CN105442054B - The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA - Google Patents
The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA Download PDFInfo
- Publication number
- CN105442054B CN105442054B CN201511021881.6A CN201511021881A CN105442054B CN 105442054 B CN105442054 B CN 105442054B CN 201511021881 A CN201511021881 A CN 201511021881A CN 105442054 B CN105442054 B CN 105442054B
- Authority
- CN
- China
- Prior art keywords
- dna
- primer
- amplification
- carried out
- egfr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method that the amplification of multiple target site is carried out to plasma DNA and builds storehouse, comprise the following steps successively:1), end is repaired and adds A;2), joint connects:Added in the DNA fragmentation that the end obtained by step 1) adds A and annealed to form the linker DNA of ring-type hairpin structure, so as to obtain both sides with reference to the double-stranded DNA after upper annular hairpin linker;As amount≤10ng of the plasma DNA of extraction purification in step 1), step 3) is carried out;Conversely, as the amount > 10ng of the plasma DNA of extraction purification in step 1), step 4) is directly carried out;3) specific primer I, Phi29 enzyme and buffer solution, are added in obtained by step 2) plus good joint DNA, carries out linear amplification;4), PCR is expanded:The amplified production forms dissociative DNA mutational site enrichment sequencing library.
Description
Technical field
The invention belongs to molecular biology, medical domain, more particularly to it is a kind of for plasma DNA or short-movie section (<
300bp) the method in DNA more sites amplification library.
Background technology
Free DNA fragmentation in the peripheral blood blood plasma of discovered in recent years human body be present, length is in 100-300bp, main collection
In near 150bp.These free DNA may be included from coming off and dead tumour cell, pregnant in tumour patient
The DNA fragmentation of fetus may be included in woman's body.It is thus certain by detecting the catastrophe of the specific site in dissociative DNA fragment
The variation situation of the specific site of tumour or fetus can be reflected in degree.It is big absolutely but the dissociative DNA fragment in blood plasma is shorter
Partly in 150-200bp or so, typically not over 300bp, and content is very low.Existing free plasma dna extracting method
Recovery rate typically in 10ng/ml blood, and 1ng dissociates human DNA containing about 150-300 part genome copies, along with blood plasma
Dissociative DNA source is various, the DNA of also a large amount of normal cells or maternal source, results in the need for the mutant DNA proportion of detection
It is very low.Recently the high throughput sequencing technologies developed rapidly can be calculated to a certain extent by the high covering sequencing to a large amount of sequences
Go out the shared ratio of these mutation.But existing two generations high throughput sequencing technologies all carry out library construction firstly the need of to DNA,
In the joint that both sides use plus sequencing, and cost is too high if all DNA fragmentations are sequenced and can cause
The covering number of plies of target zone substantially reduces.This just needs us to have a kind of method to be built to the short segment DNA of low content
Storehouse, and the section where specific enrichment or amplification mutational site, and the library construction in multiple sites can be detected simultaneously
Method.Current existing banking process includes:1) all DNA fragmentations are carried out first building storehouse, then visited using specificity capture
Library fragments (the SureSelect Target Enrichment technologies and sieve of Agilent at present where pin capture mutation section
The NimbleGen methods of family name are all the representatives of this kind of technology);2) carry out amplification using multiple PCR method and build storehouse (such as Life companies
Ion Ampliseq and Illumina TruSeq Amplicon just belong to the representative of this kind of technology).Wherein specificity capture
The mode of probe has certain requirement to DNA initial amounts, and process needs to be hybridized, and the cycle is longer (it is small to generally require 24
When more than), cost is higher, and more certain miss the target (capture section is not target zone) be present.It is and existing multiple
PCR method uses the mode of both-end specific primer, and there is also many problems, because multiplex PCR needs design, specificity is drawn
Thing, and a site at least needs to design a pair of specific primers, while to consider between the primer in the multiple sites of multiplex PCR
Interference is so design primer is usual longer (usual 30bp or so), and generally has certain distance apart from mutational site.But due to
Fragment is shorter, and mutational site is likely located at fragment ends, causes the position mistake that can be actually combined using both-end specific primer
It is short, cause the fragment of a large amount of (more than 50%) all can not effectively to expand, so as to substantially increase to DNA initial amount requirements, very
It extremely can not effectively build storehouse.Thus this area still need to one kind be applicable to this low equivalent of plasma DNA (<10ng) short-movie section (<
300bp) the DNA banking process that more site rapid amplifyings can be enriched with.
