WO2018133546A1 - CONSTRUCTION METHOD, DETECTION METHOD AND KIT FOR NON-INVASIVE PRENATAL FETAL α-THALASSEMIA GENE MUTATION DETECTION LIBRARY - Google Patents

Abstract

Disclosed are a construction method, a detection method and a kit for a non-invasive prenatal fetal α-thalassemia gene mutation detection library. In the construction method for the library, a specific linker is ligated to a free DNA fragment in the maternal peripheral blood, and the pre-amplification product of the linker ligation product is then divided into two parts, and two rounds of specific amplification are respectively carried out independently using upstream and downstream primers for a target site, and the target site can be enriched with a high specificity, and the amplification specificity of the primers can be significantly improved. In addition, two rounds of specific amplification are respectively carried out using upstream and downstream primer sets for multiple SNP sites for calculating the proportion of free fetal DNA, and the fetal DNA proportion can be efficiently and accurately calculated. Sequencing the library can accurately and efficiently detect the α-thalassemia gene mutation, and the results thereof are consistent with those of the amniocentesis detection genotyping; however, in terms of safety, non-invasiveness and high-efficiency, the method is significantly better than the amniocentesis detection.

Description

Non-invasive prenatal fetal alpha thalassemia gene mutation detection library construction method, detection method and kit Technical field

The invention relates to the field of gene detection technology, in particular to a method, a detection method and a kit for constructing a non-invasive prenatal fetal alpha thalassemia gene mutation detection library.

Background technique

Thalassemia (referred to as thalassemia) is one of the high incidence genetic diseases in the world. It is due to the mutation or deletion of human genes, resulting in an imbalance of the synthesis rate of α,β-globin peptide chains, resulting in hemolytic anemia. Two common types of thalassaemia are α-thalassemia and β-thalassemia, α-thalassemia-related genes are HBA2 and HBA1, and β-thalassaemia-related genes are HBB. The thalassemia is concentrated in the tropical and subtropical regions, mostly in the Mediterranean countries, followed by the Middle East, India, Pakistan, Southeast Asia, South China and North Africa. The United States is an immigrant country with a high incidence. The provinces south of the Yangtze River are high-risk areas for thalassaemia, with more than 200 million people affected by Guangdong, Guangxi, Hainan, Taiwan and Hong Kong. Among the Chinese population, α-thalassemia genotypes are commonly found as -α ^SEA , -α3.7, -α4.2, α ^CS , α ^QS and α ^WS , and 26 gene mutations are common in β-thalassemia. do not. At present, there is no cure for thalassaemia. It can only rely on traditional methods of treatment, that is, blood transfusion therapy is the main method, and the price is expensive. Therefore, prenatal screening and diagnosis are of great significance for preventing such birth defects.

In 1997, Lu Yuming discovered that there is free DNA from the fetus in peripheral blood of pregnant women. This finding provides a new possibility for non-invasive prenatal diagnosis and detection of embryonic genotypes in pregnant women's peripheral blood. With the application of high-throughput sequencing technology, Non-invasive prenatal detection of embryonic chromosomal abnormalities (such as 21, 18, and 13 chromosome aneuploidy variants) and partial large copy number variation have been successfully applied to clinical prenatal screening and diagnosis, but fetal free DNA in pregnant women only accounts for maternal plasma. 3%-6% of the total free DNA poses a challenge for the detection of fetal non-invasive hereditary diseases.

Researchers have been trying to detect fetal thalassemia genes through the free DNA of pregnant women's peripheral blood. Because there are a large number of maternal free DNA in the peripheral blood of pregnant women, how to effectively distinguish the mutations of embryonic genes, the sensitivity of the detection method is very high. Requirements. At present, there are several methods for prenatal detection of thalassemia gene mutations: traditional amniocentesis, abdominal villus biopsy, etc., due to traumatic operation, may be associated with fetal injury, miscarriage or intrauterine infection. Non-invasive prenatal diagnosis using free fetal DNA in maternal plasma has also been studied. Chiu RW achieves efficient detection of the father-derived codons 41/42 4bp deletion by using real-time fluorescent PCR technology, and researchers have developed detection methods for other β-thalassaemia mutations, but since the detection mutations are mostly point mutations, The specificity of the method needs to be improved. Studies on alpha-thalassemia mutations have also been reported. Warunee Tungwiwat et al. established a method for detecting α ⁰ deletions based on real-time PCR, but the sensitivity of this method needs to be improved. In addition, a variety of high-sensitivity techniques have also been tried for non-invasive depletion detection, such as mass spectrometry, digital PCR, COLD-PCR, and the like. However, the detection methods based on single-site PCR technology have certain limitations, such as low plasma DNA content and high fragmentation characteristics, which may bring false negative PCR. This method can only detect the presence of a specific paternal mutation different from the mother, and cannot further determine the presence or absence of the maternal mutation. Whole-genome sequencing or target region capture sequencing of maternal plasma free DNA based on high-throughput sequencing technology can more accurately detect fetal thalassemia genes, but the cost of genome-wide sequencing and the complexity of analytical methods and the need for parental monomers Types and the like limit the clinical application; target region capture sequencing can only achieve the differentiation of the fetal α ^SEA deletion pure heterozygous type due to the low capture efficiency of the target region, and there is also the possibility of typing errors. In view of this, it is necessary to provide a high-precision non-invasive prenatal fetal thalassemia gene mutation detection method.

Summary of the invention

The invention provides a method, a detection method and a kit for constructing a non-invasive prenatal fetal alpha thalassemia gene mutation detection library, which can accurately and efficiently detect the alpha thalassemia gene mutation, and the result is consistent with the amniocentesis detection type, but Safety, non-invasiveness and high efficiency are significantly better than amniocentesis.

