WO2020113577A1 - Method for constructing target gene library, detection device and application thereof - Google Patents

Abstract

Provided are a method for constructing a target gene library, a detection device and an application thereof. The method for constructing a target gene library comprises: extracting free RNA from a biological sample obtained from a pregnant woman, which comprises fetal free RNA; performing reverse transcription on the free RNA to form first-strand cDNA; amplifying the first-strand cDNA by using specific primers to obtain an amplification product having specificity, which is to say differentially expressed genes of the fetus and the mother, i.e., the target genes; performing a second round of PCR amplification on the amplification product by using universal primers to obtain a target gene library.

Description

Construction method, detection device and application of target gene library Technical field

The present application relates to the field of gene detection, in particular to a method for constructing a target gene library, a detection device and its application.

Background technique

Prenatal diagnosis is an important means to prevent birth defects caused by genetic diseases. However, there are still risks associated with invasive sampling methods such as chorionic sampling, amniotic fluid puncture, and umbilical cord blood puncture to obtain fetal genetic information. Therefore, developing a non-invasive prenatal detection method has always been an important research direction. In the early years, the research direction of scientific researchers focused on how to obtain fetal nucleated red blood cells from the peripheral blood of pregnant women for genetic analysis. However, how to efficiently separate and enrich fetal nucleated red blood cells has been a major bottleneck in the development of this technology. In 1997, Lu Yuming published a scientific paper in "lancet", which confirmed the presence of free DNA from the fetus in the plasma of pregnant women by PCR amplification of Y chromosome-specific genes; Blood testing for fetal genotypes provides new possibilities.

The widely used detection technology based on whole genome sequencing now provides an important reference for the screening of children with Down's disease, and also avoids the birth of countless children with Down's disease. However, the existing technology can only detect chromosomal abnormalities, and cannot detect other single gene mutations. However, the proportion of fetal defects caused by chromosomal abnormalities is less than 4% of the total number of congenital foolish and disabled children. A considerable number of defective fetuses are not caused by abnormal chromosome numbers, but by single gene mutations. Diseases caused by single gene mutations are important diseases that affect children's health and quality of life, and the vast majority cannot be detected in early pregnancy. Although B-imaging can find abnormalities, it can only be found in the middle or late pregnancy, which brings a heavy blow to pregnant women and their families. After birth, most of the defective fetuses have physiological abnormalities, and it is difficult to take care of themselves. It also brings great pain to the family.

In recent years, the development of high-throughput sequencing technology has provided a new technical platform for noninvasive prenatal detection of single gene diseases. The dominant single gene can be detected by directly detecting the denovo mutation that may exist in the plasma; however, for the recessive single gene, because the mother generally carries mutation information, it is difficult to detect whether the fetus carries the plasma from the mother's background Mutation information for both parents. Dennis Lo et al. published an article based on whole-genome sequencing of free plasma DNA of pregnant women in the journal Science Translational Medicine and combined with haplotype analysis of parents to speculate the genotype of the fetus. The article uses β-thalassaemia as an example to confirm The application prospect of this method in the detection of genetic diseases. Subsequently, it published a report on the detection of noninvasive fetal β-thalassemia mutations based on target area capture. This report is similar to the analysis method used in the previous article, except that the use of target area capture technology greatly reduces the The cost of sequencing has brought it closer to clinical applications. This haplotype-based analysis method can not only determine whether the fetus obtains the disease-causing mutation from the father, but also realize the determination of the alleles inherited by the fetus from the mother. However, this method needs to first obtain the genetic information of parents and probands through experiments, and use complex algorithms to speculate whether the fetus is sick. The operation is complicated and the cost is high, which cannot meet the actual clinical needs. Moreover, it is difficult to detect some gene structure mutations with short fragments of plasma free DNA.

Summary of the invention

The purpose of the present application is to provide a new method for constructing a target gene library, a fetal gene detection method, a fetal gene detection device, a fetal gene detection reagent and their applications based on the library construction method of the present application.

This application specifically adopts the following technical solutions:

The first aspect of the present application discloses a method for constructing a target gene library, including the following steps: extracting free RNA from a biological sample derived from a pregnant woman, the free RNA including fetal free RNA; reverse transcription of the extracted free RNA to generate a first Strand cDNA; the first strand cDNA is amplified with specific primers to obtain specific amplification products; wherein, the specific primers can specifically amplify the target gene, the target gene is the differentially expressed gene of the fetus and the mother, and the specific primer The sequence of the 5′ end of the upstream primer and/or the downstream primer is the same as at least a part of the sequence of the universal primer; using the universal primer to perform a second round of PCR amplification on the specific amplification product to obtain the target gene library.

Preferably, the differentially expressed genes are genes that are specifically expressed by the fetus, but are hardly expressed by the mother.

Preferably, the differentially expressed genes are at least one of the genes shown in Table 1.

In the present application, the differentially expressed genes refer to genes corresponding to RNAs derived from maternal and fetal and released into the peripheral blood of pregnant women with significantly different expression levels. For example, the differentially expressed gene may be a gene that is specifically expressed by the fetus, but is rarely expressed by the maternal or expressed in a very low amount. Specifically, the differentially expressed genes may be any one or more of the genes shown in Table 1. This application is to use the differential expression of the fetus and the mother to construct the fetal target gene library, and then realize the subsequent detection of the fetal gene information. In addition, the sequence of the 5'end of the upstream primer and/or the downstream primer of the specific primer is the same as at least a part of the sequence of the universal primer, so that the subsequent universal primer can bind to the end of the specific amplification product, thereby achieving specific amplification The amplified products were subjected to the second round of PCR amplification. It can be understood that in the actual application process, there can be multiple sets of specific primers, which respectively amplify multiple target genes, so as to obtain multiple specific amplification products; while universal primers use one set of primers to Different specific amplification products are amplified; therefore, it is necessary to design a sequence identical to at least a part of the sequence of the universal primer at the 5′ end of the upstream primer and/or downstream primer of each specific primer.

It should be noted that pregnant women’s biological samples contain fetal free RNA, especially free mRNA (abbreviated cfmRNA). Therefore, the present application creatively constructs a fetal target gene library for free RNA extracted from pregnant women samples. The fetal target gene library constructed by this application can directly detect fetal specific cfmRNA expressed in the plasma or urine of pregnant women, and then infer the genotype of the fetus, which solves the problem that a large amount of maternal background is carried in free DNA Causes problems that mutation detection cannot judge. cfmRNA is a complete transcript sequence obtained after DNA translation. It removes a lot of intron redundant information, which can reflect the structural variation of DNA in exons. These variations are difficult to detect at the DNA level. At the mRNA level, these variations are relatively easy to detect. Therefore, the target gene library construction of the present application uses cfmRNA instead of cfDNA for subsequent noninvasive detection of genetic disease-related mutations, which can detect certain recessive genetic disease-related mutations of the fetus, and can also detect the structure of certain genes Mutations, which are difficult to detect at the cfDNA level.

Preferably, in the target gene library construction method of the present application, the biological sample is peripheral blood or urine.

It should be noted that the target gene library construction method of the present application is in principle applicable to all pregnant women samples containing fetal free RNA, including but not limited to urine and peripheral blood plasma.

Preferably, in the method for constructing a target gene library of the present application, reverse transcription of the extracted free RNA to generate first-strand cDNA specifically includes reverse transcription of the free RNA using random primers to obtain first-strand cDNA.

More preferably, the random primer is an N6 random primer.

It should be noted that the use of N6 random primers to generate the first-strand cDNA is only a specific scheme adopted in an implementation manner of this application, and it is not excluded that other methods for generating the first-strand cDNA can also be used, which is not specifically limited herein.