The content of the invention
Multiple target position is carried out to short segment DNAs such as plasma DNAs the technical problem to be solved in the present invention is to provide a kind of
The method that storehouse is built in point amplification, the present invention is in view of the defects of existing multiplex PCR is for design of primers and DNA fragmentation, what is provided builds
Storehouse method can not only be greatly reduced design of primers and the requirement of DNA initial amounts but also can improve amplified library efficiency.
In order to solve the above-mentioned technical problem, the present invention provides a kind of expanded to plasma DNA progress multiple target site and built
The method in storehouse, comprises the following steps successively:
1), end is repaired and adds A:
So as to obtain the DNA fragmentation that end adds A;
2), joint connects:
It is included in the end obtained by step 1) and adds to add in A DNA fragmentation and has annealed to form the joint of ring-type hairpin structure
DNA, so as to obtain both sides with reference to the double-stranded DNA (DNA for referred to as adding good joint) after upper annular hairpin linker;
The linker DNA of the ring-type hairpin structure is by ring-type joint sequence, both sides complementary series built-up (in addition to 6
The random sequence of individual base);
As amount≤10ng of the plasma DNA of extraction purification in step 1), following step 3 is carried out);
Conversely, as the amount > 10ng of the plasma DNA of extraction purification in step 1), following step 4 is directly carried out);
3) specific primer I, Phi29 enzyme and buffer solution, are added in obtained by step 2) plus good joint DNA,
36.8~37.2 DEG C (preferable 37 DEG C) carry out linear amplification 0.5~3 hour;
4), PCR is expanded:
Added in the DNA by amplification in DNA after the jointing obtained by step 2) or obtained by step 3) special
Property primer I I and universal primer and sequence measuring joints primer P5 and P7 with index, carry out 14~30 wheel PCR cycles amplifications,
Amplified production is obtained, the amplified production forms the dissociative DNA mutational site enrichment sequencing library.
Remarks:All reactions are in same reaction tube, without being shifted and being purified.
The improvement that the amplification of multiple target site is carried out to plasma DNA and builds the method in storehouse as the present invention:
This method also includes the library detection of step 5).
The further improvements in methods that the amplification of multiple target site is carried out to plasma DNA and builds storehouse as the present invention:
The step 1) is:Using NEB (New England Biolabs, knob Great Britain) end repair and add A modules ( UltraTMII End Repair/dA-Tailing Module (E7546)) to the plasma free of extraction purification
DNA carries out end reparation and adds A, so as to obtain the DNA fragmentation that end adds A.
The further improvements in methods that the amplification of multiple target site is carried out to plasma DNA and builds storehouse as the present invention:Institute
Stating step 2) is:
Added in the DNA fragmentation that the end obtained by step 1) adds A and annealed to form the linker DNA of ring-type hairpin structure,
And NEB Rapid connecting modules [ UltraTMII Ligation Module (E7595)], finally obtain both sides
With reference to the double-stranded DNA (DNA for referred to as adding good joint) after upper annular hairpin linker, wherein the ligase included can be to dissociative DNA
Or the damage of the DNA fragmentation after formalin fixation is repaired.
The further improvements in methods that the amplification of multiple target site is carried out to plasma DNA and builds storehouse as the present invention:Institute
Stating step 4) is:The gains of step 3) or step 2) by using unilateral specificity amplification primer combination opposite side general connecing
The method that head primer carries out specific PCR and mutation is judged whether after being compared by high-flux sequence.
The further improvements in methods that the amplification of multiple target site is carried out to plasma DNA and builds storehouse as the present invention:Ring
Shape hair fastener joint sequence is:PHO-CTACTTGCCTCGACATCCAGCGTGCGGACACATAACGCACTACATCATTCCGTACT
CNNNNNNCGAGGCAAGTAGT。
The further improvements in methods that the amplification of multiple target site is carried out to plasma DNA and builds storehouse as the present invention:It is special
Specific primer I is specificity amplification primer 1_EGFR_p.G598V, specificity amplification primer 1_EGFR_p.D761Y, specificity expand
Increase primer 1_KRAS_p.Q61K;
Corresponding specific primer II is specific primer 2_EGFR_p.G598V, specific primer 2_EGFR_
P.D761Y, specific primer 2_KRAS_p.Q61K.