According to a first aspect of the present invention, the present invention provides a method for constructing a non-invasive prenatal fetal alpha-type thalassemia gene mutation detection library for detecting non-invasive prenatal fetal alpha-type thalassemia gene mutation by high-throughput sequencing The above methods include:

(a) a linker sequence having a specific tag sequence and an optional sample tag sequence for maternal peripheral blood free DNA ligation;

(b) pre-librarian amplification of the ligation product of the previous step using a pre-library amplification primer sequence, wherein the pre-library amplification primer sequence is complementary to the linker sequence;

(c) dividing the pre-library obtained in the previous step into an upstream pre-library and a downstream pre-library, and specifically amplifying the upstream pre-library and the downstream pre-library using the upstream specific primer set 1 and the downstream specific primer set 1, respectively. The upstream specific amplification product 1 and the downstream specific amplification product 1 are respectively obtained.

Wherein, the upstream specific primer set 1 includes an upstream primer set 1 for amplifying the α-thalassemia gene and an upstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio; the above-mentioned downstream specific primer set 1 comprising a downstream primer set 1 for amplifying a thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio;

(d) specifically amplifying the upstream specific amplification product 1 and the downstream specific amplification product 1 using the upstream specific primer set 2 and the downstream specific primer set 2, respectively, to obtain upstream specific amplification products, respectively. 2 and downstream specific amplification product 2,

Wherein the upstream specific primer set 2 includes an upstream primer set 2 for amplifying the α-thalassemia gene and an upstream primer set 2 for calculating a plurality of SNP sites of a fetal free DNA ratio; the above-mentioned downstream specific primer set 2 comprising a downstream primer set 2 for amplifying the alpha thalassemia gene and a downstream primer set 2 for calculating a plurality of SNP sites of fetal free DNA ratio;

Furthermore, the upstream specific primer set 2 is closer to the corresponding amplification target position than the upstream specific primer set 1 described above. Point, the downstream specific primer set 2 is closer to the corresponding amplification target site than the downstream specific primer set 1; the upstream specific primer set 2 and the 5' end of the downstream specific primer set 2 are contained for a linker sequence of a high throughput sequencing library;

(e) The upstream specific amplification product 2 and the downstream specific amplification product 2 are mixed, and then amplified using universal primers at both ends to obtain a library which can be sequenced by the machine.

Further, the 5' end of the upstream specific primer set 1 and the downstream specific primer set 1 described above are provided with a modification for isolating the amplification product, preferably with a biotin modification.

Further, the 3' end of the primer for the specific target site in the upstream specific primer set 1 and the 5' end of the primer corresponding to the target site in the upstream specific primer set 2 are 10-15 bases Coincident; the 3' end of the primer for the specific target site in the downstream specific primer set 1 and 10-15 bases from the 5' end of the primer for the target site in the downstream specific primer set 2 described above Coincident.

Further, the above upstream primer set 1 sequence for amplifying the α-thalassemia gene is as shown in SEQ ID NOs: 1-7;

The upstream primer set 1 sequence of the above plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOS: 8-17;

The sequence of the downstream primer set 1 for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 18-23;

The sequence of the downstream primer set 1 of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NO: 24-33;

The above upstream primer set 2 sequence for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 34-40;

The upstream primer set 2 sequence of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 41-50;

The sequence of the downstream primer set 2 for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 51-56;

The sequence of the downstream primer set 2 of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 57-66.

According to a second aspect of the present invention, the present invention provides a non-invasive prenatal fetal alpha thalassemia gene mutation detecting method comprising performing high-throughput sequencing of a library constructed by the method of the first aspect to obtain a sequencing read read; Based on the total depth of the unique specific tag sequence of the site and the depth of the allele of the mutation, the fetal DNA content was calculated and the thalassemia-related mutation was typed to analyze the alpha-thalassemia gene mutation.

According to a third aspect of the present invention, the present invention provides a non-invasive prenatal fetal alpha thalassemia gene mutation detection library construction kit for performing non-invasive prenatal fetal alpha thalassemia gene mutation by high-throughput sequencing For testing, the above kits include:

(a) upstream specific primer set 1 and downstream specific primer set 1 for upstream pre-library and downstream pre-library, respectively Specific amplification is performed to obtain upstream specific amplification product 1 and downstream specific amplification product 1, respectively.

Wherein, the upstream specific primer set 1 includes an upstream primer set 1 for amplifying the α-thalassemia gene and an upstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio; the above-mentioned downstream specific primer set 1 comprising a downstream primer set 1 for amplifying a thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio;

(b) upstream specific primer set 2 and downstream specific primer set 2, respectively, for specifically amplifying the above upstream specific amplification product 1 and downstream specific amplification product 1 respectively to obtain upstream specific expansion Product 2 and downstream specific amplification product 2,

Wherein the upstream specific primer set 2 includes an upstream primer set 2 for amplifying the α-thalassemia gene and an upstream primer set 2 for calculating a plurality of SNP sites of a fetal free DNA ratio; the above-mentioned downstream specific primer set 2 comprising a downstream primer set 2 for amplifying the alpha thalassemia gene and a downstream primer set 2 for calculating a plurality of SNP sites of fetal free DNA ratio;

Further, the upstream specific primer set 2 is closer to the corresponding amplification target site than the upstream specific primer set 1, and the downstream specific primer set 2 is closer to the corresponding amplification than the downstream specific primer set 1 Target site; the upstream specific primer set 2 and the 5' end of the downstream specific primer set 2 described above contain a linker sequence for a high throughput sequencing library.