Preferably, in the method for constructing a target gene library of the present application, the specific primer pair is at least one of the first primer pair to the sixth primer pair; the upstream and downstream primers of the first primer pair are SEQ ID NO. 1 and SEQ respectively The sequence shown in ID NO.2, the upstream and downstream primers of the second primer pair are the sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, and the upstream and downstream primers of the third primer pair are SEQ ID NO. 5 and SEQ respectively The sequence shown in ID NO.6, the upstream and downstream primers of the fourth primer pair are the sequences shown in SEQ ID NO.7 and SEQ ID NO.8, and the upstream and downstream primers of the fifth primer pair are SEQ ID NO.9 and SEQ, respectively The sequence shown in ID NO.10, the upstream and downstream primers of the sixth primer pair are the sequences shown in SEQ ID NO.11 and SEQ ID NO.12, respectively.

It should be noted that the six primer pairs of the sequences shown in SEQ ID NO. 1 to SEQ ID NO. 12 are only the specific primers for amplifying common mutation sites of the FGA gene in one implementation of the present application. On the one hand, without affecting the amplification effect or covering the mutation site, the primer can be adjusted appropriately, such as adding or subtracting a few bases at the 5'end or 3'end, or adding a special purpose at the 5'end Nucleic acid sequence, for example, the six primer pairs of the present application add a part of the linker sequence at the 5'end, so as to facilitate subsequent amplification using universal primers; on the other hand, in the specific use process, according to the specific detected mutation One or more primer pairs are used for the site selection. Even for some special mutation sites that are not covered by the six primer pairs in this application, primer pairs can be designed by themselves, which is not specifically limited here.

Preferably, in the method for constructing a target gene library of the present application, the specific primers include at least one of primer pair 1 to primer pair 7, and the upstream and downstream primers of primer pair 1 are SEQ ID NO. 17 and SEQ ID NO. 18 respectively. The sequence of primer pair two is the sequence shown in SEQ ID NO.19 and SEQ ID NO.20, and the primer pair three is the sequence shown in SEQ ID NO.21 and SEQ ID NO.22 The upstream and downstream primers of primer pair 4 are the sequences shown in SEQ ID NO.23 and SEQ ID NO. 24, respectively. The upstream and downstream primers of primer pair 5 are the sequences shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively. The upstream and downstream primers for pair six are the sequences shown in SEQ ID NO.27 and SEQ ID NO.28, respectively, and the upstream and downstream primers for primer pair seven are the sequences shown in SEQ ID NO.29 and SEQ ID NO.30.

Similarly, the seven primer pairs of the sequences shown in SEQ ID NO. 17 to SEQ ID NO. 30 are only the specific primers for amplifying common mutation sites of the HESX1 gene in one implementation of this application; , Without affecting the amplification effect or covering the mutation site, you can adjust the primer appropriately; on the other hand, in the specific use process, you can choose to use one or more of the mutation sites according to the specific detection One primer pair, even at some special mutation sites that are not covered by the seven primer pairs of this application, you can also design your own primer pair, which is not specifically limited here.

Preferably, in the method for constructing a target gene library of the present application, while using specific primers to amplify the first-strand cDNA, reference primers are used to amplify the first-strand cDNA, and the reference primers can specifically amplify the housekeeper gene.

It should be noted that the target region of the housekeeping gene is amplified, on the one hand, it can be used as a reference for the success of the experiment; on the other hand, it can be used as a reference for sample quantification.

Preferably, the housekeeping gene is the GAPDH gene.

Preferably, the upstream and downstream primers of the primers that amplify the housekeeping gene GAPDH are the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively.

It should be noted that the primers of the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14 are only the primers used to amplify the housekeeping gene GAPDH used in one implementation of this application, and it is not excluded that other primers can also be designed or used , As long as it does not affect the target gene amplification.

Preferably, in the method for constructing a target gene library of the present application, the universal primer includes a first primer and a second primer, the first primer is the sequence shown in SEQ ID NO.15, and the second primer is the sequence shown in SEQ ID NO.16. Also, preferably, the 5'end of the first primer has a phosphorylation modification.

It should be noted that the purpose of the universal primer is to further amplify and enrich the PCR amplification product, so as to obtain a sequencing library that can be used for sequencing; wherein, the 5'end of the first primer has a phosphorylation modification, and its purpose is to It is convenient for the subsequent circularization of single-stranded DNA. It can be understood that the specific sequence of the universal primer can be designed according to different experiments or sequencing platforms.

Preferably, in the method for constructing a target gene library of the present application, after obtaining the double-stranded nucleic acid amplification product in the second round of PCR amplification, the double-stranded nucleic acid amplification product is denatured into single-stranded nucleic acid, and a nucleic acid-mediated fragment is used The single-stranded nucleic acid is connected into a circular single-stranded nucleic acid, thereby obtaining a circular single-stranded target gene library, in which the nucleic acid-mediated fragment can be combined with the two ends of the single-stranded nucleic acid through the base complementary pairing principle.

It should be noted that, according to different sequencing platforms selected, the target gene library can be adaptively processed. For example, sequencing using the Illumina sequencing platform requires that the library on the computer is a double-stranded nucleic acid library, that is, the nucleic acid double-stranded amplification product obtained after the second round of PCR amplification is the library used on the computer; another example, use BGI or MGI sequencing platform for sequencing requires that the library on the machine is a circular single-stranded nucleic acid library, then the double-stranded nucleic acid amplification product obtained after the second round of PCR amplification needs to be denatured into single-stranded nucleic acid, and through the mediated fragment The single-stranded nucleic acid is connected into a circular single-stranded nucleic acid, and the sequencing can only be performed after the circular single-stranded nucleic acid library is finally obtained.

The second aspect of the present application discloses a method for detecting fetal genes, including the following steps:

The method of the first aspect of the present application is used to construct a target gene library to obtain a target gene library; sequence the target gene library to obtain sequencing results composed of multiple sequencing data; analyze the sequencing results to obtain fetal gene information.

It should be noted that the fetal gene detection method of the present application is actually based on the method of constructing the target gene library of the present application, and further sequencing the constructed target gene library to realize fetal gene detection. In one implementation of the present application, a high-throughput sequencing method is used to sequence the constructed target gene library to obtain mutation information, fetal genotype information, and gene structure variation information including recessive genetic single gene disease. Fetal genetic information.

It can be understood that the fetal gene detection method of the present application may be a detection method for non-diagnostic purposes, for example, the fetal genotype information is obtained by the detection method, so as to predict the phenotype that the fetus may appear, when the genotype information does not directly correspond to the disease In the relationship, the predicted phenotype information is not directly related to the disease.

Preferably, the analysis of the sequencing results specifically includes the steps of filtering the sequencing data; comparing the filtered sequencing data to the reference genome, retaining the sequencing data of the unique reference genome; sequencing based on the unique comparison of the reference genome Data, statistics of the base distribution of the target gene, to obtain mutation information of the target gene, and then obtain the genetic information of the fetus.

Preferably, the analysis of the sequencing results further includes comparing the mutation information of the target gene with the disease database to obtain mutation information of the recessive genetic single gene disease of the fetus.

For other parts of the fetal gene detection method of the present application, such as the type of biological sample, the first strand cDNA generation, etc., reference may be made to the method of constructing a target gene library in the first aspect of the present application, which is not described here.

In the method for constructing a target gene library or the method for detecting fetal genes in the present application, all or part of the steps can be realized by a unique mechanical device, so as to realize automatic operation.

The third aspect of the present application discloses a fetal gene detection device, which includes a free RNA extraction module, a reverse transcription module, a target gene amplification module, a target gene library generation module, a sequencing module, and an analysis module; a free RNA extraction module, It is used to extract free RNA from biological samples derived from pregnant women. The free RNA contains fetal free RNA; the reverse transcription module is used to reverse transcribe the extracted free RNA to generate first-strand cDNA; the target gene amplification module is used to adopt specific Sexual primers amplify the first-strand cDNA to obtain specific amplification products. The specific primers can specifically amplify the target gene. The target gene is the differentially expressed gene of the fetus and the mother. The upstream primer and/or downstream of the specific primer The sequence at the 5'end of the primer is the same as at least a part of the sequence of the universal primer; the target gene library generation module is used to perform a second round of PCR amplification on the specific amplification product using the universal primer to obtain the target gene library; the sequencing module is used to Sequencing the target gene library to obtain sequencing results composed of multiple sequencing data; analysis module for analyzing the sequencing results to obtain fetal genetic information.