The inventive point of the present invention is mainly reflected in (not just for as follows):
1st, the construction method of the ring-type joint sequence of step 2) and both sides complementary series;
2nd, the utilization single stranded circle structure of step 3) uses Phi29 amplification enzymes and the sequence of specific primer 1, to original
DNA sample carries out linear ring-type pre-expansion and increased.
The present invention has following technical advantage:
1) unidirectional specific primer, is only needed, so as to solve the limitation of the short bilateral design of primers of Circulating DNA fragments,
The target site at DNA fragmentation head and the tail can be detected simultaneously.
2), design of primers is simple, and a target site is only needed with a specific primer II, avoids what bilateral primer occurred
Primers complementary and mispairing.
3) unique barcade, is added in pili annulati clamping joint, it can be estimated that follow-up PCR efficiency, correct in time
PCR cycle number and subsequent data analysis.
4), compared to original capture and simple multiple PCR method either specific primer design or sample starting
Amount requirement and experimental implementation and cost are all greatly reduced.In addition specific amplification can also be carried out after single-stranded cyclisation, so as to
So that DNA initial request is greatly reduced.
Brief description of the drawings
The embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 is banking process schematic diagram;
Fig. 2 is diagram and primer sequence;
Fig. 3 is DNA testing results;
Left side is that dissociative DNA extracts testing result, right side marker, bottom for 250bp, it is seen that DNA is respectively positioned on
Below 250bp;
Fig. 4 is the electrophoresis result that this method builds PCR primer behind storehouse;
Left side is the library production after the completion of PCR, right side marker, and the band of the top is 500bp, 2 of lower section
Bright band is 300 and 250bp;
Fig. 5 is this method and other method contrast and experiment.
Urine sample library production after the completion of respectively marker from left to right, PCR, marker, and build storehouse completion
Tumour formalin fixed samples library afterwards, marker centres bright wisp band is 500bp, and the bright band of lower section is 300bp.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, it is right below in conjunction with drawings and Examples
The present invention is further elaborated.It should be appreciated that specific embodiment described herein is only to explain the present invention, not
For limiting the present invention.
The present invention carries out the preposition preparation process of multiple target site amplification banking process to plasma DNA:
1st, 5ml plasma samples are chosen, use QIAamp Circulating Nucleic Acid Kit (Qiagen
55114) free plasma dna, is extracted according to kit method, it is final to obtain 100ul elution volumes about 100ng total amount dissociative DNAs
Fragment.For detection, the present invention builds storehouse effect to low equivalent DNA, takes above-mentioned DNA solution 10ul, adds water 40ul to 50ul volumes,
DNA total amounts are 10ng as subsequent step sample.
2nd, by the dry powder-shaped joint sequence of synthesis, it is dissolved in water, is warming up to 98 DEG C of 1min, Temperature fall to room temperature, annealing
Pili annulati clamping header sequence, and make ultimate density be 15uM.
3rd, the tri- mutation positions of p.Q61K of the present embodiment to p.G598V and p.D761Y and the KRAS gene of EGFR gene
Point is detected, and synthetic primer sees attached list 1.
Embodiment 1, amplification banking process in multiple target site is carried out to plasma DNA, followed the steps below successively:
1), end is repaired and adds A
Prepare reaction mixture according to the proportioning of table 1 below, gently inhaled up and down with rifle and blow mixing, used
UltraTMII End Repair/dA-Tailing Module (E7546) include NEBNext Ultra II End Prep
Enzyme Mix and NEBNext Ultra II End Prep Reaction Buffer two parts, originate the model of dissociative DNA amount
It is trapped among 500pg-1ug (being, for example, 10ng).
Table 1
NEBNext Ultra II End Prep Enzyme Mix | 3ul |
NEBNext Ultra II End Prep Reaction Buffer | 7ul |
Dissociative DNA obtained by above-mentioned preparation process | 50ul |
Total | 60ul |
It is positioned in PCR instrument, sets program to react:
Top cover temperature >=75 DEG C are set
20℃30min
65℃30min
4 DEG C of preservations;
Obtain the DNA fragmentation that end adds A.
2), joint connects:
Prepare reaction mixture according to the proportioning of table 2 below, gently inhaled up and down with rifle and blow mixing.