Further, the 5' end of the upstream specific primer set 1 and the downstream specific primer set 1 described above are provided with a modification for isolating the amplification product, preferably with a biotin modification.

Further, the 3' end of the primer for the specific target site in the upstream specific primer set 1 and the 5' end of the primer corresponding to the target site in the upstream specific primer set 2 are 10-15 bases Coincident; the 3' end of the primer for the specific target site in the downstream specific primer set 1 and 10-15 bases from the 5' end of the primer for the target site in the downstream specific primer set 2 described above Coincident.

Further, the above upstream primer set 1 sequence for amplifying the α-thalassemia gene is as shown in SEQ ID NOs: 1-7;

The upstream primer set 1 sequence of the above plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOS: 8-17;

The sequence of the downstream primer set 1 for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 18-23;

The sequence of the downstream primer set 1 of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NO: 24-33;

The above upstream primer set 2 sequence for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 34-40;

The upstream primer set 2 sequence of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 41-50;

The sequence of the downstream primer set 2 for amplifying the alpha thalassemia gene is shown in SEQ ID NOs: 51-56;

The sequence of the downstream primer set 2 of the above plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 57-66.

Further, the kit further includes:

(c) a linker sequence with a specific tag sequence and an optional sample tag sequence for ligation of maternal peripheral blood free DNA to obtain a ligation product;

(d) a pre-library amplification primer sequence which is complementary to the above-described linker sequence for pre-library amplification of the above-described ligation product;

(e) a universal primer for amplifying the mixed product after mixing the upstream specific amplification product 2 and the downstream specific amplification product 2 to obtain a library which can be sequenced on the machine;

Preferably,

The above linker sequences are shown in SEQ ID NOs: 67-68;

The above pre-library amplification primer sequences are shown in SEQ ID NOs: 69-70;

The above universal primers are shown in SEQ ID NOs: 71-72.

The method and kit of the invention can construct a library for detection of alpha thalassemia gene mutation by using maternal free plasma DNA as a raw material, and realize detection of alpha thalassemia gene mutation by high-throughput sequencing of the library (including -α ^SEA , -α ^3.7 , -α ^4.2 , α ^CS , α ^QS , α ^WS mutation detection). The key is that in the library construction, a specific linker is ligated to the free DNA fragment of the maternal peripheral blood, and then the pre-amplification product of the linker ligation product is creatively divided into two parts, which are used independently for the target site (such as α-type thalassemia). The upstream and downstream primers of the gene are subjected to two rounds of specific amplification, which can highly enrich the target site and significantly increase the specificity of primer amplification. And during the amplification process, the upstream primer set and the downstream primer set for calculating a plurality of SNP sites of the fetal free DNA ratio are respectively used for amplification. Specifically, different primers are also used for the SNP site for two rounds of specificity. Sexual amplification can efficiently and accurately calculate the fetal DNA content. Thus, after high-throughput sequencing, the fetal DNA content can be calculated based on the sequencing read length and the thalassemia-related mutations can be classified to effectively distinguish the mutations of the embryonic gene.

Further, the inventors have designed highly efficient primers specifically for thalassemia genes, as well as primers for calculating multiple SNP sites of fetal DNA ratio. Using the library construction method of the present invention, it is preferred to accurately and efficiently detect alpha-thalassemia gene mutations (including -α ^SEA , -α ^3.7 , -α ^4.2 , α) using the primer sequence set provided by the present invention. ^CS , α ^QS , α ^WS mutation detection), the results are consistent with the amniocentesis test classification, but the safety, non-invasive and high efficiency is significantly better than amniocentesis.

DRAWINGS

1 is a method for constructing a non-invasive prenatal fetal alpha thalassemia gene mutation detection library and a mutation detecting method according to an embodiment of the present invention; Schematic diagram of the process;

2 is a schematic diagram showing the relative positional relationship between the upstream and downstream specific primers, the universal primers and the template in the embodiment of the present invention;

3 is a 2% gel electrophoresis detection map of a pre-library (a) and a final library (b) for detection of non-invasive prenatal fetal alpha thalassemia gene mutation according to an embodiment of the present invention, M represents Marker, and A1-A6 represents 6 An exemplary sample.

detailed description

The present invention will be further described in detail below with reference to the accompanying drawings.

As shown in FIG. 1 , a method for constructing a non-invasive prenatal fetal alpha thalassemia gene mutation detection library according to an embodiment of the present invention includes the steps of:

S1: A linker sequence with a specific tag sequence and an optional sample tag sequence is ligated to the parental peripheral blood free DNA.

The parental peripheral blood free DNA, that is, the peripheral blood free DNA of pregnant women, including maternal blood free DNA and fetal-derived free DNA. The linker sequence carries a specific tag sequence, which can be a random sequence of n (eg, 8 or 10) bases in length, such that each linker sequence is different from the other linker sequences, that is, the linker sequence is In order to distinguish the free DNA of the maternal peripheral blood, the free DNA fragments of each parental blood bank have a specific linker sequence, which facilitates the differentiation of different maternal peripheral blood free DNA fragments in the sequence information analysis after subsequent sequencing. Because high-throughput sequencing produces massive amounts of sequencing data each time, sample pooling of different sources (eg, peripheral blood free DNA from different maternal sources) is often sequenced, so the linker sequence can also With a sample tag sequence (index), it is used to distinguish samples from different sources.

S2: Pre-library amplification of the ligation product of the previous step using a pre-library amplification primer sequence, wherein the pre-library amplification primer sequence is complementary to the linker sequence.