Preferably, in the fetal gene detection device of the present application, the biological sample involved in the free RNA extraction module is peripheral blood or urine.

Preferably, in the fetal gene detection device of the present application, the reverse transcription module reverse transcribes the extracted free RNA to generate first-strand cDNA, which specifically includes performing reverse transcription of the free RNA using random primers to obtain the first-strand cDNA; preferably, random The primers are N6 random primers.

Preferably, in the fetal gene detection device of the present application, the differentially expressed genes involved in the target gene amplification module are genes that are specifically expressed by the fetus but hardly expressed by the mother. Preferably, the differentially expressed genes are at least one of the genes shown in Table 1.

Preferably, in the fetal gene detection device of the present application, in the analysis module, the genetic information of the fetus includes at least one of mutation information of recessive genetic single gene disease, fetal genotype information, and genetic structure variation information.

Preferably, in the fetal gene detection device of the present application, the analysis module further includes a filtering unit, a reference genome comparison unit and a statistical unit; a filtering unit is used to filter sequencing data; a reference genome comparison unit is used to filter The sequencing data is compared to the reference genome, and the unique comparison of the sequencing data of the reference genome is retained; the statistical unit is used to calculate the base distribution of the target gene based on the sequencing data of the unique comparison of the reference genome to obtain mutation information of the target gene, and then Get the genetic information of the fetus.

Preferably, in the fetal gene detection device of the present application, the analysis module further includes a disease database comparison unit, and the disease database comparison unit is used to compare target gene mutation information with the disease database to obtain mutation information of the recessive genetic single gene disease of the fetus .

The fourth aspect of the present application discloses the method of constructing the target gene library of the first aspect of the present application, the fetal gene detection method of the second aspect of the present application or the fetal gene detection device of the third aspect of the present application in the detection of recessively inherited single gene diseases , Or the application of structural variation detection.

A fifth aspect of the present application discloses a reagent for detecting fetal FGA gene, the reagent includes a specific primer for amplifying FGA gene, the specific primer includes at least one of the first primer pair to the sixth primer pair In one set, the upstream and downstream primers of the first primer pair are the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and the upstream and downstream primers of the second primer pair are SEQ ID NO. 3 and SEQ ID NO. 4. Sequence, the upstream and downstream primers of the third primer pair are the sequences shown in SEQ ID NO.5 and SEQ ID NO.6, and the upstream and downstream primers of the fourth primer pair are SEQ ID NO.7 and SEQ ID NO.8, respectively. Sequence, the upstream and downstream primers of the fifth primer pair are the sequences shown in SEQ ID NO. 9 and SEQ ID NO. 10, respectively, and the upstream and downstream primers of the sixth primer pair are SEQ ID NO. 11 and SEQ ID NO. 12 respectively.示SEQ.

It should be noted that the reagent of the present application, its six primer pairs can amplify and cover the common mutation sites of the FGA gene; therefore, the reagent of the present application can be directly used for FGA gene mutation detection on the one hand, on the other hand, The corresponding target fragments can be amplified and enriched. It can be understood that the reagents of the present application can be used for the detection method of the fetal FGA gene of the present application, and other FGA gene detection methods based on PCR amplification of target fragments can also use the reagents of the present application, which are not specifically limited herein.

Preferably, the reagent of the present application further includes a reference primer for amplifying the housekeeping gene GAPDH, and the upstream and downstream primers of the reference primer are the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively.

It should be noted that in the reagents of the present application, six specific primer pairs and primer pairs for amplifying the housekeeping gene GAPDH, these primer pairs can be pre-mixed in proportion according to the use requirements and the optimized multiplex PCR amplification scheme. Each primer pair can be packaged separately, and the primer mixture can be configured according to the specific use situation, which is not specifically limited here. It can be understood that if it is not necessary to amplify the housekeeping gene, the corresponding reference primer pair may not be used.

Preferably, the reagent of the present application further includes a universal primer for constructing a sequencing library. The universal primer includes a first primer and a second primer. The first primer is the sequence shown in SEQ ID NO.15, and the second primer is SEQ ID NO. The sequence shown in 16; and, preferably, the 5'end of the first primer has a phosphorylation modification.

A sixth aspect of the present application discloses a kit for fetal FGA gene detection, which includes the reagent for fetal FGA gene detection in the fifth aspect of the present application.

Preferably, the kit further includes at least one of free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents and nucleic acid purification reagents.

It should be noted that, for ease of use, the specific primer pairs of the FGA gene of the present application, the housekeeping gene GAPDH amplification primer pairs and/or the library can be used to construct universal primers, or even involved in the fetal FGA gene detection method of the present application The various reagents are assembled into a kit to facilitate the detection of fetal FGA genes; of course, free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, nucleic acid purification reagents, etc. can also use conventional laboratory reagents, here No specific restrictions.

The seventh aspect of the present application discloses a reagent for detecting fetal HESX1 gene, including a specific primer for amplifying the HESX1 gene, the specific primer includes at least one of primer pair 1 to primer pair 7, primer pair 1 The upstream and downstream primers are the sequences shown in SEQ ID NO.17 and SEQ ID NO.18, respectively. The upstream and downstream primers of primer pair 2 are the sequences shown in SEQ ID NO.19 and SEQ ID NO.20, and the primer pair three is The downstream primers are the sequences shown in SEQ ID NO.21 and SEQ ID NO.22 respectively, the upstream and downstream primers of primer pair 4 are the sequences shown in SEQ ID NO.23 and SEQ ID NO.24, and the upstream and downstream primers of primer pair V are respectively They are the sequences shown in SEQ ID NO.25 and SEQ ID NO. 26 respectively, the upstream and downstream primers of primer pair 6 are the sequences shown in SEQ ID NO.27 and SEQ ID NO. 28, and the upstream and downstream primers of primer pair 7 are respectively The sequence shown in SEQ ID NO.29 and SEQ ID NO.30.

Similarly, the reagent of the present application, its seven primer pairs can amplify and cover the common mutation sites of the HESX1 gene; therefore, the reagent of the present application can be directly used for HESX1 gene mutation detection on the one hand, and can also be used for the corresponding The target fragments are amplified and enriched. It can be understood that the reagents of the present application can be used for the HESX1 gene detection method of the present application, and other HESX1 gene detection methods based on PCR amplification of target fragments can also use the reagents of the present application, which are not specifically limited herein.

Preferably, the reagent of the present application further includes a reference primer for amplifying the housekeeping gene GAPDH, and the upstream and downstream primers of the reference primer are the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively.

Preferably, the reagent of the present application further includes a universal primer for constructing a sequencing library. The universal primer includes a first primer and a second primer. The first primer is the sequence shown in SEQ ID NO.15, and the second primer is SEQ ID NO. The sequence shown in 16; and, preferably, the 5'end of the first primer has a phosphorylation modification.

Similarly, the packaging format of the primer and whether the reference primer is used are the reagents for detecting the FGA gene of the fetus according to the fifth aspect of the present application, which are not repeated here.

Similarly, for convenience of use, specific primer pairs of the HESX1 gene of the present application, housekeeping gene GAPDH amplification primer pairs and/or libraries can also be used to construct universal primers, and even each of the methods involved in the fetal HESX1 gene detection method of the present application Reagents, assembled into a kit to facilitate the detection of fetal HESX1 gene; of course, free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, nucleic acid purification reagents can also use conventional laboratory reagents, do not do here Specific restrictions.

The eighth aspect of the present application discloses a kit for fetal HESX1 gene detection, which includes the reagent for fetal HESX1 gene detection in the seventh aspect of the present application.

Preferably, the kit further includes at least one of free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents and nucleic acid purification reagents.

Similarly, the packaging form of various reagents in the kit is the same as the kit for detecting fetal FGA gene in the sixth aspect of the present application, which is not repeated here.