In order to promote cyclisation (improving joint joint efficiency), according to starting DNA (the starting dissociative DNA in above-mentioned steps 1)
Amount difference, it is necessary to allocate the joint of various concentrations, such as (dilution uses 10mMTris-HCl or 10mMTris-HCl to table 2
Add 10mMNaCl):
Table 2
Originate DNA | Dilution ratio | Joint concentration |
1μg–101ng | Do not dilute | 15μM |
100ng–5ng | 10 times (1:10) | 1.5μM |
Less than 5ng | 25 times (1:25) | 0.6μM |
Use UltraTMII Ligation Module (E7595) include NEBNext Ultra II
Ligation Master Mix and NEBNext Ligation Enhancer;Reaction system is as described in Table 3.
Table 3
The sequence of pili annulati clamping joint is as described in Table 7.
In 20 DEG C of Constant temperature hatchs 15 minutes, 37 DEG C of Constant temperature hatchs 15 minutes afterwards;The DNA of joint must have been added.
3), Phi29 specific amplifications (optional, when starting DNA is less than 10ng)
Prepare reaction mixture according to the proportioning of table 4 below, gently inhaled up and down with rifle and blow mixing.
Table 4
phi29 DNA Polymerase(10U/μL)Thermo ScientificTM EP0091 | 1ul |
Phi29 enzymes and buffer solution | 99ul |
DNA after step 2 jointing | 100ul |
The mixing pit of specificity amplification primer 1 (for each primer etc. than mixing, mix primer concentration is 0.5uM) | 1ul |
Specificity amplification primer 1 is as described in Table 7.
Linear amplification is carried out at 37 DEG C and (works as DNA content within 0.5 hour<During 1ng, proliferation time can increase to 2 hours).
Now gains meet the condition for carrying out the 4th step PCR amplifications.
That is, it is obtained by step 2) plus good joint as the amount > 10ng of the plasma DNA of extraction purification in step 1)
DNA has met the condition of the 4th step PCR amplifications.
4), PCR is expanded
Prepare reaction mixture according to the proportioning of table 5 below, gently inhaled up and down with rifle and blow mixing.
Table 5
2X KAPA HiFiHotstart Ready Mix(KAPA KK2602) | 25ul |
Specific primer 2 and universal joint primer mixture (each 0.1uM) | 1ul |
P5/P7 primer mixtures (each 10uM) | 1ul |
DNA (or step 2DNA) after step 3 jointing | 23ul |
Total | 50ul |
Above-mentioned specific primer 2, universal joint primer, P5/P7 primers are as described in Table 7.
PCR instrument is put into, according to the form below 6 sets program to react
Table 6
5), library detection
PCR primer in step 4) is diluted to 2ng/ul, 1ul is taken out and carries out detected through gel electrophoresis, the library of structure is total
Length is in 200-350bp or so;In addition, further taking out 1ul is used for qPCR detection limits, and it is dense according to library fragments length computation library
Degree (that is, when library concentration reach more than 2nmol/ul as qualified).
Above involved Primer and particular sequence are as described in Table 7.
Table 7
Wherein PHO represents 5 ' phosphorylation modifications, and -3 ' AminolinkerC7 represents 3 ' aminations modification, and N represents random alkali
Base ,-s- represent thio-modification.
As can be seen from the above description, the present invention realizes following technique effect:
1) present invention adds designed pili annulati clamping header sequence in dissociative DNA fragment, is attached with reference to rear shape
Into single stranded circle structure, and ring-type junction portion introduces the universal primer sequence available for amplification, and after adding and being used for
The barcode sequences of continuous unimolecule copy counting number, the shadow of PCR amplification-free preference is kept away when can subsequently calculate the frequency of mutation
Ring.
2) because DNA forms single stranded circle DNA, by adding 3, ' specific primer and Phi29 enzymes after modification, can
To be replicated by the quick ring-types of RDA so as to solve the problems, such as that low initial amount DNA's builds storehouse.
3) due to the universal primer joint of introducing so that only need to consider unilateral specific primer during design multiplex PCR,
So as to greatly reduce the difficulty of design of primers and deviation, the present invention can according to the different designs specific primer of detector segments,
Specific primer design only needs to ensure its annealing temperature between 60-65 DEG C, between primer and itself be not present hairpin structure or
Complementation is formed, and primer can specifically bind target site.And all reactions are carried out in a reaction tube, are avoided
Pollution and loss caused by purifying and shifting sample repeatedly.