Pre-library amplification (or "pre-amplification") is performed to increase the amount of linker ligation product, as some of the molecules in the linker ligation product may have a lower copy number and are specifically amplified in subsequent partitions. At these times, these molecules with low copy number may not be efficiently amplified, and pre-amplification increases the amount of linker ligation products, so that molecules of various copy numbers can be efficiently amplified.

S3: The pre-library obtained in the previous step is divided into an upstream pre-library and a downstream pre-library, and the upstream pre-library and the downstream pre-library are specifically amplified by using the upstream specific primer set 1 and the downstream specific primer set 1, respectively, respectively. Upstream specific amplification product 1 and downstream specific amplification product 1.

In the present invention, the pre-library is divided into an upstream pre-library and a downstream pre-library for two rounds of specific amplification, which can significantly increase the specificity of primer amplification. The beneficial effects of separate independent amplification on the upstream and downstream include: on the one hand, upstream specific primers and downstream specific primers need to be closer to the amplification target site due to the second generation high-throughput sequencing read shorts (or Target region), it is difficult to effectively amplify the target fragment without separation, and independent amplification of the upstream and downstream can effectively amplify the target fragment; on the other hand, independent amplification of the upstream and downstream can retain the linker sequence at one end of the sequence. Easy for subsequent high-throughput measurements The progress of the order.

In the embodiment of the present invention, the amplification target site (or target region) includes two types of thalassemia gene and a plurality of SNP sites for calculating fetal DNA ratio, and correspondingly, upstream specific primer set 1 and downstream specific The primer set 1 also includes two primers respectively, that is, the upstream specific primer set 1 includes: an upstream primer set 1 for amplifying the α-thalassemia gene and a plurality of SNP sites for calculating a fetal free DNA ratio. The upstream primer set 1; the downstream specific primer set 1 includes a downstream primer set 1 for amplifying the α-thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of the fetal free DNA ratio.

2 shows the upstream primer set 1 (USP1) for amplifying the α-thalassemia gene and the downstream primer set 1 (DSP1) for amplifying the α-thalassemia gene in combination with the template in the embodiment of the present invention. Relative positional relationship. It can be seen that USP1 and DSP1 are located at the left and right sides of the amplification target site, or the detection point (ie, the α-type thalassemia gene mutation). Generally, the 3' end of USP1 and DSP1 are closer to the detection point. For example, a few bases, a distance of a dozen bases, one of the reasons is that the second-generation high-throughput sequencing reads shorter, such as about 100bp, if the USP1 and DSP1 3' end distance detection point In the far distance, it may be that the second generation high-throughput sequencing cannot effectively detect the detection points. The relative positional relationship of the upstream and downstream specific primers to the template binding of the plurality of SNP sites for calculating the fetal free DNA ratio is the same as that of the schematic diagram of FIG.

In order to be able to separate the upstream specific amplification product 1 and the downstream specific amplification product 1, the 5' end of the upstream specific primer set 1 and the downstream specific primer set 1 may be provided with a modification for isolating the amplification product, preferably with Biotin modification, biotin can bind to avidin, so upstream specific amplification product 1 and downstream specific amplification product 1 can be separated from the reaction system by biotin-avidin affinity binding.

S4: specific amplification of upstream specific amplification product 1 and downstream specific amplification product 1 using upstream specific primer set 2 and downstream specific primer set 2, respectively, to obtain upstream specific amplification products 2 and Downstream specific amplification product 2.

In the case of only one round of specific primer amplification, there may be a presence of non-specific amplification products. Therefore, a second round of specific primer amplification is required, and the specific primers used for the second round of specific primer amplification also include upstream specific primers and downstream specific primers.

In an embodiment of the invention, similar to the first round of specific primer amplification, the upstream specific primer set 2 used for the second round of specific primer amplification comprises: an upstream primer set 2 for amplifying the alpha thalassemia gene 2 And an upstream primer set 2 for calculating a plurality of SNP sites of the fetal free DNA ratio; the downstream specific primer set 2 includes: a downstream primer set 2 for amplifying the α-thalassemia gene and for calculating a fetal free DNA ratio The downstream primer set 2 of multiple SNP sites.

2 shows the upstream primer set 2 (USP2) for amplifying the α-thalassemia gene and the downstream primer set 2 (DSP2) for amplifying the α-thalassemia gene in combination with the template in the embodiment of the present invention. Relative positional relationship. It can be seen that USP2 is closer to the alpha-type thalassemia gene mutation site than USP1, and DSP2 is closer to the alpha-type thalassemia gene mutation site than DSP1. use The relative positional relationship between the upstream and downstream primer set 2 and the template binding of the plurality of SNP sites for calculating the fetal free DNA ratio is the same as that of the schematic diagram of FIG. In summary, the upstream specific primer set 2 is closer to the corresponding amplification target site than the upstream specific primer set 1, and the downstream specific primer set 2 is closer to the corresponding amplification target site than the downstream specific primer set 1.

In a specific embodiment, the primer for a specific target site in the upstream specific primer set 1 (for example, USP1 for the alpha-type thalassemia gene), and the upstream specific primer set 2 for the target site Primers (eg, USP2 for the alpha-type thalassemia gene) have a 10-15 base overlap at the 5' end; similarly, primers for a specific target site in the downstream specific primer set 1 (eg, for alpha-type thalassemia) The 3' end of the DSP1) of the gene has a 10-15 base overlap with the 5' end of the downstream specific primer set 2 for the target site (for example, DSP2 for the alpha-type thalassemia gene). Here, "3' end" and "5' end" refer to a sequence near the 3' end and the 5' end, respectively. This coincidence is mainly considering that USP1 and DSP1 are close to the original detection point (for example, α-type thalassemia gene mutation site), and the superposition of bases can fully utilize the binding space while further improving the amplification specificity.