The beneficial effects of this application are:

The target gene library construction method of the present application uses the difference in gene expression between the fetus and the mother to construct a target gene library for genes expressed by the fetus and hardly expressed by the mother based on free RNA extracted from the pregnant woman. The target gene library construction method of the present application and the fetal gene detection method based on the constructed target gene library, first, the present application detects the differential genes expressed by the fetus and the mother, especially those that are specifically expressed by the fetus and almost not expressed by the mother Genes can eliminate the interference of maternal background, and solve the problem that the mutation detection cannot be judged due to the large amount of maternal background in the detection based on free DNA; second, this application is specific for the target gene in free RNA of maternal plasma Amplification can detect fetal genes with low expression in plasma, and solve the problem of losing low-expression mRNA based on full transcriptome detection. Third, cfmRNA is a complete transcript obtained after DNA translation. The sequence, which removes a lot of redundant information of introns, can reflect the structural variation of DNA occurring on exons. Therefore, the present application can detect genetic structural variation, which solves the difficulty of detecting genetic structural variation in the existing free DNA-based detection Question; Fourth, the target gene library constructed in this application is used for fetal gene detection. When detecting recessive single gene disease, there is no need to know the information of parents and probands, no need to construct fetal haploid information, and the operation is simpler. The cost is lower. The construction method of the target gene library and the fetal gene detection method based on the constructed target gene library of this application are simple in operation and low in cost, and can meet the clinical use requirements, laying a foundation for the further promotion and use of non-invasive detection for pregnant women.

BRIEF DESCRIPTION

FIG. 1 is a schematic diagram of a technical process of a method for constructing a target gene library in an embodiment of the present application;

2 is a distribution diagram of the coverage depth of each amplicon in Example 1 of the present application;

3 is a graph of repetitive statistical results of two repeated sequencing samples of plasma samples of pregnant women with normal fetuses in Example 1 of the present application;

4 is a graph of repetitive statistical results of two repeated sequencing samples of a pregnant woman plasma sample with a fetus with congenital afibrinogenemia in Example 1 of the present application;

FIG. 5 is a statistical result diagram of the base coverage of four sequencing samples in the first embodiment of the present application to the target pathogenic site;

6 is a graph showing the results of base coverage of four sequencing samples in Example 2 of the present application on target pathogenic sites.

detailed description

The existing fetal gene detection method is mainly for free fetal DNA in the blood of pregnant women. The detection method based on free fetal DNA provided by Dennis Lo et al. can not only determine whether the fetus obtains the pathogenic mutation from the father, but also Judgment of the status of alleles inherited by the fetus from the mother. However, the detection methods of Dennis Lo and others are complicated and costly, and it is difficult to meet the needs of clinical use; and, more importantly, the detection method based on free fetal DNA is difficult to detect genetic structure variation.

Research by the inventors of the present application shows that the transcript profile of the pregnant woman and the transcript profile of the fetus are different throughout the pregnancy period; the expression of different genes in time and space varies during the development of the fetus from the fertilized egg into an individual, for example, for certain Genes are not expressed by the mother, while the fetus is expressed during a certain period of pregnancy or has been expressed throughout pregnancy. The inventors of the present application found that diseases caused by mutations in genes that differ in fetal and maternal expression can be detected by directly detecting cfmRNA expressed specifically in fetuses in plasma. Fetal-specifically expressed RNA is released into the blood circulation through the placenta. By detecting cfmRNA in the blood circulation, mutations in the fetal DNA level can be deduced.

Based on the above research and knowledge, the present application creatively proposes a new method for constructing a target gene library, including extracting free RNA from biological samples derived from pregnant women, the free RNA includes fetal free RNA; and reverse transcription of the extracted free RNA is generated First-strand cDNA; the first-strand cDNA is amplified with specific primers to obtain specific amplification products, wherein the specific primers can specifically amplify the target gene, which is a differentially expressed gene of the fetus and the mother, specific The sequence of the 5'end of the upstream primer and/or the downstream primer of the sexual primer is the same as at least a part of the sequence of the universal primer; the universal primer is used to perform a second round of PCR amplification on the specific amplification product to obtain the target gene library of the present application.

On the basis of the target gene library construction method of the present application, the present application further proposes a fetal gene detection method based on the target gene library construction method of the present application, and a fetal gene detection device and the like. Further, based on a specific application of the target gene library construction method and fetal gene detection method of the present application; and the present application proposes a reagent and kit for fetal FGA gene detection; a fetal HESX1 gene detection method Reagents and kits.

The fetal gene detection method of the present application is based on the detection of free plasma RNA from pregnant women. The cfmRNA specifically expressed by fetus in plasma can easily detect the type of mutation of the fetus, including the genetic structure, so as to analyze whether the fetus carries the mutation of the parent. Specifically, during pregnancy, some genes of the fetus are specifically expressed and released into the mother's blood circulation system through the placenta. If these genes are related to certain diseases, the plasma cfRNA can be directly detected to detect the fetus. DNA mutation, as shown in Figure 1.

The fetal gene detection method of the present application, for example, for recessive sick leave, the maternal genotype is AA or Aa, and the decision logic is:

If only AA is detected in plasma cfRNA, then the fetal genotype is AA;

If only Aa is detected in the plasma cfRNA, there are only two cases: 1) A: a = 1:1, then the genotype of the fetus is Aa; 2) A<<a, that is, the detected A is much smaller than a, then The genotype of the fetus is aa;

If only aa is detected in plasma cfRNA, then the fetal genotype must be aa.

The target gene library construction method and fetal gene detection method of the present application use genes with different expressions in the fetus and the mother to detect, and are particularly suitable for genes that are specifically expressed by the fetus, but the mother does not express or the expression of the mother is very low, such genes As shown in Table 1.

Table 1 List of detectable genes

KRT7	CSH1	PSG8	GBP1P1	SEMA3B
TMEM54	KISS1	ENDOU	CLDN4	GPC3
PRKCZ	STAT1	EGFR	C2orf72	PLAC2
SDC1	CGA	DUSP4	PAPPA2	PSG9
LGALS13	CSH2	PHYHIPL	HIST2H3A	FN1
EFHD1	TFPI2	CTSF	HIST2H3C	NOS3
CAPN6	GBP1	TRIM29	TCL6	LOC100506655
XAGE3	PLAC4	RCN3	MFSD2A	PSG11
EBI3	HSD17B1	SPIRE2	ZFAT-AS1	SPTLC3
GH2	CSHL1	LOC100216001	INSL4	EXPH5
PAGE4	KRT8	FAM176A	DHRS2	HSPA2
ALPP	KRT18	SCIN	HES2	PSG6
INHBA	HPGD	ZNF500	WLS	PLAC1
LOC100505659	GADD45G	PRR16	PLCXD3	TACC2
FBLN1	LGALS14	LOC100128054	LOC100505483	PRPF40B
LOC388948	ADAM12	GRHL2	SVEP1	CRH
SERPINB2	PSG2	PPP1R32	CRYAB	EFS
HSD3B1	OLR1	C1orf130	HSPB8	TIMD4
KRT19	SLC30A2	FOSB	PKIB	ALDH3B2
SERPINE1	LOC285972	GCM1	PGF	KRT81
GDF15	HESX1	TRPV6	CYP11A1	MUC15
CYP19A1	TMEM139	TFAP2A	PSG5	PRSS8
PSG4	ZNF727	MMP11	PSG1	SH2D5
PSG3	TM4SF19	TUSC3	PAPPA	LOC728175
HMGCR	GLDN	C8orf39	VGLL3	CORO6
CCK	PGAP3	LOC100129935	MSX2P1	GH1
PABPN1L	FGA	A	A	A

Table 1 shows the genes that are specifically expressed by the fetus, but the mother does not express or has very little expression. These genes can be used for the detection of the fetal gene of the present application for recessive genetic single gene disease mutations, fetal genotypes, genetic structure variations, etc. Detection.

The target gene library construction method of the present application and the fetal gene detection method based on the constructed target gene library can perform fetal genotype detection, and can easily realize genetic structure variation detection; and the operation is simple, the detection cost is relatively low, and It satisfactorily satisfies the use of clinical testing and lays the foundation for the further promotion and application of noninvasive production testing.

The present application will be further described in detail below through specific embodiments. The following examples only further illustrate the present application, and should not be construed as limiting the present application.

Example one

Congenital afibrinogenemia is a bleeding symptom caused by the loss of the coagulation process. Most of them are related to mutations in the FGA gene and are autosomal recessive genetic diseases. During pregnancy, the gene is rarely or not expressed in the mother, while the fetus is specifically expressed. Therefore, in this example, the fetal FGA gene was tested to verify the target gene library construction method and fetal gene detection method of the present application.

In this example, six primer pairs were designed, namely specific primer pairs, covering common FGA mutation sites; the primer pairs designed in this example are shown in Table 2, and the common FGA mutation sites covered are shown in Table 3. In addition, this example also designed a pair of primers to amplify GAPDH as a sample reference for reference for successful experiment and sample quantification. The specific primer sequences are shown in Table 2. In Table 2, FGA-F01 and FGA-R01 are the first primer pair, FGA-F02 and FGA-R02 are the second primer pair, FGA-F03 and FGA-R03 are the third primer pair, FGA-F04 and FGA-R04 It is the fourth primer pair, FGA-F05 and FGA-R05 are the fifth primer pair, FGA-F06 and FGA-R06 are the sixth primer pair, and GAPDH-F and GAPDH-R are the primer pairs for amplifying GAPDH.

Table 2 Specific primer pairs and GAPDH amplification primers

Primer number	Sequence (5’→3’)	SEQ ID NO.
FGA-F01	GACCGCTTGGCCTCCGACTT TGTTTGCTGTAACTTGAAGATTTACC	1
FGA-R01	GACATGGCTACGATCCGACTT CTTCTCACCTATGTTAGGAGAG	2
FGA-F02	GACCGCTTGGCCTCCGACTT ATTGCCTCGGGACAGTCAGAACCA	3
FGA-R02	GACATGGCTACGATCCGACTT CAGGACTGGTAAAGAGAAGGTCACC	4
FGA-F03	GACCGCTTGGCCTCCGACTT GCCAGGATTCCAGGTTCCGGTAC	5
FGA-R03	GACATGGCTACGATCCGACTT GGACTGGAGGGACTGCAACCTGG	6
FGA-F04	GACCGCTTGGCCTCCGACTT CGAGTAATCTCATTTCCACCAGGTCTC	7

FGA-R04	GACATGGCTACGATCCGACTT TGAACAGGTCATTGCCAAAGACTT	8
FGA-F05	GACCGCTTGGCCTCCGACTT CACTTTTCTCTGCATATAGTAGAC	9
FGA-R05		GACATGGCTACGATCCGACTT AATTGAAGTCCTGAAGCGCAAAG	10
FGA-F06	GACCGCTTGGCCTCCGACTT TGACTGCTTACCCAGTCTTCAT	11
FGA-R06	GACATGGCTACGATCCGACTT TATGTGAATGAATCTTTAAAGACTGC	12
GAPDH-F	GACCGCTTGGCCTCCGACTT TCAACGACCACTTTGTCAAGC	13
GAPDH-R	GACATGGCTACGATCCGACTT GCCAGACCCTGCACTTTTTAAG	14

In Table 2, the underlined sequence, that is, the 20 bp sequence at the 5'end of the upstream primer and the 21 bp sequence at the 5'end of the downstream primer is the linker sequence. In this example, when the first round of PCR is performed on the cDNA, a part of the adapter sequence is introduced through the primer; in the second round of PCR, that is, when the specific primer is used to amplify the specific PCR amplification product, the complete linker containing the tag sequence is introduced through the universal primer Sequence, these linker sequences can be adjusted according to different sequencing platforms.

Table 3 FGA mutation sites covered by specific primer pairs

Numbering	mutation	Location on HG38
1	c.510+1G>T	chr4:154587511
2	c.1622delT(p.Val541Alafs)	chr4:154585807
3	c.1634A>T(p.Glu545Val)	chr4:154585795
4	c.104G>A(p.Arg35His)	chr4:154589513
5	c.103C>T(p.Arg35Cys)	chr4:154589514
6	c.571G>A(p.Gly191Arg)	chr4:154609725
7	c.1718G>T(p.Arg573Leu)	chr4:154585711
8	c.1629delG(p.Thr544Leufs)	chr4:154585800
9	c.711dupT(p.Lys238Terfs)	chr4:154586718
10	c.502C>T(p.Arg168Ter)	chr4:154587520

In this example, the free RNA in the blood of pregnant women is extracted, and the cfRNA is reverse transcribed into cDNA, which is combined with multiple PCR to complete the preparation of the target library, and then the mutation information is obtained through high-throughput sequencing. The details are as follows:

Experimental sample: 1 mL of a plasma sample of a pregnant woman carrying a normal fetus. The sample was divided into 2 equal parts for repeated testing. A pregnant woman with a fetus known to have a congenital afibrinogenemia. The fetus was clinically diagnosed with a gene mutation: c.103C>T(p.Arg35Cys). The pregnant woman’s plasma sample was 1 mL, and the sample was also averaged. Divided into 2 parts, as a repeated test.

1.cfRNA extraction

The plasma samples were extracted from Qigen using Qigen’s

The Circulating Nucleic Acid Kit was extracted according to standard operating procedures, and the final total RNA was dissolved in 20 μL of water.

2. cDNA first strand synthesis

Thermofisher's first-strand cDNA synthesis kit SuperScript ^™ IV First-Strand Synthesis System 18091200 was used, as follows:

First add 1 μL of 10 mM dNTPs, 1 μL of 50 ng/μL random primers, and 1 μL of extracted RNA to 10 μL of RNase free H ₂ O, mix for 5 minutes at 65°C, and place on ice for 1 minute to obtain an RNA mixture. Among them, the random primer is an N ₆ random primer.

Then prepare a 20μL reverse transcription system, including: 5×SSIV BUFFER 4μL, 100mM DTT 1μL, Ribonuclease Inhibitor 1μL, 200U/μL SuperScript TM IV Reverse Transcriptase 1μL, and the previous step RNA mixture 13μL.

After the reverse transcription system was mixed quickly, 10 minutes at 23°C and 10 minutes at 55°C. After the reaction was completed, 30 μL of Agencourt AMPure XP magnetic beads were added to obtain a 50 μL magnetic bead purification system. Purification was performed according to the instructions. Finally, 20 μL of distilled water was used to dissolve the DNA. Among them, Agencourt AMPure XP magnetic beads were purchased from Beckman Coulter Co., Ltd.

3. Specific PCR amplification

The PCR amplification enzyme adopts KAPA2G Fast Multiplex PCR Kit product number KK5801 of American kapa company.

The PCR reaction system includes: 2×kapa polymerase mixed solution 25 μL, 10 μM primer pool 5 μL, purified DNA 20 μL, a total of 50 μL.

The primer pool includes the specific primer pairs shown in Table 1 and the primer pairs for amplifying GAPDH. The concentration of the upstream and downstream primers of each primer pair in the primer pool is 10 μM.

The PCR reaction conditions were: pre-denaturation at 98°C for 2 min, and then entered into 15 cycles: 98°C for 10 s, 62°C for 2 min, and 72°C for 30 s. After the cycle was extended at 72°C for 5 min, PCR amplification was completed.

After the PCR is completed, add 1 volume of Agencourt AMPure XP magnetic beads to the PCR amplification product, that is, add 50 μL of magnetic beads, and purify according to the instructions. After purification, dissolve the DNA in 20 μL of distilled water.

4. Universal PCR amplification

The PCR amplification enzyme adopts KAPA2G Fast Multiplex PCR Kit product of American kapa company, article number KK5801.

The reaction system includes: 25×L of 2×kapa polymerase mixture, 2.5 μL of 10 μM first primer, 2.5 μL of 10 μM second primer, and 20 μL of DNA obtained from the purified product of specific PCR amplification, totaling 50 μL.

The first primer is the sequence shown in SEQ ID NO.15, the second primer is the sequence shown in SEQ ID NO.16; and, the 5'end of the first primer has a phosphorylation modification.

SEQ ID NO.15: 5’-GAACGACATGGCTACGATCCGACTT-3’

SEQ ID NO.16:

5'-TGTGAGCCAAGGAGTTGCTGCGTACATTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT-3'.

The reaction conditions were: pre-denaturation at 98°C for 2min, then 15 cycles: 98°C for 10s, 62°C for 2min, 72°C for 30s, and 72°C extension for 5min after the end of the cycle.

After the reaction, add 1 volume of Agencourt AMPure XP magnetic beads, add 50 μL of magnetic beads, and purify according to the instructions. After purification, dissolve the DNA in 20 μL of distilled water.

5. Computer sequencing

After the library quality test is passed, DNA nanospheres are prepared according to the requirements of BGISEQ-500 platform of BGI, and then the DNA nanospheres are sequenced on the computer. The sequencing type is 50bp double-ended. The preparation of DNA nanospheres includes: denaturing double-stranded nucleic acid amplification products into single-stranded nucleic acids through high temperature, using nucleic acid-mediated fragments to connect single-stranded nucleic acids into circular single-stranded nucleic acids, and performing rolling circle amplification on the circular single-stranded nucleic acids To obtain DNA nanospheres. For detailed steps, please refer to the instruction of BGISEQ-500 platform of BGI.

6. Data analysis

After the data is off the machine, remove the connector, use cutadapt 1.18 software to remove the fastq file and low-quality filtering (see https://github.com/marcelm/cutadapt/) to obtain filtered reads (clean reads); use BWA Or other comparison software compares fastq data to the reference genome, statistical comparison rate, comparison rate = reads/clean reads of the reference genome; remove reads from multiple comparisons, and count the reads that leave the only comparison, Count the number of reads at all target amplification positions, count the total number of reads in each amplicon region, the coverage depth of the amplicon, count the base distribution of the target site, and obtain site mutation information and disease database according to the base distribution Make a comparison to get the mutation detection result.

The statistical results of the number of original reads, the number of de-joined reads, the number of aligned reads, and the number of reads in the target area for the four sequencing samples are shown in Table 4. Among them, four sequencing samples, that is, two repeated sequencing samples of plasma samples of pregnant women with normal fetuses, and two repeated sequencing samples of plasma samples of pregnant women with fetal congenital afibrinogenemia.

Table 4 Statistical results of offline data

Sample number	Raw reads	Go to the joint reads	Compare reads	Target area reads
Sample 1 repeats 1	67394	65987	64991	63981
Sample 1 repeats 2	76542	74541	73923	73012
Sample 2 repeats 1	63495	62596	61463	60982
Sample 2 repeats 2	79482	78210	77129	76365

In Table 4, sample 1 repeats sample 1 and sample 1 repeats 2, that is, 2 repeated sequencing samples of the plasma samples of pregnant women with normal fetus; sample 2 repeats sample 1 and sample 2 repeats 2, ie suffers from congenital afibrin Two repeated sequencing samples of maternal plasma samples of protozoan fetuses. The results in Table 4 show that in the fetal FGA gene detection method of this example, the data utilization rate of the off-machine data can reach 97%, the comparison rate can reach 98%, and the target area ratio can reach 98%.

The coverage of each specific primer pair and GAPDH amplification primers in the four sequencing samples is statistically shown in Figure 2; in Figure 2, the abscissas FGA01, FGA02, FGA03, FGA04, FGA05, FGA06 are in order Coverage of one pair of primers to the sixth pair of primers in four sequencing samples, 1-repeat 1, 1-repeat 2 are two replicate sequencing samples of pregnant fetal plasma samples from normal fetuses, 2-repeat 1, 2-repeat 2 Two repeated sequencing samples of plasma samples from pregnant women with fetuses with congenital afibrinogenemia. The results in Figure 2 show that the depth distribution obtained after sequencing each amplicon (ie, primer pair) is within 5 times the depth difference between different amplicons in the four samples.

The repeatability of two repeated sequencing samples of the plasma samples of pregnant women with normal fetuses was counted. The results are shown in Figure 3. The vertical coordinate of Figure 3 is the coverage of duplicate 1, and the horizontal coordinate is the coverage of duplicate 2. The repeatability of two repeated sequencing samples of the plasma samples of pregnant women with congenital non-fibrinogenemia fetuses was counted. The results are shown in Figure 4. The vertical coordinate of Figure 4 is the coverage of Repeat 1, and the horizontal Coverage for repeat 2. The results of Figure 3 and Figure 4 show that the depth stability of each amplicon obtained from different experiments of the same sample is very good. As shown in Figure 3, the two repeated R ² = 0.9666, as shown in Figure 4, the two repeated R ² = 0.9797, indicating that the repeatability of each sample is very good.

The base coverage of the target pathogenic site was counted by sequencing data. The results are shown in Fig. 5. The abscissa of Fig. 5 is four sequencing samples, the ordinate is the coverage depth ratio, █ indicates the pathogenic base, □ indicates Normal bases. Figure 5 shows the coverage of the four sequencing samples for the target site c.103C>T. The results in Figure 5 show that the plasma samples of pregnant women with two normal fetuses can cover the pathogenic bases well, and the plasma samples of two pregnant women with congenital afibrinogenemia can also cover the normal. Base, indicating that the sequencing data of this example has a good coverage of the target pathogenic site.

The results of mutation analysis on four sequencing samples are shown in Table 5.

Table 5 Sample test results

Sample number	Clinical test results	Test results in this case
Sample 1 repeats 1	No mutation	No mutation detected
Sample 1 repeats 2	No mutation	No mutation detected
Sample 2 repeats 1	c.103C>T	c.103C>T
Sample 2 repeats 2	c.103C>T	c.103C>T

The results in Table 5 show that no mutations were detected in two repeated sequencing samples of plasma samples of pregnant women with normal fetuses; and two repeated sequencing samples of plasma samples of pregnant women with fetal congenital afibrinogenemia C.103C>T was detected, and the results were in line with expectations, indicating that the fetal FGA gene detection method in this case can accurately detect single base mutations of the FGA gene.

Example 2

Optic septal dysplasia is a rare anterior malformation of the midline structure, also known as De-Morsier syndrome, including the absence of transparent septa and dysplasia of the visual transmission pathway, which can be combined with other developmental abnormalities in the brain. Part of the cause is caused by mutations in the HESX1 gene. During pregnancy, the gene is rarely or not expressed in the mother, while the fetus is specifically expressed. Therefore, in this example, the fetal HESX1 gene was tested to verify the target gene library construction method and fetal gene detection method of the present application.

In this example, 7 pairs of specific primers were designed to cover the common HESX1 mutation sites; the primer pairs designed in this example are shown in Table 6, and the covered common HESX1 mutation sites are shown in Table 7. In addition, this example also uses a pair of primers to amplify GAPDH as a sample reference for reference for successful experiment and sample quantification. The specific primer sequences are shown in Table 1. In Table 6, HESX-F01 and HESX-R01 are primer pair one, HESX F02 and HESX-R02 are primer pair two, HESX-F03 and HESX-R03 are primer pair three, and HESX-F04 and HESX-R04 are primer pair four , HESX F05 and HESX-R05 are primer pair five, HESX-F06 and HESX-R06 are primer pair six, HESX-F07 and HESX-R07 are primer pair seven.

Table 6 Specific primer pairs

Primer number	Sequence (5’→3’)	SEQ ID NO.
HESX1-01F	GACCGCTTGGCCTCCGACTTCACTTCTTTAGAGAAAGTTAAGTC	17
HESX1-01R	GACATGGCTACGATCCGACTTTCCTGTCTTAGAAAGTTTTAGC	18
HESX1-02F	GACCGCTTGGCCTCCGACTTGCTGGGCAAGTGTTCATTGAC	19
HESX1-02R		GACATGGCTACGATCCGACTTGGAGACATCCTCTCGTGGTCTGCA	20
HESX1-03F	GACCGCTTGGCCTCCGACTTCAGAGGCCAGAGCTGTTGCTC	twenty one
HESX1-03R	GACATGGCTACGATCCGACTTGACATAAGTTACCATCTTTCC	twenty two
HESX1-04F	GACCGCTTGGCCTCCGACTTGGGCAGACACCTGCAGCTCATC	twenty three
HESX1-04R	GACATGGCTACGATCCGACTTTCTTCGGCCTCTATACCAACTC	twenty four
HESX1-05F	GACCGCTTGGCCTCCGACTTAAGACTGTCTTTGAAAAGAGAG	25
HESX1-05R	GACATGGCTACGATCCGACTTCTTTTCAGTTTTGCACGCCGA	26
HESX1-06F	GACCGCTTGGCCTCCGACTTACAGAATCCAGATTTGGTTTCAA	27
HESX1-06R	GACATGGCTACGATCCGACTTTTTAACACTTAATATTTCCACTG	28

HESX1-07F	GACCGCTTGGCCTCCGACTTCTTCTAATTGCAGAGCATGAAGA	29
HESX1-07R		GACATGGCTACGATCCGACTTTCTTTACTATAACTAAAAGTGCCC	30

Table 7 HESX1 gene mutation sites covered by specific primer pairs

Mutation number	mutation	Location on HG38
18	c.18G>C(p.Gln6His)	chr3:57199901
19	c.313T>G(p.Trp105Gly)	chr3:57198797
20	c.357+2T>C	chr3:57198751
twenty one	c.445G>A(p.Glu149Lys)	chr3:57198405
twenty two	c.450_451delCA(p.Asp150Glufs)	chr3:57198399-57198400
twenty three	c.478C>T(p.Arg160Cys)	chr3:57198277
twenty four	c.509C>T(p.Ser170Leu)	chr3:57198246
25	c.511_512delCA(p.Gln171Valfs)	chr3:57198243-57198244
26	c.77T>C(p.Ile26Thr)	chr3:57199842

The experimental sample in this case: 1 mL of a plasma sample of a pregnant woman carrying a normal fetus, sample No. 3, which was divided into 2 equal parts as a repeated test. After MRI, the pregnant woman was found to have a dysplasia of the septum and a positive biopsy. The fetus was clinically diagnosed with a gene mutation: ESX1, c.509C>T, p.Ser170Leu; take a plasma sample of the pregnant woman 1mL, No. 4 sample, equally divide the sample into 2 parts, as a repeated test.

In this example, the primers in Table 6 were used to prepare the sequencing library using the same library construction method as in Example 1. The general primers used in the library preparation process were the same as in Example 1. Then use the same sequencing platform as in Example 1 for on-machine sequencing, and use the same method as in Example 1 for data analysis.

In this example, the sequencing data was used to count the base coverage of the target disease site. The results are shown in Figure 6. The abscissa of Figure 6 is four sequencing samples, sample 3 repeats 1 and sample 3 repeats 2, which is normal. 2 repeated sequencing samples of fetal maternal plasma samples; sample 4 repeats 1 and sample 4 repeats 2, that is, 2 repeat sequencing samples of maternal plasma samples with fetal dysplasia; the ordinate is the depth of coverage ratio , █ indicates a pathogenic base, □ indicates a normal base, and Figure 6 shows the coverage of the four sequencing samples for the target site c.509C>T. The results in Figure 6 show that the plasma samples of pregnant women with two normal fetuses can well cover the pathogenic bases, and the plasma samples of two pregnant women with fetal dysplasia can also cover the normal bases well. The sequencing data in this case has a good coverage of the target pathogenic site.

The results of mutation analysis on four sequencing samples are shown in Table 8.

Table 8 Sample test results

Sample number

Clinical test results

Test results in this case

Sample 3 repeats 1	No mutation	No mutation detected
Sample 3 repeats 2	No mutation	No mutation detected
Sample 4 repeats 1	c.509C>T	c.509C>T
Sample 4 repeats 2	c.509C>T	c.509C>T

The results in Table 8 show that no mutations were detected in two repeated sequencing samples of plasma samples of pregnant women with normal fetuses; and two. >T, the result is as expected, indicating that the fetal HESX1 gene detection method in this example can accurately detect single-base mutations of the HESX1 gene.

The target gene library construction method of the present application and the fetal gene detection method based on the constructed target gene library can not only detect the single base mutation of the FGA gene in Example 1 and the single base mutation of the HESX1 gene in Example 2, Similarly, genes similar to those of the FGA gene and the HESX1 gene, which are specifically expressed by the fetus but not expressed by the mother or expressed in very small amounts, such as the genes shown in Table 1, can also be tested as long as the invention of the present application The idea is to design the corresponding specific primer pairs covering the mutation sites of each gene, and then perform the first round of PCR amplification on the cDNA; the extraction of cfRNA before the specific amplification, the synthesis of the first strand of cDNA, and the subsequent general PCR amplification For augmentation, computer sequencing, and data analysis, refer to the FGA gene detection method in Example 1 of the present application.

The above content is a further detailed description of this application in conjunction with specific embodiments, and it cannot be assumed that the specific implementation of this application is limited to these descriptions. For a person of ordinary skill in the technical field to which this application belongs, without deviating from the concept of this application, several simple deductions or replacements can be made, which should be regarded as falling within the protection scope of this application.

Claims (35)

1. A method for constructing a target gene library, characterized in that it includes the following steps,

   Extract free RNA from biological samples derived from pregnant women, the free RNA including fetal free RNA;

   Reverse transcription of the extracted free RNA to generate the first strand cDNA;

   Amplify the first-strand cDNA with specific primers to obtain specific amplification products, wherein the specific primers can specifically amplify the target gene, which is a differentially expressed gene of the fetus and the mother, The sequence of the 5'end of the upstream primer and/or the downstream primer of the specific primer is the same as at least a part of the sequence of the universal primer;

   The specific amplification product is subjected to a second round of PCR amplification using a universal primer to obtain the target gene library.
2. The method according to claim 1, characterized in that the differentially expressed genes are genes that are specifically expressed by the fetus and hardly expressed by the mother.
3. The method according to claim 2, wherein the differentially expressed genes are at least one of the genes shown in Table 1.
4. The method according to claim 1, wherein the biological sample is peripheral blood or urine.
5. The method according to claim 1, characterized in that: the reverse transcription of the extracted free RNA to generate the first strand cDNA, which specifically comprises reverse transcription of the free RNA using random primers to obtain the first strand cDNA; preferably, The random primer is N6 random primer.
6. The method according to claim 1, wherein the specific primer is at least one of a first primer pair to a sixth primer pair;

   The upstream and downstream primers of the first primer pair are the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and the upstream and downstream primers of the second primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4. Sequence, the upstream and downstream primers of the third primer pair are the sequences shown in SEQ ID NO.5 and SEQ ID NO.6, and the upstream and downstream primers of the fourth primer pair are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively Sequence, the upstream and downstream primers of the fifth primer pair are the sequences shown in SEQ ID NO.9 and SEQ ID NO.10, and the upstream and downstream primers of the sixth primer pair are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively sequence.
7. The method according to claim 1, wherein the specific primer is at least one of primer pair one to primer pair seven;

   The upstream and downstream primers of primer pair 1 are the sequences shown in SEQ ID NO. 17 and SEQ ID NO. 18, respectively, and the upstream and downstream primers of primer pair 2 are the sequences shown in SEQ ID NO. 19 and SEQ ID NO. 20, respectively. The upstream and downstream primers of primer pair 3 are the sequences shown in SEQ ID NO.21 and SEQ ID NO.22, respectively. The upstream and downstream primers of primer pair 4 are the sequences shown in SEQ ID NO.23 and SEQ ID NO.24, respectively. The five upstream and downstream primers are the sequences shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively. The upstream and downstream primers of the primer pair 6 are the sequences shown in SEQ ID NO. 27 and SEQ ID NO. 28, respectively, and the primer pair 7 is The upstream and downstream primers are SEQ ID NO.29 and SEQ ID NO.30.
8. The method according to any one of claims 1-7, further comprising: using specific primers to amplify the first strand cDNA while using reference primers to amplify the first strand cDNA, said The reference primer can specifically amplify the housekeeping gene.
9. The method according to claim 8, wherein the housekeeping gene is the GAPDH gene.
10. The method according to claim 9, wherein the upstream and downstream primers of the reference primer are the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively.
11. The method according to any one of claims 1-7, wherein the universal primer includes a first primer and a second primer, the first primer is the sequence shown in SEQ ID NO.15, and the second The primer is the sequence shown in SEQ ID NO. 16; and, preferably, the 5'end of the first primer has a phosphorylation modification.
12. The method according to any one of claims 1-7, further comprising: after the second round of PCR amplification, denaturing the second round of PCR amplification products into single-stranded nucleic acids, and using nucleic acid-mediated fragments to The single-stranded nucleic acid is connected into a circular nucleic acid to obtain a circular target gene library, wherein the nucleic acid-mediated fragment can be combined with the two ends of the single-stranded nucleic acid through the base complementary pairing principle.
13. A method for detecting fetal genes, which is characterized by the following steps:

    Using the method of any one of claims 1-12 to construct a target gene library to obtain the target gene library;

    Sequencing the target gene library to obtain sequencing results composed of multiple sequencing data;

    The sequencing results are analyzed to obtain fetal genetic information.
14. The detection method according to claim 13, wherein the genetic information of the fetus includes at least one of mutation information of recessive genetic single gene disease, fetal genotype information, and genetic structure variation information.
15. The detection method according to claim 13 or 14, wherein the analysis of the sequencing result specifically includes the following steps,

    Filtering the sequencing data;

    Compare the filtered sequencing data to the reference genome, and retain the unique sequencing data of the reference genome;

    Based on the unique comparison of the sequencing data of the reference genome, the base distribution of the target gene is counted to obtain mutation information of the target gene, and then obtain the genetic information of the fetus.
16. The detection method according to claim 15, characterized in that: analyzing the sequencing result, further comprising comparing the mutation information of the target gene with a disease database to obtain mutation information of the recessive genetic single gene disease of the fetus .
17. A fetal gene detection device, characterized in that it includes a free RNA extraction module, a reverse transcription module, a target gene amplification module, a target gene library generation module, a sequencing module and an analysis module;

    The free RNA extraction module is used to extract free RNA from biological samples derived from pregnant women, the free RNA includes fetal free RNA;

    The reverse transcription module is used for reverse transcription of the extracted free RNA to generate the first strand cDNA;

    The target gene amplification module is used to amplify the first-strand cDNA with specific primers to obtain specific amplification products. The specific primers can specifically amplify the target gene, and the target gene is the fetus and The differentially expressed genes of the maternal, the sequence of the 5'end of the upstream primer and/or the downstream primer of the specific primer is the same as at least a part of the sequence of the universal primer;

    The target gene library generation module is used to perform a second round of PCR amplification on the specific amplification product using universal primers to obtain the target gene library;

    The sequencing module is used to sequence the target gene library to obtain sequencing results composed of multiple sequencing data;

    The analysis module is used to analyze the sequencing results to obtain fetal genetic information.
18. The detection device according to claim 17, wherein in the free RNA extraction module, the biological sample is peripheral blood or urine.
19. The detection device according to claim 17, wherein the reverse transcription module reversely transcribes the extracted free RNA to generate a first strand cDNA, which specifically comprises performing reverse transcription of the free RNA using random primers to obtain the first strand cDNA; preferably, the random primer is an N6 random primer.
20. The detection device according to claim 17, wherein in the target gene amplification module, the differentially expressed genes are genes that are specifically expressed by the fetus and hardly expressed by the mother.
21. The detection device according to claim 20, wherein the differentially expressed genes are at least one of the genes shown in Table 1.
22. The detection device according to claim 17, wherein in the analysis module, the genetic information of the fetus includes at least one of mutation information of the recessive single gene disease, fetal genotype information, and genetic structure variation information.
23. The detection device according to any one of claims 17-22, wherein the analysis module further includes a filtering unit, a reference genome comparison unit, and a statistical unit;

    The filtering unit is used to filter the sequencing data;

    The reference genome comparison unit is used to compare the filtered sequencing data to the reference genome, and retain the unique comparison of the sequencing data of the reference genome;

    The statistical unit is used to count the base distribution of the target gene based on the sequencing data of the unique reference genome, to obtain mutation information of the target gene, and then obtain genetic information of the fetus.
24. The detection device according to claim 23, wherein the analysis module further comprises a disease database comparison unit, the disease database comparison unit is used to compare the target gene mutation information with the disease database to obtain the hidden fetus Information on mutations in sexually inherited single gene diseases.
25. The method according to any one of claims 1-12, the detection method according to any one of claims 13-16, or the detection device according to any one of claims 17-24 in recessively inherited monogenic diseases Detection, or application of structural variation detection.
26. A reagent for fetal FGA gene detection, characterized in that it includes a specific primer for amplifying the FGA gene, the specific primer includes at least one of the first primer pair to the sixth primer pair, the first The upstream and downstream primers of the primer pair are the sequences shown in SEQ ID NO.1 and SEQ ID NO. 2, respectively. The upstream and downstream primers of the second primer pair are the sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively. The upstream and downstream primers of the primer pair are the sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively. The upstream and downstream primers of the fourth primer pair are the sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively. The upstream and downstream primers of the primer pair are the sequences shown in SEQ ID NO. 9 and SEQ ID NO. 10 respectively, and the upstream and downstream primers of the sixth primer pair are the sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12 respectively.
27. The reagent according to claim 26, further comprising a reference primer for amplifying the housekeeping gene GAPDH, the upstream and downstream primers of the reference primer are shown in SEQ ID NO. 13 and SEQ ID NO. 14 respectively sequence.
28. The reagent according to claim 26 or 27, further comprising a universal primer for constructing a sequencing library, the universal primer includes a first primer and a second primer, and the first primer is SEQ ID NO. 15 In the sequence shown, the second primer is the sequence shown in SEQ ID NO. 16; and, preferably, the 5'end of the first primer has a phosphorylation modification.
29. A kit for detecting fetal FGA genes, characterized in that the kit includes the reagent according to any one of claims 26-28.
30. The kit according to claim 29, wherein the kit further comprises at least one of free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, and nucleic acid purification reagents.
31. A reagent for fetal HESX1 gene detection, characterized in that it includes a specific primer for amplifying the HESX1 gene, the specific primer includes at least one of primer pair one to primer pair seven, and the primer pair one The downstream primers are the sequences shown in SEQ ID NO.17 and SEQ ID NO.18, the upstream and downstream primers of primer pair two are the sequences shown in SEQ ID NO.19 and SEQ ID NO.20, and the upstream and downstream primers of primer pair three are The sequences shown in SEQ ID NO.21 and SEQ ID NO.22 are respectively, the upstream and downstream primers of primer pair 4 are the sequences shown in SEQ ID NO.23 and SEQ ID NO.24, and the upstream and downstream primers of primer pair 5 are respectively SEQ ID NO.25 and SEQ ID NO.26, the upstream and downstream primers of primer pair 6 are SEQ ID NO.27 and SEQ ID NO.28, respectively, and the upstream and downstream primers of primer pair 7 are SEQ ID NO.29 and SEQ ID NO.30 shown in the sequence.
32. The reagent according to claim 31, further comprising a reference primer for amplifying the housekeeping gene GAPDH, the upstream and downstream primers of the reference primer are shown in SEQ ID NO. 13 and SEQ ID NO. 14 respectively sequence.
33. The reagent according to claim 31 or 32, further comprising a universal primer for constructing a sequencing library, the universal primer includes a first primer and a second primer, and the first primer is SEQ ID NO. 15 In the sequence shown, the second primer is the sequence shown in SEQ ID NO. 16; and, preferably, the 5'end of the first primer has a phosphorylation modification.
34. A kit for detecting fetal HESX1 gene, characterized in that the kit includes the reagent according to any one of claims 31-33.
35. The kit according to claim 34, wherein the kit further comprises at least one of free RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, and nucleic acid purification reagents.

Images