4) entirely experiment and reaction need 3.5 hours altogether.If specific primer design is carried out to be only capable of combining mutant nucleotide sequence
The mutation specific amplimer of amplification, you can only carry out amplification to being mutated so as to only need to observe PCR with the presence or absence of expansion to realize
Volume increase thing can be qualitatively judged with the presence or absence of mutation.
5) compared to it is original capture and section is set using the multiple PCR method either specific primer of pair of primers
Meter or the requirement of sample initial amount and experimental implementation and cost are all greatly reduced.In addition can also be to target after single-stranded cyclisation
Section carries out specific amplification, so that being greatly reduced to DNA initial request.In addition this method will not be carried out to long segment
Amplification, it can effectively avoid the interference of DNA long fragment discharged such as the blood cell breakage adulterated in dissociative DNA such as.
The scheme provided according to above-described embodiment 1, has specifically carried out following experiment:
Experiment one
1. the dissociative DNA in table 1 is plasma DNA, concentration 2ng/ul;
2. the joint concentration in table 2 is 1.5uM;
3. without the step 3 of primer amplified;What the specificity amplification primer 2 in table 5 was selected is that specificity is drawn
Thing 2_EGFR_p.G598V, specific primer 2_EGFR_p.D761Y and specific primer 2_KRAS_p.Q61K;
The PCR primer of gained is diluted to 2ng/ul, 1ul is taken out and carries out detected through gel electrophoresis, testing result such as Fig. 4 institutes
Show, the library total length of structure is in 250bp or so;The electrophoresis detection result of original plasma DNA is shown in Fig. 3.
Experiment two
1. the DNA in table 1 is tumour formalin fixed samples DNA, concentration 15ng/ul;
2. the joint concentration in table 2 is 1.5uM;
3. without the step 3 of primer amplified;What the specificity amplification primer 2 in table 5 was selected is that specificity is drawn
Thing 2_EGFR_p.G598V and specific primer 2_KRAS_p.Q61K;
The PCR primer of gained is diluted to 2ng/ul, 1ul is taken out and carries out detected through gel electrophoresis, testing result such as Fig. 5 institutes
Show, the library total length of structure is in 290bp or so.
Experiment three
1. the DNA in table 1 is urine sample DNA, concentration 3ng/ul;
2. the joint concentration in table 2 is 1.5uM;
3. without the step 3 of primer amplified;What the specificity amplification primer 2 in table 5 was selected is that specificity is drawn
Thing 2_EGFR_p.D761Y and specific primer 2_KRAS_p.Q61K;
The PCR primer of gained is diluted to 2ng/ul, 1ul is taken out and carries out detected through gel electrophoresis, testing result such as Fig. 5 institutes
Show, the library total length of structure is in 320bp or so.
Contrast experiment 1, the double-strand that the linker DNA of ring-type hairpin structure used in above-mentioned experiment 1 is made into equal sequence
DNA joints, remaining is equal to experiment 1;
Acquired results are:Product can be amplified, but product length is risen to based on 280bp.Sent out by sequencing data
Existing, only 5% data come from primer amplified product, and remaining is the sequencing product that all dissociative DNAs add joint.And
The data 99% obtained in above-mentioned experiment 1 are all from the product of primer amplified acquisition.