To facilitate high-throughput sequencing, the 5' end of upstream specific primer set 2 and downstream specific primer set 2 may contain a linker sequence for a high throughput sequencing library. Specifically, which high-throughput sequencing platform is used, the corresponding linker sequence of the platform is used.

S5: After the upstream specific amplification product 2 and the downstream specific amplification product 2 are mixed, amplification is performed using universal primers at both ends to obtain a library which can be sequenced on the machine.

As shown in Figure 2, the universal primer (UNP) is capable of binding to the linker sequence and is amplified by universal primers to obtain a library for sequencing on the machine. Sequencing on the machine is achieved by high-throughput sequencing. The high throughput sequencing technology can be selected from the group consisting of Illumina/Genome Analyzer/Hiseq/Miseq/NEXTseq CN500, Applied Biosystems SOLID, and life Technologies/Ion Torrent. Specifically, which high-throughput sequencing technology is used, universal primers also use primers corresponding to the high-throughput sequencing technology.

In one embodiment of the invention, the upstream primer set 1 sequence for amplifying the alpha-type thalassemia gene is set forth in SEQ ID NOs: 1-7; upstream of a plurality of SNP sites for calculating fetal free DNA ratio Primer set 1 sequences are set forth in SEQ ID NOS: 8-17; downstream primer set 1 sequences for amplifying alpha-type thalassemia gene are set forth in SEQ ID NOS: 18-23; used to calculate the ratio of fetal free DNA The sequence of the downstream primer set 1 of one SNP site is shown in SEQ ID NOs: 24-33; the sequence of the upstream primer set 2 used to amplify the alpha thalassemia gene is shown in SEQ ID NOs: 34-40; The upstream primer set 2 sequence of the plurality of SNP sites of the fetal free DNA ratio is shown in SEQ ID NOs: 41-50; the downstream primer set 2 sequence for amplifying the alpha thalassemia gene is SEQ ID NO: 51-56 The sequence of the downstream primer set 2 for the multiple SNP sites used to calculate the fetal free DNA ratio is shown in SEQ ID NOs: 57-66.

The embodiment of the invention further provides a non-invasive prenatal fetal alpha thalassemia gene mutation detecting method, comprising performing high-throughput sequencing of the library constructed in the embodiment of the invention to obtain a sequencing read read; then, according to the unique position of the site Specific tag sequence The total depth and depth of the allele of the mutation, the fetal DNA content was calculated and the thalassemia-related mutations were typed to analyze the alpha-thalassemia gene mutation.

The embodiment of the invention further provides a non-invasive prenatal fetal alpha thalassemia gene mutation detection library construction kit, wherein the above library is used for detecting non-invasive prenatal fetal alpha thalassemia gene mutation by high-throughput sequencing, the above kit include:

(R1) upstream specific primer set 1 and downstream specific primer set 1 for specific amplification of upstream pre-library and downstream pre-library, respectively, to obtain upstream specific amplification product 1 and downstream specific amplification, respectively Product 1, wherein the upstream specific primer set 1 comprises an upstream primer set 1 for amplifying a type alpha thalassemia gene and an upstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio; downstream specific primers Group 1 includes a downstream primer set 1 for amplifying a thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio;

(R2) upstream specific primer set 2 and downstream specific primer set 2, respectively, for specific amplification of upstream specific amplification product 1 and downstream specific amplification product 1 respectively, to obtain upstream specific amplification, respectively Product 2 and downstream specific amplification product 2, wherein upstream specific primer set 2 comprises an upstream primer set 2 for amplifying the alpha-thalassemia gene and an upstream of a plurality of SNP sites for calculating the fetal free DNA ratio Primer set 2; downstream specific primer set 2 includes a downstream primer set 2 for amplifying the alpha-thalassemia gene and a downstream primer set 2 for calculating a plurality of SNP sites of the fetal free DNA ratio.

Wherein, the upstream specific primer set 2 is closer to the corresponding amplification target site than the upstream specific primer set 1, and the downstream specific primer set 2 is closer to the corresponding amplification target site than the downstream specific primer set 1; The 5' end of upstream specific primer set 2 and downstream specific primer set 2 contains a linker sequence for a high throughput sequencing library.

In a preferred embodiment, the upstream specific primer set 1 and the downstream specific primer set 1 have a modification for the isolation of the amplified product, preferably with a biotin modification, to separate upstream specific expansion from the system. Product 1 and downstream specific amplification product 1 are added.

In a preferred embodiment, the 3' end of the primer for the specific target site in the upstream specific primer set 1 and the 10' end of the primer for the target site in the upstream specific primer set 2 are 10-15 Coincident of bases; the 3' end of the primer for the specific target site in the downstream specific primer set 1 and the 10' end of the primer of the downstream specific primer set 2 for the target site are 10-15 bases Coincident.

In one embodiment of the invention, the upstream primer set 1 sequence for amplifying the alpha-type thalassemia gene is set forth in SEQ ID NOs: 1-7; upstream of a plurality of SNP sites for calculating fetal free DNA ratio Primer set 1 sequences are set forth in SEQ ID NOS: 8-17; downstream primer set 1 sequences for amplifying alpha-type thalassemia gene are set forth in SEQ ID NOS: 18-23; used to calculate the ratio of fetal free DNA The sequence of the downstream primer set 1 of one SNP site is shown in SEQ ID NOs: 24-33; the sequence of the upstream primer set 2 used to amplify the alpha thalassemia gene is shown in SEQ ID NOs: 34-40; The upstream primer set 2 sequence of multiple SNP sites of fetal free DNA ratio is shown in SEQ ID NOs: 41-50; used to amplify alpha-type thalassemia The sequence of the downstream primer set 2 is shown in SEQ ID NOS: 51-56; the sequence of the downstream primer set 2 for calculating a plurality of SNP sites of fetal free DNA ratio is shown in SEQ ID NOs: 57-66.