Finally, it is also necessary to it is noted that listed above is only several specific embodiments of the invention.Obviously, this hair
It is bright to be not limited to above example, there can also be many deformations.One of ordinary skill in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
Claims (5)
1. pair plasma DNA carries out the method that storehouse is built in the amplification of multiple target site, it is characterized in that comprising the following steps successively:
1), end is repaired and adds A:
So as to obtain the DNA fragmentation that end adds A;
2), joint connects:
It is included in the end obtained by step 1) and adds to add in A DNA fragmentation and has annealed to form the linker DNA of ring-type hairpin structure,
So as to obtain both sides with reference to the double-stranded DNA after upper annular hairpin linker;
The linker DNA of the ring-type hairpin structure is built-up by ring-type joint sequence, both sides complementary series;
As amount≤10ng of the plasma DNA of extraction purification in step 1), following step 3 is carried out);
Conversely, as the amount > 10ng of the plasma DNA of extraction purification in step 1), following step 4 is directly carried out);
3) specific primer I, Phi29 enzyme and buffer solution, are added in obtained by step 2) plus good joint DNA, 36.8~
37.2 DEG C carry out linear amplification 0.5~3 hour;
4), PCR is expanded:
Specificity is added in the DNA by amplification in DNA after the jointing obtained by step 2) or obtained by step 3) to draw
Thing II and universal primer and sequence measuring joints primer P5 and P7 with index, 14~30 wheel PCR cycle amplifications are carried out, are obtained
Amplified production, the amplified production form dissociative DNA mutational site enrichment sequencing library;
Pili annulati clamping header sequence is:PHO-CTACTTGCCTCGACATCCAGCGTGCGGACACATAACGCACTACATCATTC
CGTACTCNNNNNNCGAGGCAAGTAGT;
Specific primer I is specificity amplification primer 1_EGFR_p.G598V, specificity amplification primer 1_EGFR_p.D761Y, spy
Specific amplification primers 1_KRAS_p.Q61K;
Corresponding specific primer II is specific primer 2_EGFR_p.G598V, specific primer 2_EGFR_p.D761Y, spy
Specific primer 2_KRAS_p.Q61K;
Specificity amplification primer 1_EGFR_p.G598V:
TCTTCCTTCTCTCTCTGTCATAGGG-3‘AminolinkerC7;
Specificity amplification primer 1_EGFR_p.D761Y:
GGGCATGAACTACTTGGAGGAC-3‘AminolinkerC7;
Specificity amplification primer 1_KRAS_p.Q61K:
TCCTCATGTACTGGTCCCTCA-3‘AminolinkerC7;
Specific primer 2_EGFR_p.G598V:
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTTCCTTCTCTCTCTGTCATAGGG;
Specific primer 2_EGFR_p.D761Y:
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGCATGAACTACTTGGAGGAC;
Specific primer 2_KRAS_p.Q61K:
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCATGTACTGGTCCCTCA。
2. the method according to claim 1 that the amplification of multiple target site is carried out to plasma DNA and builds storehouse, it is characterized in that:
This method also includes the library detection of step 5).
3. the method according to claim 1 or 2 that the amplification of multiple target site is carried out to plasma DNA and builds storehouse, its feature
It is:
The step 1) is:Repaired using NEB end and add A modules to carry out end to the plasma DNA of extraction purification and repaiied
Again and add A, so as to obtain the DNA fragmentation that end adds A.
4. the method according to claim 1 or 2 that the amplification of multiple target site is carried out to plasma DNA and builds storehouse, its feature
It is:
The step 2) is:
Added in the DNA fragmentation that the end obtained by step 1) adds A and annealed to form the linker DNA of ring-type hairpin structure, and
NEB Rapid connecting modules, the final both sides that obtain combine the double-stranded DNA after upper annular hairpin linker, wherein the ligase included can
The damage of DNA fragmentation after being fixed to dissociative DNA or formalin is repaired.
5. the method according to claim 1 or 2 that the amplification of multiple target site is carried out to plasma DNA and builds storehouse, its feature
It is:
The step 4) is:The gains of step 3) or step 2) are by using unilateral specificity amplification primer combination opposite side
The method that universal joint primer carries out specific PCR and mutation is judged whether after being compared by high-flux sequence.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201511021881.6A CN105442054B (en) | 2015-11-19 | 2015-12-30 | The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510808728 | 2015-11-19 | ||
CN2015108087281 | 2015-11-19 | ||
CN201511021881.6A CN105442054B (en) | 2015-11-19 | 2015-12-30 | The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105442054A CN105442054A (en) | 2016-03-30 |
CN105442054B true CN105442054B (en) | 2018-04-03 |
Family
ID=55552671