In a preferred embodiment, the kit further comprises:

a (R3) linker sequence carrying a specific tag sequence and an optional sample tag sequence for ligation of maternal peripheral blood free DNA to obtain a ligation product;

(R4) a pre-library amplification primer sequence which is complementary to the above-described linker sequence for pre-library amplification of the above-described ligation product;

(R5) a universal primer for amplifying the mixed product after mixing the upstream specific amplification product 2 and the downstream specific amplification product 2 described above to obtain a library which can be sequenced on the machine.

In one embodiment of the invention, the linker sequence is set forth in SEQ ID NOs: 67-68; the pre-library amplification primer sequences are set forth in SEQ ID NOs: 69-70; and the universal primers are set forth in SEQ ID NO: 71-72. Show.

The technical solutions and the technical effects of the present invention are described in detail below by way of examples. It is to be understood that the embodiments are only illustrative and not restrictive.

Example

1. Design synthetic primers for α thalassemia gene-α ^SEA , -α ^3.7 , -α ^4.2 , α ^CS , α ^QS , α ^WS mutation sites:

The upstream primer and the downstream primer are located on the left and right sides of the detection point, respectively. The 3' end of the ipsilateral specific primer 1 and the 5' end of the specific primer 2 have a 10-15 base overlap. Specific primer 1 has a biotin modification at the 5' end. The 5' end of specific primer 2 contains a linker sequence for a high throughput sequencing library. Specifically, the primer sequences are shown in Table 1.

Table 1

2. A linker sequence with a specific tag sequence and a sample tag sequence:

ADT-F:

CAAGCAGAAGACGGCATACGAGATNNNNNNNNATTAAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 67);

ADT-R: pGATCGGAAGAGC (SEQ ID NO: 68).

Among them, NNNNNNNN is a specific tag sequence, ATTAAGG is a sample tag sequence (index), and the above linker sequence needs to be annealed into a double strand.

3. Pre-library amplification primer sequence:

pre-lib-primer-F: CAAGCAGAAGACGGCATACGA (SEQ ID NO: 69);

pre-lib-primer-R: GCTCTTCCGATCT (SEQ ID NO: 70).

4. Final library amplification primer sequence (general primer):

Seq-lib-primer-F: CAAGCAGAAGACGGCATACGA (SEQ ID NO: 71);

Seq-lib-primer-R:

ATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC (SEQ ID NO: 72).

5. The detection method and the detection kit of the embodiment of the present invention, the specific construction steps are as follows:

1) Extract 2 ml of pregnant women's plasma free DNA.

2) Free DNA end repair, and the reaction system (Reaction 1) was set as shown in Table 2.

Table 2

Reagent	Volume (μL)
DNA	40.5
T4 DNA ligase buffer + 10 mM ATP	5
10mM dNTP mixture	2
T4 DNA polymerase (Enzymatics)	1
T4 DNA phosphorylase (Enzymatics)	0.5
rTaq (Takara company)	1
total capacity	50

Mix well, centrifuge instantaneously, and carry out the following reaction on a thermal cycler: 37 ° C, 20 min; 72 ° C, 20 min; 4 ° C storage.

3) The DNA fragment is ligated to the linker sequence carrying the specific tag sequence and the sample tag sequence, and the reaction system (Reaction 2) is shown in Table 3.

table 3

Reagent	Volume (μL)
Reaction one	50
DNA ligase buffer	27
DNA ligase (Enzymatics)	1
Linker sequence (SEQ ID NO: 67-68)	2
total capacity	80

Mix well, centrifuge instantaneously, and carry out the following reaction on a thermocycler: 20 ° C, 15 min; 65 ° C, 10 min; 4 ° C preservation.

4) Immediately after completion of the reaction, use 30 μL of XP beads to purify, and elute with 26 μL of ultrapure water or an eluent.

5) PCR preamplification

The following reaction system was placed on ice as shown in Table 4.

Table 4

Mix thoroughly, centrifuge instantaneously, and perform the following reactions on a thermal cycler: 95 ° C, 3 min, 1 cycle; (95 ° C, 15 s, 62 ° C, 30 s, 72 ° C, 30 s) 10 cycles; 72 ° C, 5 min, 1 cycle ; 4 ° C preservation.

6) The final reaction product was purified by using 50 μL of XP beads, and quantification by Qubit, and 5 μL of the reaction product was detected by 2% gel electrophoresis. The results are shown in Fig. 3a, indicating that the pre-library was successfully constructed. Two aliquots of the pre-library were taken and named as the upstream pre-library and the downstream pre-library, respectively, and each 100 ng was subjected to the next amplification.

7) Specific amplification 1

Each sample pre-library is an upstream pre-library and a downstream pre-library, respectively using the corresponding upstream and downstream specific primer 1 and specific primer 2, respectively, until the amplification of the upstream and downstream primers of each sample is combined when using universal primer amplification. And then use universal primers for amplification.

The following reaction system was placed on ice as shown in Table 5.

table 5

The PCR reaction procedure was as follows: 95 ° C, 10 min, 1 cycle; (95 ° C, 30 s, 62 ° C, 30 s, 72 ° C, 1 min) 20 cycles; 72 ° C, 7 min, 1 cycle; 4 ° C storage.

8) 5 μL of the reaction product was subjected to 2% agarose gel electrophoresis, and the remaining product was recovered by 1.2X XP, eluted with 24 μL of ultrapure water or an eluent, and the eluate was subjected to further amplification.

9) Specific amplification 2

The following reaction system was placed on ice as shown in Table 6.

Table 6

Reagent	Dosage
Upstream or downstream specific amplification of 1 product	22μL
360 Master mix (Applied Biosystems)	25μL
U-SP2 (SEQ ID NO: 34-50) or	2μL

D-SP2 (SEQ ID NO: 51-66)
GC-enhancer	1μL

The PCR reaction procedure was as follows: 95 ° C, 10 min, 1 cycle; (95 ° C, 30 s, 62 ° C, 30 s, 72 ° C, 1 min) 15 cycles; 72 ° C, 7 min, 1 cycle; 4 ° C preservation.

10) 5 μL of the reaction product was electrophoresed on 2% agarose gel, and the remaining product was recovered by 1.2X XP. The upstream and downstream amplification products of each sample were combined and recovered, and finally 26 μL of ultrapure water or eluate was eluted, and the eluate was used for general purpose. Primer amplification.

11) Universal primer amplification

The following reaction system was placed on ice as shown in Table 7.

Table 7

The PCR reaction procedure was as follows: 98 ° C, 45 s, 1 cycle; (98 ° C, 15 s, 60 ° C, 30 s, 72 ° C, 30 s) 10 cycles; 72 ° C, 1 min, 1 cycle; 4 ° C preservation.

12) 5 μL of the reaction product was detected by 2% gel electrophoresis, and the results are shown in Fig. 3b, indicating that the final library was successfully constructed. The remaining product was recovered by 1.0X XP and finally eluted with 30 ul of eluent, which was the final library.

13) After library control, Illumina NEXTseq CN500 was subjected to 75PE sequencing.

14) Analysis of sequencing data information

After filtering out low-quality sequencing read reads, for each pair of pair reads based on the linked molecular tag sequence and amplification primer sequence, when the reads start sequence and the experimentally added primer sequences and molecular tags When the sequence is inconsistent, the reads will be filtered out. The retained pair-end reads are aligned with the BWA MEM human reference genome (hg19), clustered into the same group by the same starting, same termination position and molecular tag sequence, resulting in a unique molecular tag set sequence, which will be unique. The molecular tag set sequences were re-aligned to the reference genome (BWA MEM), the sequences surrounding Indel were re-aligned using GATK software, SNP and small indels were detected using samtools software, and alpha1 (α1) and alpha2 were performed using CNVPanelizer R package. (α2) deletion detection. Calculate the embryonic DNA content based on the total depth of the unique molecular tag set sequence of the locus and the depth of the associated SNP locus allele, and genotype the fetal thalassemia-related point mutation, INDEL, for alpha1 And alpha2 type deletion, mixed Gaussian model for fetal genotyping.

According to the above examples, non-invasive prenatal thalassemia gene detection was performed on 8 pregnant women with thalassemia carriers, and the results are shown in Table 8 below.

Table 8

The results show that the non-invasive prenatal detection and the amniocentesis detection of the α-thalassemia gene mutation are consistent in the embodiment of the present invention, indicating that the method of the present invention can accurately and efficiently detect the alpha-thalassemia gene mutation, and the result and the amniocentesis test score. The type is consistent, but it is significantly better than amniocentesis in terms of safety, non-invasiveness and high efficiency.

The above is a further detailed description of the present invention in connection with the specific embodiments, and the specific embodiments of the present invention are not limited to the description. It will be apparent to those skilled in the art that the present invention may be made without departing from the spirit and scope of the invention.

Claims (10)

1. A method for constructing a non-invasive prenatal fetal alpha-type thalassemia gene mutation detection library for detecting non-invasive prenatal fetal alpha-type thalassemia gene mutation by high-throughput sequencing, characterized in that the method comprises:

   (a) a linker sequence having a specific tag sequence and an optional sample tag sequence for maternal peripheral blood free DNA ligation;

   (b) pre-librarian amplification of the ligation product of the previous step using a pre-library amplification primer sequence, wherein the pre-library amplification primer sequence is complementary to the linker sequence;

   (c) dividing the pre-library obtained in the previous step into an upstream pre-library and a downstream pre-library, and specifically amplifying the upstream pre-library and the downstream pre-library using the upstream specific primer set 1 and the downstream specific primer set 1, respectively. , obtaining upstream specific amplification product 1 and downstream specific amplification product 1, respectively.

   Wherein the upstream specific primer set 1 comprises an upstream primer set 1 for amplifying a type alpha thalassemia gene and an upstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio; the downstream specificity Primer set 1 includes a downstream primer set 1 for amplifying a type alpha thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio;

   (d) specifically amplifying the upstream specific amplification product 1 and the downstream specific amplification product 1 using the upstream specific primer set 2 and the downstream specific primer set 2, respectively, to obtain upstream specific amplification, respectively. Product 2 and downstream specific amplification product 2,

   Wherein the upstream specific primer set 2 comprises an upstream primer set 2 for amplifying the α-thalassemia gene and an upstream primer set 2 for calculating a plurality of SNP sites of a fetal free DNA ratio; the downstream specificity Primer set 2 includes a downstream primer set 2 for amplifying a type alpha thalassemia gene and a downstream primer set 2 for calculating a plurality of SNP sites of a fetal free DNA ratio;

   And, the upstream specific primer set 2 is closer to the corresponding amplification target site than the upstream specific primer set 1, and the downstream specific primer set 2 is closer to the downstream specific primer set 1 Corresponding amplification target sites; the upstream specific primer set 2 and the downstream specific primer set 2 have a linker sequence for the high-throughput sequencing library at the 5' end;

   (e) After mixing the upstream specific amplification product 2 and the downstream specific amplification product 2, amplification was carried out using universal primers at both ends to obtain a library which can be sequenced by the machine.
2. The library construction method according to claim 1, wherein the upstream specific primer set 1 and the downstream specific primer set 1 have a modification at the 5' end thereof for isolating the amplification product, preferably with biotin modification. .
3. The library construction method according to claim 1, wherein a 3' end of the primer specific to the specific target site in the upstream specific primer set 1 and the target specific position in the upstream specific primer set 2 Point 5's primer has a 10-15 base overlap; the downstream specific primer set 1 has a 3' end for a specific target site, and the downstream specific primer set 2 The 5' end of the primer at the target site has a 10-15 base overlap.
4. The library construction method according to any one of claims 1 to 3, wherein the upstream primer set 1 sequence for amplifying the α-thalassemia gene is as shown in SEQ ID NOS: 1-7;

   The upstream primer set 1 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 8-17;

   The downstream primer set 1 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 18-23;

   The downstream primer set 1 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 24-33;

   The upstream primer set 2 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 34-40;

   The upstream primer set 2 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 41-50;

   The downstream primer set 2 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 51-56;

   The downstream primer set 2 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 57-66.
5. A non-invasive prenatal fetal alpha thalassemia gene mutation detecting method, characterized in that the method comprises performing high-throughput sequencing of the library constructed according to any one of claims 1 to 4 to obtain a sequencing read length; and then, according to the site The total depth of the unique specific tag sequence and the depth of the mutant allele, the fetal DNA content was calculated and the thalassemia-related mutation was typed to analyze the alpha-thalassemia gene mutation.
6. A non-invasive prenatal fetal alpha thalassemia gene mutation detection library construction kit for detecting non-invasive prenatal fetal alpha-type thalassemia gene mutation by high-throughput sequencing, characterized in that the kit include:

   (a) upstream specific primer set 1 and downstream specific primer set 1 for specific amplification of upstream pre-library and downstream pre-library, respectively, to obtain upstream specific amplification product 1 and downstream specific amplification, respectively Product 1,

   Wherein the upstream specific primer set 1 comprises an upstream primer set 1 for amplifying a type alpha thalassemia gene and an upstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio; the downstream specificity Primer set 1 includes a downstream primer set 1 for amplifying a type alpha thalassemia gene and a downstream primer set 1 for calculating a plurality of SNP sites of a fetal free DNA ratio;

   (b) upstream specific primer set 2 and downstream specific primer set 2 for specifically amplifying the upstream specific amplification product 1 and downstream specific amplification product 1 respectively to obtain upstream specificity, respectively Amplification product 2 and downstream specific amplification product 2,

   Wherein the upstream specific primer set 2 comprises an upstream primer set 2 for amplifying the α-thalassemia gene and an upstream primer set 2 for calculating a plurality of SNP sites of a fetal free DNA ratio; the downstream specificity Primer set 2 includes a downstream primer set 2 for amplifying the alpha thalassemia gene and a downstream of a plurality of SNP sites for calculating the ratio of fetal free DNA. Primer set 2;

   And, the upstream specific primer set 2 is closer to the corresponding amplification target site than the upstream specific primer set 1, and the downstream specific primer set 2 is closer to the downstream specific primer set 1 Corresponding amplification target sites; the upstream specific primer set 2 and the 5' end of the downstream specific primer set 2 contain a linker sequence for a high throughput sequencing library.
7. The library construction kit according to claim 6, wherein the upstream specific primer set 1 and the downstream specific primer set 1 have a modification at the 5' end thereof for isolating the amplification product, preferably with biotin Modification.
8. The library construction kit according to claim 6, wherein the upstream specific primer set 1 has a 3' end for a specific target site, and the upstream specific primer set 2 targets the target The 5' end of the primer of the site has a 10-15 base overlap; the 3' end of the primer of the downstream specific primer set 1 for a specific target site, and the downstream specific primer set 2 The 5' end of the primer at the target site has a 10-15 base overlap.
9. The library construction kit according to any one of claims 6 to 8, wherein the upstream primer set 1 sequence for amplifying the alpha thalassemia gene is as shown in SEQ ID NOS: 1-7;

   The upstream primer set 1 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 8-17;

   The downstream primer set 1 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 18-23;

   The downstream primer set 1 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 24-33;

   The upstream primer set 2 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 34-40;

   The upstream primer set 2 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is as shown in SEQ ID NOs: 41-50;

   The downstream primer set 2 sequence for amplifying the alpha thalassemia gene is set forth in SEQ ID NOs: 51-56;

   The downstream primer set 2 sequence of the plurality of SNP sites for calculating the ratio of fetal free DNA is shown in SEQ ID NOs: 57-66.
10. The library construction kit according to any one of claims 6 to 8, wherein the kit further comprises:

    (c) a linker sequence with a specific tag sequence and an optional sample tag sequence for ligation of maternal peripheral blood free DNA to obtain a ligation product;

    (d) a pre-library amplification primer sequence that binds complementary to the linker sequence for pre-library amplification of the ligation product;

    (e) a universal primer for amplifying the mixed product after mixing the upstream specific amplification product 2 and the downstream specific amplification product 2 to obtain a library which can be sequenced on the machine;

    Preferably,

    The linker sequence is set forth in SEQ ID NOs: 67-68;

    The pre-library amplification primer sequences are set forth in SEQ ID NOs: 69-70;

    The universal primers are set forth in SEQ ID NOs: 71-72.

Images