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201511021881.6A Active CN105442054B (en) | 2015-11-19 | 2015-12-30 | The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105442054B (en) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105926043B (en) * | 2016-04-19 | 2018-08-28 | 苏州贝康医疗器械有限公司 | A method of improving fetus dissociative DNA accounting in pregnant woman blood plasma dissociative DNA sequencing library |
CN106047998B (en) * | 2016-05-27 | 2019-11-12 | 深圳市海普洛斯生物科技有限公司 | A kind of detection method and application of lung cancer gene |
US11674137B2 (en) | 2016-05-27 | 2023-06-13 | Haplox Biotechnology (Shenzhen) Co., Ltd. | Adaptor for sequencing DNA at ultratrace level and use thereof |
CN106048008A (en) * | 2016-06-03 | 2016-10-26 | 人和未来生物科技(长沙)有限公司 | EGFR gene ultralow frequency mutation detection kit |
CN107488656B (en) | 2016-06-13 | 2020-07-17 | 陆欣华 | Nucleic acid isothermal self-amplification method |
CN108070586A (en) * | 2016-11-18 | 2018-05-25 | 杭州拓宏生物科技有限公司 | Pcr amplification primer and its application |
CN108624584A (en) * | 2017-03-16 | 2018-10-09 | 上海融享生物科技有限公司 | A kind of library constructing method for the detection of ctDNA low frequencies |
CN106835292B (en) * | 2017-04-05 | 2019-04-09 | 北京泛生子基因科技有限公司 | The method of one-step method rapid build amplification sublibrary |
CN107541791A (en) * | 2017-10-26 | 2018-01-05 | 中国科学院北京基因组研究所 | Construction method, kit and the application in plasma DNA DNA methylation assay library |
CN108004301B (en) * | 2017-12-15 | 2022-02-22 | 格诺思博生物科技南通有限公司 | Gene target region enrichment method and library construction kit |
CN109971827B (en) * | 2019-03-25 | 2020-05-01 | 纳昂达(南京)生物科技有限公司 | Method and kit for constructing blood plasma DNA library |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8383345B2 (en) * | 2008-09-12 | 2013-02-26 | University Of Washington | Sequence tag directed subassembly of short sequencing reads into long sequencing reads |
CN102212612A (en) * | 2011-03-23 | 2011-10-12 | 上海美吉生物医药科技有限公司 | Constructing method of double-end library for high throughput 454 sequencing |
US20150126376A1 (en) * | 2012-06-14 | 2015-05-07 | Fred Hutchinson Cancer Research Center | Compositions and methods for sensitive mutation detection in nucleic acid molecules |
CN104695027B (en) * | 2013-12-06 | 2017-10-20 | 中国科学院北京基因组研究所 | Sequencing library and its preparation and application |
-
2015
- 2015-12-30 CN CN201511021881.6A patent/CN105442054B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN105442054A (en) | 2016-03-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105442054B (en) | The method that storehouse is built in the amplification of multiple target site is carried out to plasma DNA | |
CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
CN108004301B (en) | Gene target region enrichment method and library construction kit | |
CN106906211B (en) | Molecular joint and application thereof | |
CN107541791A (en) | Construction method, kit and the application in plasma DNA DNA methylation assay library | |
WO2020140693A1 (en) | Gene target region enrichment method and kit | |
CN110409001A (en) | The method and kit in a kind of building capture library | |
CN110760936B (en) | Method for constructing DNA methylation library and application thereof | |
WO2023071889A1 (en) | Methylation biomarker related to detection of gastric cancer lymph node metastasis, or combination thereof and use thereof | |
CN109536579A (en) | The construction method of single-stranded sequencing library and its application | |
WO2017202389A1 (en) | Adapter suitable for ultra-trace dna sequencing, and application thereof | |
WO2018184495A1 (en) | Method for constructing amplicon library through one-step process | |
WO2017143866A1 (en) | Kit and method for quantitative detection of dna methylation in rprm genes | |
CN108998508A (en) | The construction method and primer sets and kit of amplicon sequencing library | |
CN103571822B (en) | A kind of multipurpose DNA fragmentation enriching method analyzed for new-generation sequencing | |
WO2024146481A1 (en) | Dna methylation library construction method and library obtained with same, dna hybridization capture method and kit | |
EP3643789A1 (en) | Pcr primer pair and application thereof | |
CN110592200B (en) | Multiplex PCR method for improving amplification specificity and uniformity | |
CN111575347A (en) | Method for constructing library for simultaneously obtaining free DNA methylation and fragmentation pattern information in plasma | |
CN109337956B (en) | Design method and kit for enriching multi-gene stem-loop probe based on NGS technology | |
CN108103143B (en) | Method for constructing multiple PCR and rapid library in target region | |
WO2019227331A1 (en) | Method for constructing variable region sequence library, sequencing method, and kit thereof | |
WO2021018127A1 (en) | Library creation method and application | |
TW201321520A (en) | Method and system for virus detection | |
CN114005490B (en) | Circulating tumor DNA fusion detection method based on second-generation sequencing technology |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |