CN106755484A - The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit - Google Patents
The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit Download PDFInfo
- Publication number
- CN106755484A CN106755484A CN201710044342.7A CN201710044342A CN106755484A CN 106755484 A CN106755484 A CN 106755484A CN 201710044342 A CN201710044342 A CN 201710044342A CN 106755484 A CN106755484 A CN 106755484A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer group
- primer
- library
- sea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of noninvasive prenatal foetal α‑SEAThe poor detection in Gene Mutation library constructing method in type ground, detection method and kit.In library constructing method, specific joint is connected to maternal peripheral blood dissociative DNA fragment, then the pre- amplified production of joint connection product is divided into two parts, separately two-wheeled specific amplification is carried out using the upstream and downstream primer for target site, target site can be with high specificity enriched with, primer specific amplification is significantly improved.And two-wheeled specific amplification is carried out using the upstream and downstream primer sets of the multiple SNP sites for calculating fetus dissociative DNA ratio respectively, the poor genotype in fetus ground can efficiently, be accurately judged.Library of the invention is sequenced, α can be accurately and efficiently detected‑SEAThe poor gene mutation in type ground, its result is consistent with amniocentesis detection and genotyping, but security, non-invasive and high efficiency aspect are substantially better than amniocentesis detection.
Description
Technical field
The present invention relates to technical field of gene detection, more particularly to a kind of noninvasive prenatal foetal α-SEAThe poor gene mutation in type ground
Detection library constructing method, detection method and kit.
Background technology
Thalassemia (referred to as poor) is one of global high incidence hereditary disease, be due to human body gene mutation or
Person lacks and causes α, the imbalance of beta-globin peptide chain synthesis rate, so as to the hemolytic anemia for causing.Ground poor common two
Type is that α-ground is poor and β-ground is poor, and the poor related gene in α-ground is that the poor related gene of HBA2 and HBA1, β-ground is HBB.Ground meager set
In in subtropical and tropical zones, it is multiple to be born in Mediterranean country, secondly for the Middle East, India, Pakistan, Southeast Asia,
Southern china and north African, the U.S. are immigrant countries, and its incidence is also higher.Shi Dipin districts occurred frequently in each province on the south China the Changjiang river, extensively
Population be involved more than 200,000,000 in the ground such as east, Guangxi, Hainan, TaiWan, China and Hong Kong.In Chinese population, the poor gene type in α-ground is normal
That sees has-αSEA、-α3.7、-α4.2、αCS、αQSAnd αWS, β-ground is poor to common are 26 kinds of gene mutation types.It is poor at present to there is no
The method of radical cure, can only rely on traditional treatment methods, i.e., expensive based on treatment of blood transfusion, therefore Prenatal Screening and diagnosis
To preventing this kind of birth defect to be significant.
1997, Lu Yuming had found there is the dissociative DNA for coming from fetus in maternal blood slurry, and this is found to be and passes through
The noninvasive pre-natal diagnosis of maternal blood and detection embryonic gene type provide new possibility, with answering for high throughput sequencing technologies
With, noninvasive antenatal detection embryo chromosome abnormal (such as 21,18, the variation of 13 chromosome aneuploids) and the big copy number in part
Variation has been successfully applied to clinical Prenatal Screening and diagnosis, but fetus dissociative DNA only accounts for total in pregnant woman blood plasma in pregnant woman's body
The 3%-6% of dissociative DNA, the detection for the genetic disease of fetus non-invasive brings challenges.
Constantly there is researcher to attempt making detection to the poor gene in fetus ground by maternal blood dissociative DNA, due to pregnant
There are a large amount of source of parents dissociative DNAs in woman's peripheral blood, so the mutation of embryonic gene how is effectively distinguished, to the sensitive of detection method
Degree proposes requirement very high.The current antenatal method for detecting poor gene mutation of clinical report has several：Traditional amnion is worn
Thorn, abdomen fine hair biopsy etc., due to being have traumatic operation, may be with fetal damage, miscarriage or intrauterine infection equivalent risk.Profit
With noninvasive pre-natal diagnosis also some researchs of free fetal dna in Maternal plasma.Chiu RW are by using real-time fluorescence PCR skill
Art realizes the effective detection to the 4bp of father source codons 41/42 missings, and also researcher has developed for other β ground
The detection method of poor point mutation, but because detection mutation is generally point mutation, the specificity of method has much room for improvement.It is poor for α ground prominent
The research of change also has been reported that Warunee Tungwiwat et al. are established based on fluorescence quantitative PCR detection α0The method of missing,
But the sensitivity of the method has much room for improvement.Additionally, various highly sensitive technical methods are also attempted for non-invasively poor inspection
Survey, such as mass spectrum, digital pcr, COLD-PCR.But these detection methods for being based on the round pcr of single site exist certain
The characteristics of limitation, such as plasma dna low content and height fragmentation, it is likely that the false negative of PCR can be brought.This method can only
Enough detections specific father source mutation different from mother whether there is, and cannot further determine that the presence or absence of source of parents mutation.
The genome sequencing of the pregnant woman blood plasma dissociative DNA based on high throughput sequencing technologies or target area capture sequencing can be more
Accurately realize the detection to the poor gene in fetus ground, but the cost of genome sequencing and the complexity of analysis method and needs
Father and mother's haplotype etc. limits application clinically；Target area capture sequencing is low due to its target area capture rate, only
Can realize to fetus αSEAThe differentiation of pure heterozygous is lacked, and also there is the possibility of parting mistake.Given this, it is desirable to provide one
Plant the poor detection method of gene mutation in noninvasive prenatal foetal ground of pinpoint accuracy.
The content of the invention
The present invention provides a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation library constructing method in type ground, detection method
And kit, can accurately and efficiently detect α-SEAThe poor gene mutation in type ground, its result is consistent with amniocentesis detection and genotyping,
But security, non-invasive and high efficiency aspect are substantially better than amniocentesis detection.
According to the first aspect of the invention, the present invention provides a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation in type ground
Library constructing method, above-mentioned library is used to carry out noninvasive prenatal foetal α by high-flux sequence-SEAThe inspection of the poor gene mutation in type ground
Survey, the above method includes：
A () is to joint of the maternal peripheral blood dissociative DNA connection with special sequence label and optional sample label sequence
Sequence；
B () carries out pre- amplified library using pre- amplified library primer sequence to the connection product of previous step, wherein above-mentioned pre-
Amplified library primer sequence is complementary with above-mentioned joint sequence to be combined；
C pre- library obtained in the previous step is divided into the pre- library in the pre- library in upstream and downstream by (), upstream specificity is used respectively
Primer sets 1 and downstream specific primer group 1 carry out specific amplification to the pre- library in the pre- library in above-mentioned upstream and downstream, respectively obtain
Upstream specific amplification products 1 and downstream specific amplification products 1,
Wherein, above-mentioned upstream specific primer group 1 is included for expanding α-SEAThe sense primer 1 and use of the poor gene in type ground
In the sense primer group 1 of the multiple SNP sites for calculating fetus dissociative DNA ratio；Above-mentioned downstream specific primer group 1 includes being used for
Amplification α-SEAThe anti-sense primer 1 of the poor gene in type ground and draw for calculating the downstream of multiple SNP sites of fetus dissociative DNA ratio
Thing group 1；
D () uses upstream specificity respectively to above-mentioned upstream specific amplification products 1 and downstream specific amplification products 1
Primer sets 2 and downstream specific primer group 2 carry out specific amplification, respectively obtain upstream specific amplification products 2 and downstream is special
Specific amplification product 2,
Wherein, above-mentioned upstream specific primer group 2 is included for expanding α-SEAThe sense primer 2 and use of the poor gene in type ground
In the sense primer group 2 of the multiple SNP sites for calculating fetus dissociative DNA ratio；Above-mentioned downstream specific primer group 2 includes being used for
Amplification α-SEAThe anti-sense primer 2 of the poor gene in type ground and draw for calculating the downstream of multiple SNP sites of fetus dissociative DNA ratio
Thing group 2；
Also, above-mentioned upstream specific primer group 2 is compared to above-mentioned upstream specific primer group 1 closer to corresponding amplification mesh
Mark point, above-mentioned downstream specific primer group 2 is compared to above-mentioned downstream specific primer group 1 closer to corresponding amplification target position
Point；5 ' ends of above-mentioned upstream specific primer group 2 and above-mentioned downstream specific primer group 2 are containing for high-throughput sequencing library
Joint sequence；
E () mixes above-mentioned upstream specific amplification products 2 and downstream specific amplification products 2 after, the logical of two ends is used
Expanded with primer, the library of the sequencing that obtains being available on the machine.
Further, the 5' ends of above-mentioned upstream specific primer group 1 and downstream specific primer group 1 are with for separating expansion
Increase production the modification of thing, preferably with biotin modification.
Further, 3 ' ends of the primer in specific objective site are directed in above-mentioned upstream specific primer group 1, on above-mentioned
There is the 10-15 coincidence of base at 5 ' ends of the primer in trip specific primer group 2 for the target site；Above-mentioned downstream specificity
In primer sets 1 for specific objective site primer 3 ' end, with above-mentioned downstream specific primer group 2 in be directed to the target site
Primer 5 ' end have the 10-15 coincidence of base.
Further, it is above-mentioned for expanding α-SEAThe sequence of the sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 1；
The above-mentioned sequence of the sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 2-11；
It is above-mentioned for expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；
The above-mentioned sequence of the anti-sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 13-22；
It is above-mentioned for expanding α-SEAThe sequence of the sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 23；
The above-mentioned sequence of the sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 24-33；
It is above-mentioned for expanding α-SEAThe sequence of the anti-sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 34；
The above-mentioned sequence of the anti-sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 35-44.
According to the second aspect of the invention, the present invention provides a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation in type ground
Method, including high-flux sequence is carried out to the library that the method for first aspect builds obtain sequencing reading length (reads)；Then, root
According to the total depth and the depth of mutation allele (allele) of the unique special sequence label in site, calculate tire source DNA and contain
Measure and poor related mutation carries out parting to analyze α over the ground-SEAThe poor gene mutation situation in type ground.
According to the third aspect of the invention we, the present invention provides a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation in type ground
Library construction Kit, above-mentioned library is used to carry out noninvasive prenatal foetal α by high-flux sequence-SEAThe poor gene mutation in type ground
Detection, mentioned reagent box includes：
A () upstream specific primer group 1 and downstream specific primer group 1, are respectively used to pre- to the pre- library in upstream and downstream
Library carries out specific amplification, to respectively obtain upstream specific amplification products 1 and downstream specific amplification products 1,
Wherein, above-mentioned upstream specific primer group 1 is included for expanding α-SEAThe sense primer 1 and use of the poor gene in type ground
In the sense primer group 1 of the multiple SNP sites for calculating fetus dissociative DNA ratio；Above-mentioned downstream specific primer group 1 includes being used for
Amplification α-SEAThe anti-sense primer 1 of the poor gene in type ground and draw for calculating the downstream of multiple SNP sites of fetus dissociative DNA ratio
Thing group 1；
B () upstream specific primer group 2 and downstream specific primer group 2, are respectively used to above-mentioned upstream specific amplification
Product 1 and downstream specific amplification products 1 carry out specific amplification, to respectively obtain upstream specific amplification products 2 and downstream
Specific amplification products 2,
Wherein, above-mentioned upstream specific primer group 2 is included for expanding α-SEAThe sense primer 2 and use of the poor gene in type ground
In the sense primer group 2 of the multiple SNP sites for calculating fetus dissociative DNA ratio；Above-mentioned downstream specific primer group 2 includes being used for
Amplification α-SEAThe anti-sense primer 2 of the poor gene in type ground and draw for calculating the downstream of multiple SNP sites of fetus dissociative DNA ratio
Thing group 2；
Also, above-mentioned upstream specific primer group 2 is compared to above-mentioned upstream specific primer group 1 closer to corresponding amplification mesh
Mark point, above-mentioned downstream specific primer group 2 is compared to above-mentioned downstream specific primer group 1 closer to corresponding amplification target position
Point；5 ' ends of above-mentioned upstream specific primer group 2 and above-mentioned downstream specific primer group 2 are containing for high-throughput sequencing library
Joint sequence.
Further, the 5' ends of above-mentioned upstream specific primer group 1 and downstream specific primer group 1 are with for separating expansion
Increase production the modification of thing, preferably with biotin modification.
Further, 3 ' ends of the primer in specific objective site are directed in above-mentioned upstream specific primer group 1, on above-mentioned
There is the 10-15 coincidence of base at 5 ' ends of the primer in trip specific primer group 2 for the target site；Above-mentioned downstream specificity
In primer sets 1 for specific objective site primer 3 ' end, with above-mentioned downstream specific primer group 2 in be directed to the target site
Primer 5 ' end have the 10-15 coincidence of base.
Further, it is above-mentioned for expanding α-SEAThe sequence of the sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 1；
The above-mentioned sequence of the sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 2-11；
It is above-mentioned for expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；
The above-mentioned sequence of the anti-sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 13-22；
It is above-mentioned for expanding α-SEAThe sequence of the sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 23；
The above-mentioned sequence of the sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 24-33；
It is above-mentioned for expanding α-SEAThe sequence of the anti-sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 34；
The above-mentioned sequence of the anti-sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：
Shown in 35-44.
Further, mentioned reagent box also includes：
C () joint sequence, it carries special sequence label and optional sample label sequence, for connecting maternal peripheral blood
Dissociative DNA, to obtain connection product；
D () pre- amplified library primer sequence, itself and the complementation of above-mentioned joint sequence are combined, for being carried out to above-mentioned connection product
Pre- amplified library；
(e) universal primer, for after above-mentioned upstream specific amplification products 2 and downstream specific amplification products 2 mix,
Mix products are expanded, with the library of the sequencing that obtains being available on the machine；
Preferably,
Above-mentioned joint sequence such as SEQ ID NO：Shown in 45-46；
Above-mentioned pre- amplified library primer sequence such as SEQ ID NO：Shown in 47-48；
Above-mentioned universal primer such as SEQ ID NO：Shown in 49-50.
The method of the present invention and kit, can be by with the free plasma dna of parent as original material, building α-SEAType ground
The library of poor detection in Gene Mutation, and realize α by carrying out high-flux sequence to library-SEAThe poor detection in Gene Mutation in type ground.
It is critical that in library construction, specific joint is connected to maternal peripheral blood dissociative DNA fragment, then creatively will
The pre- amplified production of joint connection product is divided into two parts, separately using for target site (such as α-SEAThe poor gene in type ground)
Upstream and downstream primer carry out two-wheeled specific amplification, can with high specificity be enriched with target site, significantly improve primer amplification special
The opposite sex.And in amplification procedure, the sense primer of the multiple SNP sites for calculating fetus dissociative DNA ratio is used respectively
Group and anti-sense primer group are expanded, and specifically, also two-wheeled specific amplification are carried out using different primers for SNP site,
Can efficiently, accurately calculate foetal DNA ratio.So as to after high-flux sequence, tire source can be calculated according to sequencing reading length
DNA content and over the ground poor related mutation carry out parting, effectively distinguish the mutation of embryonic gene.
Further, inventor devises efficient primer particular for the poor gene in ground, and calculates foetal DNA ratio
The primer of multiple SNP sites.Using library constructing method of the invention, preferably in the primer sequence group provided using the present invention
In the case of, can accurately and efficiently detect α-SEAThe poor gene mutation in type ground, its result is consistent with amniocentesis detection and genotyping,
But security, non-invasive and high efficiency aspect are substantially better than amniocentesis detection.
Brief description of the drawings
Fig. 1 is the noninvasive prenatal foetal α of the embodiment of the present invention-SEAThe type poor detection in Gene Mutation library constructing method in ground and prominent
Become the schematic flow sheet of detection method；
The relative position relation that Fig. 2 is the upstream and downstream specific primer of the embodiment of the present invention, universal primer is combined with template
Schematic diagram；
Fig. 3 is the noninvasive prenatal foetal α of the embodiment of the present invention-SEAThe pre- library (a) of the poor detection in Gene Mutation in type ground and end
The 2% detected through gel electrophoresis collection of illustrative plates in library (b), M represents that Marker, A10-A15 represent 6 exemplary samples.
Specific embodiment
The present invention is described in further detail below by specific embodiment combination accompanying drawing.
As shown in figure 1, the noninvasive prenatal foetal α of the embodiment of the present invention-SEAThe poor detection in Gene Mutation library construction side in type ground
Method includes step：
S1：To joint of the maternal peripheral blood dissociative DNA connection with special sequence label and optional sample label sequence
Sequence.
The peripheral blood dissociative DNA of maternal peripheral blood dissociative DNA, i.e. pregnant woman, swims including source of parents blood dissociative DNA and tire source
From DNA.Joint sequence carries special label sequence, and the special label sequence can be one section of n (such as 8 or 10) bases longs
Random sequence so that each joint sequence is different from other joint sequences, that is to say, that joint sequence is used to distinguish its connection
Maternal peripheral blood dissociative DNA so that each maternal peripheral blood dissociative DNA fragment all carry specific joint sequence, be easy to
Different maternal peripheral blood dissociative DNA fragments can be distinguished in sequence information analysis after follow-up sequencing.Due to being measured in high pass
In sequence, the sequencing data of magnanimity can be produced every time, therefore often by separate sources (such as from the peripheral blood of different parents
Dissociative DNA) sample mixed storehouse (pooling) be sequenced, therefore joint sequence can also carry one section of sample label sequence
(index) sample that, it is used for distinguishing different.
S2：Pre- amplified library is carried out to the connection product of previous step using pre- amplified library primer sequence, wherein pre- library
Amplimer sequence is complementary with joint sequence to be combined.
It is in order to increase the amount of joint connection product, because joint connection is produced to carry out pre- amplified library (or " pre- amplification ")
The copy number of some molecules may be relatively low in thing, it is follow-up be divided into upstream and downstream two parts and carry out specific amplification when, these copies
The relatively low molecule of number may not be expanded effectively, and expand increases the amount of joint connection product in advance so that various copy numbers
Molecule can effectively be expanded.
S3：Pre- library obtained in the previous step is divided into the pre- library in the pre- library in upstream and downstream, upstream specificity is used respectively
Primer sets 1 and downstream specific primer group 1 carry out specific amplification to the pre- library in the pre- library in upstream and downstream, respectively obtain upstream
Specific amplification products 1 and downstream specific amplification products 1.
Pre- library is divided into the pre- library in the pre- library in upstream and downstream by the present invention carries out two-wheeled specific amplification, Neng Gouxian respectively
Write and improve primer specific amplification.The beneficial effect that upstream and downstream separate independent amplification includes：On the one hand, due to two generation high fluxs
The reason for sequencing reading length (reads) is short, upstream specific primer needs to relatively close to amplification target position with downstream specific primer
Point (or target area), it is not separated to be difficult to effectively amplification to target fragment, and upstream and downstream separate independent amplification and can effectively expand
To target fragment；On the other hand, upstream and downstream separate independent amplification can retain joint sequence in one end of sequence, be easy to follow-up
The carrying out of high-flux sequence.
In the embodiment of the present invention, amplification target site (or target area) includes α-SEAThe type poor gene in ground and for calculating tire
Two kinds of multiple SNP sites of youngster's dissociative DNA ratio, accordingly, upstream specific primer group 1 and downstream specific primer group 1
Respectively include including two kinds of primers, i.e. upstream specific primer group 1：For expanding α-SEAThe sense primer 1 of the poor gene in type ground
And for calculating the sense primer group 1 of multiple SNP sites of fetus dissociative DNA ratio；Downstream specific primer group 1 includes：
For expanding α-SEAThe anti-sense primer 1 of the poor gene in type ground and under the multiple SNP sites for calculating fetus dissociative DNA ratio
Trip primer sets 1.
As shown in Figure 2 for expanding α in the embodiment of the present invention-SEAThe sense primer 1 (USP1) and use of the poor gene in type ground
In amplification α-SEAThe relative position relation that the anti-sense primer 1 (DSP1) of the poor gene in type ground is combined with template.As can be seen that USP1 and
DSP1 is located at amplification target site respectively --- or test point is (i.e.-SEAType lack breakaway poing) the left and right sides, it is however generally that
3 ' the ends of USP1 and DSP1 are nearer apart from test point, such as several bases, the distance of more than ten base, one reason for this is that,
Reading sequence long (reads) of two generation high-flux sequences is shorter, such as 100bp or so, if 3 ' the end distance inspections of USP1 and DSP1
Farther out, possible two generation high-flux sequences can not effectively measure test point to measuring point.For calculating fetus dissociative DNA ratio
The upstream and downstream specific primer of multiple SNP sites is identical with the schematic diagram of Fig. 2 with the relative position relation that template is combined.
In order to separate upstream specific amplification products 1 and downstream specific amplification products 1, upstream specific primer group
1 and the 5' ends of downstream specific primer group 1 can carry for separating the modification of amplified production, preferably with biotin modification,
Biotin can be combined with Avidin, therefore upstream specific amplification products 1 and downstream specific amplification products 1 can be by lifes
Thing element-Avidin affine combination is separated from reaction system.
S4：To upstream specific amplification products 1 and downstream specific amplification products 1, upstream specific primer is used respectively
Group 2 and downstream specific primer group 2 carry out specific amplification, respectively obtain upstream specific amplification products 2 and downstream specificity
Amplified production 2.
In the case of only one wheel primer amplified, the presence of non-specific amplification product is might have.Therefore, need
The second wheel primer amplified is carried out, the specific primer that the primer amplified of second wheel is used also includes upstream
Specific primer and downstream specific primer.
In embodiments of the present invention, similar to first round primer amplified, the second wheel primer amplified is used
Upstream specific primer group 2 include：For expanding α-SEAThe sense primer 2 of the poor gene in type ground and for calculating fetus dissociative
The sense primer group 2 of multiple SNP sites of DNA ratios；Downstream specific primer group 2 includes：For expanding α-SEAThe poor base in type ground
The anti-sense primer 2 of cause and the anti-sense primer group 2 for calculating multiple SNP sites of fetus dissociative DNA ratio.
As shown in Figure 2 for expanding α in the embodiment of the present invention-SEAThe sense primer 2 (USP2) and use of the poor gene in type ground
In amplification α-SEAThe relative position relation that the anti-sense primer 2 (DSP2) of the poor gene in type ground is combined with template.As can be seen that USP2 phases
Than USP1 closer to-SEAType lack breakaway poing, DSP2 compared to DSP1 closer to-SEAType lacks breakaway poing.For calculating fetus dissociative
Relative position relation and the schematic diagram phase of Fig. 2 that the upstream and downstream primer sets 2 of multiple SNP sites of DNA ratios are combined with template
Together.In a word, upstream specific primer group 2 is compared to upstream specific primer group 1 closer to corresponding amplification target site, and downstream is special
Specific primer group 2 is compared to downstream specific primer group 1 closer to corresponding amplification target site.
In a particular embodiment, the primer in specific objective site is directed in upstream specific primer group 1 (such as α-SEA
The USP1 of the poor gene in type ground) 3 ' ends, with upstream specific primer group 2 in (be for example directed to for the primer of the target site
α-SEAThe USP2 of the poor gene in type ground) 5 ' ends have the 10-15 coincidence of base；Similarly, it is directed in downstream specific primer group 1
The primer in specific objective site is (such as α-SEAThe DSP1 of the poor gene in type ground) 3 ' ends, in downstream specific primer group 2
For the target site primer (such as α-SEAThe DSP2 of the poor gene in type ground) 5 ' ends have the 10-15 coincidence of base.
" 3 ' end " and " 5 ' end ", refers respectively to be close to one section of sequence of 3 ' ends and 5 ' ends herein.This coincidence, mainly considers
USP1 and DSP1 originally apart from test point (for example-SEAType lacks breakaway poing) it is relatively near, the coincidence of base can improved further
While specific amplification, fully effectively in conjunction with space.
For the ease of the carrying out of high-flux sequence, 5 ' ends of upstream specific primer group 2 and downstream specific primer group 2
The joint sequence for high-throughput sequencing library can be contained.Specifically, using which kind of high-flux sequence platform, then being put down using this
The corresponding joint sequence of platform.
S5：After upstream specific amplification products 2 and downstream specific amplification products 2 are mixed, general using two ends draws
Thing is expanded, the library of the sequencing that obtains being available on the machine.
As shown in Fig. 2 universal primer (UNP) can combine joint sequence, being expanded by universal primer can obtain upper machine
The library of sequencing.Upper machine sequencing is realized by high-flux sequence.High throughput sequencing technologies can be selected from Illumina/Genome
Analyzer/Hiseq/Miseq/NEXTseq CN500, Applied Biosystems SOLID and life
Technologies/Ion Torrent.Specifically, using which kind of high throughput sequencing technologies, then universal primer is also adopted by the high pass
The corresponding primer of amount sequencing technologies.
In one embodiment of the invention, for expanding α-SEAThe sequence of the sense primer 1 such as SEQ ID of the poor gene in type ground
NO：Shown in 1；The sequence of sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：2-
Shown in 11；For expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；For calculating fetus trip
From the sequence of the anti-sense primer group 1 such as SEQ ID NO of multiple SNP sites of DNA ratios：Shown in 13-22；For expanding α-SEAType ground
The sequence of the sense primer 2 such as SEQ ID NO of poor gene：Shown in 23；Multiple SNP sites for calculating fetus dissociative DNA ratio
The sequence of sense primer group 2 such as SEQ ID NO：Shown in 24-33；For expanding α-SEAThe sequence of anti-sense primer 2 of the poor gene in type ground
Such as SEQ ID NO：Shown in 34；The sequence of anti-sense primer group 2 such as SEQ for calculating multiple SNP sites of fetus dissociative DNA ratio
ID NO：Shown in 35-44.
The embodiment of the present invention also provides a kind of noninvasive prenatal foetal α-SEAThe poor detection method of gene mutation in type ground, including to this
The library that inventive embodiments build carries out high-flux sequence and obtains sequencing reading length (reads)；Then, according to unique spy in site
The depth of the total depth and mutation allele (allele) of different sequence label, calculating tire source DNA content and over the ground poor correlation
Mutation carries out parting to analyze α-SEAThe poor gene mutation situation in type ground.
The embodiment of the present invention also provides a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation library construction reagent in type ground
Box, above-mentioned library is used to carry out noninvasive prenatal foetal α by high-flux sequence-SEAThe detection of the poor gene mutation in type ground, above-mentioned examination
Agent box includes：
(R1) upstream specific primer group 1 and downstream specific primer group 1, are respectively used to pre- to the pre- library in upstream and downstream
Library carries out specific amplification, to respectively obtain upstream specific amplification products 1 and downstream specific amplification products 1, wherein, on
Trip specific primer group 1 is included for expanding α-SEAThe sense primer 1 of the poor gene in type ground and for calculating fetus dissociative DNA ratio
The sense primer group 1 of multiple SNP sites of example；Downstream specific primer group 1 is included for expanding α-SEAUnder the poor gene in type ground
Trip primer 1 and the anti-sense primer group 1 for calculating multiple SNP sites of fetus dissociative DNA ratio；
(R2) upstream specific primer group 2 and downstream specific primer group 2, are respectively used to upstream specific amplification products
1 and downstream specific amplification products 1 carry out specific amplification, it is special to respectively obtain upstream specific amplification products 2 and downstream
Property amplified production 2, wherein, upstream specific primer group 2 is included for expanding α-SEAThe sense primer 2 and use of the poor gene in type ground
In the sense primer group 2 of the multiple SNP sites for calculating fetus dissociative DNA ratio；Downstream specific primer group 2 is included for expanding
α-SEAThe anti-sense primer 2 and the anti-sense primer group for calculating multiple SNP sites of fetus dissociative DNA ratio of the poor gene in type ground
2。
Wherein, upstream specific primer group 2 compares upstream specific primer group 1 closer to corresponding amplification target site,
Downstream specific primer group 2 is compared to downstream specific primer group 1 closer to corresponding amplification target site；Upstream specific primer
Contain the joint sequence for high-throughput sequencing library in 5 ' ends of group 2 and downstream specific primer group 2.
In a preferred embodiment, the 5' ends of upstream specific primer group 1 and downstream specific primer group 1 are with for dividing
From the modification of amplified production, preferably with biotin modification, to separate upstream specific amplification products 1 and downstream from system
Specific amplification products 1.
In a preferred embodiment, in upstream specific primer group 1 for specific objective site primer 3 ' ends, it is and upper
There is the 10-15 coincidence of base at 5 ' ends of the primer in trip specific primer group 2 for the target site；Downstream specific primer
In group 1 for specific objective site primer 3 ' ends, with downstream specific primer group 2 in for the target site primer
There is the 10-15 coincidence of base at 5 ' ends.
In one embodiment of the invention, for expanding α-SEAThe sequence of the sense primer 1 such as SEQ ID of the poor gene in type ground
NO：Shown in 1；The sequence of sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：2-
Shown in 11；For expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；For calculating fetus trip
From the sequence of the anti-sense primer group 1 such as SEQ ID NO of multiple SNP sites of DNA ratios：Shown in 13-22；For expanding α-SEAType ground
The sequence of the sense primer 2 such as SEQ ID NO of poor gene：Shown in 23；Multiple SNP sites for calculating fetus dissociative DNA ratio
The sequence of sense primer group 2 such as SEQ ID NO：Shown in 24-33；For expanding α-SEAThe sequence of anti-sense primer 2 of the poor gene in type ground
Such as SEQ ID NO：Shown in 34；The sequence of anti-sense primer group 2 such as SEQ for calculating multiple SNP sites of fetus dissociative DNA ratio
ID NO：Shown in 35-44.
In a preferred embodiment, kit also includes：
(R3) joint sequence, it carries special sequence label and optional sample label sequence, for connecting maternal peripheral
Blood dissociative DNA, to obtain connection product；
(R4) pre- amplified library primer sequence, itself and the complementation of above-mentioned joint sequence are combined, for entering to above-mentioned connection product
The pre- amplified library of row；
(R5) universal primer, for mixing in above-mentioned upstream specific amplification products 2 and downstream specific amplification products 2
Afterwards, mix products are expanded, with the library of the sequencing that obtains being available on the machine.
In one embodiment of the invention, joint sequence such as SEQ ID NO：Shown in 45-46；Pre- amplified library primer sequence
Row such as SEQ ID NO：Shown in 47-48；Universal primer such as SEQ ID NO：Shown in 49-50.
Describe technical scheme and technique effect in detail by the following examples, it will be appreciated that embodiment is only
Exemplary, it is impossible to it is interpreted as limiting the scope of the invention.
Embodiment
1st, for alpha Thalassemia gene-αSEADesign synthetic primer in mutational site：
Sense primer and anti-sense primer are located at test point left side and right side respectively.The specific primer 1 of homonymy 3 ' end and
There is the 10-15 coincidence of base at 5 ' ends of specific primer 2.There is biotin modification at the 5' ends of specific primer 1.Specific primer
Contain the joint sequence for high-throughput sequencing library in 25 ' ends.Specifically, primer sequence is as shown in table 1.
Table 1
2nd, the joint sequence with special sequence label and sample label sequence (index)：
ADT-F：
CAAGCAGAAGACGGCATACGAGATNNNNNNNNATTAAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ
ID NO：45)；
ADT-R：pGATCGGAAGAGC(SEQ ID NO：46).
Wherein, NNNNNNNN is special sequence label, and ATTAAGG is sample label sequence (index), above joint sequence
Need to be annealed into double-strand.
3rd, pre- amplified library primer sequence：
pre-lib-primer-F:CAAGCAGAAGACGGCATACGA(SEQ ID NO：47)；
pre-lib-primer-R:GCTCTTCCGATCT(SEQ ID NO：48).
4th, whole amplified library primer sequence (universal primer)：
Seq-lib-primer-F:CAAGCAGAAGACGGCATACGA(SEQ ID NO：49)；
Seq-lib-primer-R:
ATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC(SEQ ID NO：50).
5th, the detection method and detection kit of the embodiment of the present invention, specifically building storehouse step is：
1) 2ml pregnant woman blood plasma dissociative DNAs are extracted.
2) dissociative DNA end is repaired, and configuration reaction system (reaction one) is as shown in table 2.
Table 2
| Reagent | Volume (μ L) |
| DNA | 40.5 |
| T4DNA ligase buffer solution+10mM ATP | 5 |
| 10mM dNTP mixed liquors | 2 |
| T4DNA polymerases (Enzymatics companies) | 1 |
| T4DNA phosphorylases (Enzymatics companies) | 0.5 |
| RTaq (Takara companies) | 1 |
| Cumulative volume | 50 |
Fully mix, brief centrifugation is reacted as follows on thermal cycler：37 DEG C, 20min；72 DEG C, 20min；4℃
Preserve.
3) joint sequence of the DNA fragmentation connection with special sequence label and sample label sequence, configuration reaction system is (anti-
Answer two) as shown in table 3.
Table 3
| Reagent | Volume (μ L) |
| Reaction one | 50 |
| DNA ligase buffer solution | 27 |
| DNA ligase (Enzymatics companies) | 1 |
| Joint sequence (SEQ ID NO：45-46) | 2 |
| Cumulative volume | 80 |
Fully mix, brief centrifugation is reacted as follows on thermal cycler：20 DEG C, 15min；65 DEG C, 10min；4℃
Preserve.
4) after reaction terminates, purified using 30 μ L XP beads immediately, eluted in 26 μ L ultra-pure waters or eluent.
5) PCR is expanded in advance
Following reaction system is configured on ice, as shown in table 4.
Table 4
Fully mix, brief centrifugation is reacted as follows on thermal cycler：95 DEG C, 3min, 1 circulation；(95 DEG C, 15s,
62 DEG C, 30s, 72 DEG C, 30s) 10 circulations；72 DEG C, 5min, 1 circulation；4 DEG C of preservations.
6) reacting final product uses 50 μ L XP beads recovery purifyings, quantitative using Qubit, and 5 μ L product 2% are coagulated
Gel electrophoresis detection, as a result as shown in Figure 3 a, shows pre- library construction success.The pre- library of two equal portions is taken, upstream is respectively designated as pre-
The pre- library in library and downstream, every part of 100ng carries out next step amplification.
7) specific amplification 1
Every part of pre- library of sample is the pre- library in the pre- library in upstream and downstream, is drawn using corresponding upstream and downstream specificity respectively
Thing 1 and specific primer 2, are merged every part of sample upstream and downstream primer extension product when being expanded using universal primer, then make
Expanded with universal primer.
Following reaction system is configured on ice, as shown in table 5.
Table 5
PCR response procedures are as follows：95 DEG C, 10min, 1 circulation；(95 DEG C, 30s, 62 DEG C, 30s, 72 DEG C, 1min) 20 are circulated；
72 DEG C, 7min, 1 circulation；4 DEG C of preservations.
8) agarose gel electrophoresis of 5 μ L product 2%, resultant product 1.2X XP recovery, 24 μ L ultra-pure waters or wash-out
Liquid is eluted, and eluent carries out next step amplification.
9) specific amplification 2
Following reaction system is configured on ice, as shown in table 6.
Table 6
PCR response procedures are as follows：95 DEG C, 10min, 1 circulation；(95 DEG C, 30s, 62 DEG C, 30s, 72 DEG C, 1min) 15 are circulated；
72 DEG C, 7min, 1 circulation；4 DEG C of preservations.
10) agarose gel electrophoresis of 5 μ L product 2%, resultant product 1.2X XP reclaim, each sample it is upper and lower
Trip amplified production can merge recovery, final 26 μ L ultra-pure waters or elution, and eluent carries out universal primer amplification.
11) universal primer amplification
Following reaction system is configured on ice, as shown in table 7.
Table 7
PCR response procedures are as follows：98 DEG C, 45s, 1 circulation；(98 DEG C, 15s, 60 DEG C, 30s, 72 DEG C, 30s) 10 are circulated；72
DEG C, 1min, 1 circulation；4 DEG C of preservations.
12) detected through gel electrophoresis of 5 μ L product 2%, as a result as shown in Figure 3 b, show whole library construction success.It is remaining
Product 1.0X XP are reclaimed, finally using 30ul elutions, as final upper machine library.
13) after the Quality Control of library, Illumina NEXTseq CN500 carry out 75PE sequencings.
14) sequencing data information analysis
After filtering out low quality sequencing reading length (reads), for every a pair of pair-end reads according to dividing for being connected
Subtab sequence and amplimer sequence are sorted out, when primer sequence and molecule mark that reads start-up portions sequence is added with experiment
When label sequence is inconsistent, reads will be filtered.The pair-end reads for remaining BWA MEM mankind's reference genes
Group (hg19) is compared, by with starting, with final position and the consistent Sequence clustering of molecular label to same group, uniquely divided
Subtab group sequence, compares reference gene group (BWA MEM), with GATK softwares pair again by unique molecular label group sequence
Sequence around Indel is compared again, and SNP and small insertion and deletion detection are carried out with samtools softwares, uses FACTERA softwares
Carry out-SEA missing detections.The total depth and associated SNP positions allele of the unique molecular label group sequence according to site
(allele) depth, calculates embryo's DNA content, and related SNP, INDEL poor to fetus ground, -- SEA types missing is divided
Type.
According to above-described embodiment, 14 pregnant woman of thalassemia carrier are carried out with noninvasive antenatal thalassemia gene
Detection, it is as a result as shown in table 8 below.
Table 8
Result shows, the p- α of the embodiment of the present inventionSEAThe noninvasive antenatal detection of thalassemia gene mutation and amniocentesis inspection
Survey parting consistent, show that the method for the present invention can accurately and efficiently detect α-SEAThe poor gene mutation in type ground, its result and amniotic fluid
Puncture detection and genotyping consistent, but security, non-invasive and high efficiency aspect are substantially better than amniocentesis detection.
Above content is to combine specific embodiment further description made for the present invention, it is impossible to assert this hair
Bright specific implementation is confined to these explanations.For general technical staff of the technical field of the invention, do not taking off
On the premise of present inventive concept, some simple deduction or replace can also be made, should all be considered as belonging to protection of the invention
Scope.
SEQUENCE LISTING
<110>People and future biological science and technology（Changsha）Co., Ltd
<120>The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit
<130> 17I23913
<160> 50
<170> PatentIn version 3.3
<210> 1
<211> 30
<212> DNA
<213>Primer sequence
<400> 1
tcgtcgcggc ctggggttca cttggggggc 30
<210> 2
<211> 30
<212> DNA
<213>Primer sequence
<400> 2
tgtagagcag aaaggtatgg gctcaactag 30
<210> 3
<211> 33
<212> DNA
<213>Primer sequence
<400> 3
ctcttttatt ctatacttct ctaatactca cct 33
<210> 4
<211> 30
<212> DNA
<213>Primer sequence
<400> 4
gttctccctg ttccggggac atcaccttcc 30
<210> 5
<211> 30
<212> DNA
<213>Primer sequence
<400> 5
gatttttagg gcagtgaaac tcctctacag 30
<210> 6
<211> 30
<212> DNA
<213>Primer sequence
<400> 6
ttagtcttac tttgcttttt taaattagct 30
<210> 7
<211> 25
<212> DNA
<213>Primer sequence
<400> 7
tgttaggatg tacacacatt ttaat 25
<210> 8
<211> 30
<212> DNA
<213>Primer sequence
<400> 8
agacattact gctttgaaga ctttgtgtat 30
<210> 9
<211> 30
<212> DNA
<213>Primer sequence
<400> 9
cctatcgcca agtggtgaga caatcgccga 30
<210> 10
<211> 30
<212> DNA
<213>Primer sequence
<400> 10
tttagtcatg aagttttctg agtgccagtg 30
<210> 11
<211> 30
<212> DNA
<213>Primer sequence
<400> 11
gtaataataa caacactaat ggcggtaaac 30
<210> 12
<211> 29
<212> DNA
<213>Primer sequence
<400> 12
tgaactcctg gacttaagtg atcctcctg 29
<210> 13
<211> 30
<212> DNA
<213>Primer sequence
<400> 13
tataatccca caccactctt tgtttgctct 30
<210> 14
<211> 33
<212> DNA
<213>Primer sequence
<400> 14
accctataat gctctgtgaa acacctattt gtt 33
<210> 15
<211> 30
<212> DNA
<213>Primer sequence
<400> 15
aagatggcca gggaagtgtg agtgacccta 30
<210> 16
<211> 30
<212> DNA
<213>Primer sequence
<400> 16
cagcgttata tgttctacag gtttagacaa 30
<210> 17
<211> 25
<212> DNA
<213>Primer sequence
<400> 17
tgggaaggct gcatggtgaa tataa 25
<210> 18
<211> 30
<212> DNA
<213>Primer sequence
<400> 18
ttcaagcatt cactgaaggt cttggaacgt 30
<210> 19
<211> 25
<212> DNA
<213>Primer sequence
<400> 19
tagaaccttt tggactagtt atgcc 25
<210> 20
<211> 30
<212> DNA
<213>Primer sequence
<400> 20
caagtgaaag gggtccgatg gtactcactg 30
<210> 21
<211> 30
<212> DNA
<213>Primer sequence
<400> 21
aatcttcagt ggggatgtag cacattttgc 30
<210> 22
<211> 30
<212> DNA
<213>Primer sequence
<400> 22
atcatgttgg caacatgctt ggagatcccc 30
<210> 23
<211> 49
<212> DNA
<213>Primer sequence
<400> 23
agatgtgtat aagagacagg ttcacttggg gggcgccttg gggaggttc 49
<210> 24
<211> 49
<212> DNA
<213>Primer sequence
<400> 24
agatgtgtat aagagacagt atgggctcaa ctagctatgt tacaacttc 49
<210> 25
<211> 52
<212> DNA
<213>Primer sequence
<400> 25
agatgtgtat aagagacagc ttctctaata ctcacctgtt ctaatgagat tt 52
<210> 26
<211> 44
<212> DNA
<213>Primer sequence
<400> 26
agatgtgtat aagagacagg ggacatcacc ttccagtctc caag 44
<210> 27
<211> 49
<212> DNA
<213>Primer sequence
<400> 27
agatgtgtat aagagacagg aaactcctct acagcatact gtaatgatg 49
<210> 28
<211> 49
<212> DNA
<213>Primer sequence
<400> 28
agatgtgtat aagagacagg cttttttaaa ttagctcttc atgcagcac 49
<210> 29
<211> 44
<212> DNA
<213>Primer sequence
<400> 29
agatgtgtat aagagacagc acacatttta atattttggt acca 44
<210> 30
<211> 49
<212> DNA
<213>Primer sequence
<400> 30
agatgtgtat aagagacagg aagactttgt gtatactaaa tgtgggtaa 49
<210> 31
<211> 49
<212> DNA
<213>Primer sequence
<400> 31
agatgtgtat aagagacagg tgagacaatc gccgagcagt gagaccatc 49
<210> 32
<211> 49
<212> DNA
<213>Primer sequence
<400> 32
agatgtgtat aagagacagt tctgagtgcc agtggaactg tcctggttc 49
<210> 33
<211> 49
<212> DNA
<213>Primer sequence
<400> 33
agatgtgtat aagagacagc taatggcggt aaacaccatc atcatcttg 49
<210> 34
<211> 49
<212> DNA
<213>Primer sequence
<400> 34
agatgtgtat aagagacagt cctggactta agtgatcctc ctgccccag 49
<210> 35
<211> 49
<212> DNA
<213>Primer sequence
<400> 35
agatgtgtat aagagacagc cactctttgt ttgctctatt ttggttctc 49
<210> 36
<211> 52
<212> DNA
<213>Primer sequence
<400> 36
agatgtgtat aagagacagt ctgtgaaaca cctatttgtt agataaattg at 52
<210> 37
<211> 49
<212> DNA
<213>Primer sequence
<400> 37
agatgtgtat aagagacagg aagtgtgagt gaccctaggg gttgtgccc 49
<210> 38
<211> 49
<212> DNA
<213>Primer sequence
<400> 38
agatgtgtat aagagacagt tctacaggtt tagacaagtg tatcctaac 49
<210> 39
<211> 49
<212> DNA
<213>Primer sequence
<400> 39
agatgtgtat aagagacagg ctgcatggtg aatataagaa ctgaattct 49
<210> 40
<211> 49
<212> DNA
<213>Primer sequence
<400> 40
agatgtgtat aagagacagc tgaaggtctt ggaacgtatc ccctgtgga 49
<210> 41
<211> 49
<212> DNA
<213>Primer sequence
<400> 41
agatgtgtat aagagacagt tttggactag ttatgccact cctgaggag 49
<210> 42
<211> 49
<212> DNA
<213>Primer sequence
<400> 42
agatgtgtat aagagacagg tccgatggta ctcactgctc agcaatagg 49
<210> 43
<211> 49
<212> DNA
<213>Primer sequence
<400> 43
agatgtgtat aagagacagg gatgtagcac attttgctat ttgagatgg 49
<210> 44
<211> 49
<212> DNA
<213>Primer sequence
<400> 44
agatgtgtat aagagacaga catgcttgga gatccccaga tcaaaggtg 49
<210> 45
<211> 73
<212> DNA
<213>Primer sequence
<220>
<221> misc_feature
<222> (25)..(32)
<223> n is a, c, g, or t
<400> 45
caagcagaag acggcatacg agatnnnnnn nnattaaggg tgactggagt tcagacgtgt 60
gctcttccga tct 73
<210> 46
<211> 12
<212> DNA
<213>Primer sequence
<400> 46
gatcggaaga gc 12
<210> 47
<211> 21
<212> DNA
<213>Primer sequence
<400> 47
caagcagaag acggcatacg a 21
<210> 48
<211> 13
<212> DNA
<213>Primer sequence
<400> 48
gctcttccga tct 13
<210> 49
<211> 21
<212> DNA
<213>Primer sequence
<400> 49
caagcagaag acggcatacg a 21
<210> 50
<211> 43
<212> DNA
<213>Primer sequence
<400> 50
aatgatacgg cgaccaccga gatctacact cgtcggcagc gtc 43
Claims (10)
1. a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation library constructing method in type ground, the library is used to pass through high pass
Measuring sequence carries out noninvasive prenatal foetal α-SEAThe detection of the poor gene mutation in type ground, it is characterised in that methods described includes：
A () is to joint sequence of the maternal peripheral blood dissociative DNA connection with special sequence label and optional sample label sequence；
B () carries out pre- amplified library using pre- amplified library primer sequence to the connection product of previous step, wherein the pre- library
Amplimer sequence is complementary with the joint sequence to be combined；
C pre- library obtained in the previous step is divided into the pre- library in the pre- library in upstream and downstream by (), upstream specific primer is used respectively
Group 1 and the pre- library in upstream of downstream specific primer group 1 pair and the pre- library in downstream carry out specific amplification, respectively obtain upstream
Specific amplification products 1 and downstream specific amplification products 1,
Wherein, the upstream specific primer group 1 is included for expanding α-SEAThe sense primer 1 of the poor gene in type ground and based on
Calculate the sense primer group 1 of multiple SNP sites of fetus dissociative DNA ratio；The downstream specific primer group 1 is included for expanding
α-SEAThe anti-sense primer 1 and the anti-sense primer group for calculating multiple SNP sites of fetus dissociative DNA ratio of the poor gene in type ground
1；
D () uses upstream specific primer respectively to the upstream specific amplification products 1 and downstream specific amplification products 1
Group 2 and downstream specific primer group 2 carry out specific amplification, respectively obtain upstream specific amplification products 2 and downstream specificity
Amplified production 2,
Wherein, the upstream specific primer group 2 is included for expanding α-SEAThe sense primer 2 of the poor gene in type ground and based on
Calculate the sense primer group 2 of multiple SNP sites of fetus dissociative DNA ratio；The downstream specific primer group 2 is included for expanding
α-SEAThe anti-sense primer 2 and the anti-sense primer group for calculating multiple SNP sites of fetus dissociative DNA ratio of the poor gene in type ground
2；
Also, the upstream specific primer group 2 is compared to the upstream specific primer group 1 closer to corresponding amplification target position
Point, the downstream specific primer group 2 is compared to the downstream specific primer group 1 closer to corresponding amplification target site；Institute
Contain the joint for high-throughput sequencing library in the 5 ' ends for stating upstream specific primer group 2 and the downstream specific primer group 2
Sequence；
E () mixes the upstream specific amplification products 2 and downstream specific amplification products 2 after, general using two ends draws
Thing is expanded, the library of the sequencing that obtains being available on the machine.
2. library constructing method according to claim 1, it is characterised in that the upstream specific primer group 1 and downstream
The 5' ends of specific primer group 1 carry the modification for separating amplified production, preferably with biotin modification.
3. library constructing method according to claim 1, it is characterised in that be directed in the upstream specific primer group 1
5 ' ends of the primer of the target site are directed in 3 ' ends of the primer in specific objective site, with the upstream specific primer group 2
There is the 10-15 coincidence of base；3 ' ends of the primer in specific objective site are directed in the downstream specific primer group 1, with institute
There is the 10-15 coincidence of base at the 5 ' ends for stating the primer for being directed to the target site in downstream specific primer group 2.
4. the library constructing method according to claim any one of 1-3, it is characterised in that described for expanding α-SEAType ground
The sequence of the sense primer 1 such as SEQ ID NO of poor gene：Shown in 1；
The sequence of the sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：2-11
It is shown；
It is described for expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；
The sequence of the anti-sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：13-
Shown in 22；
It is described for expanding α-SEAThe sequence of the sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 23；
The sequence of the sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：24-
Shown in 33；
It is described for expanding α-SEAThe sequence of the anti-sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 34；
The sequence of the anti-sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：35-
Shown in 44.
5. a kind of noninvasive prenatal foetal α-SEAThe poor detection method of gene mutation in type ground, it is characterised in that methods described is included to right
It is required that the library that any one of 1-4 builds carries out high-flux sequence and obtains sequencing reading length；Then, according to the unique special mark in site
The total depth of sequence and the depth of mutation allele are signed, calculating tire source DNA content and over the ground poor related mutation carry out parting
To analyze α-SEAThe poor gene mutation situation in type ground.
6. a kind of noninvasive prenatal foetal α-SEAThe poor detection in Gene Mutation library construction Kit in type ground, the library is used for by height
Flux sequencing carries out noninvasive prenatal foetal α-SEAThe detection of the poor gene mutation in type ground, it is characterised in that the kit includes：
A () upstream specific primer group 1 and downstream specific primer group 1, are respectively used to the pre- library in the pre- library in upstream and downstream
Specific amplification is carried out, to respectively obtain upstream specific amplification products 1 and downstream specific amplification products 1,
Wherein, the upstream specific primer group 1 is included for expanding α-SEAThe sense primer 1 of the poor gene in type ground and based on
Calculate the sense primer group 1 of multiple SNP sites of fetus dissociative DNA ratio；The downstream specific primer group 1 is included for expanding
α-SEAThe anti-sense primer 1 and the anti-sense primer group for calculating multiple SNP sites of fetus dissociative DNA ratio of the poor gene in type ground
1；
B () upstream specific primer group 2 and downstream specific primer group 2, are respectively used to the upstream specific amplification products 1
Specific amplification is carried out with downstream specific amplification products 1, to respectively obtain upstream specific amplification products 2 and downstream specificity
Amplified production 2,
Wherein, the upstream specific primer group 2 is included for expanding α-SEAThe sense primer 2 of the poor gene in type ground and based on
Calculate the sense primer group 2 of multiple SNP sites of fetus dissociative DNA ratio；The downstream specific primer group 2 is included for expanding
α-SEAThe anti-sense primer 2 and the anti-sense primer group for calculating multiple SNP sites of fetus dissociative DNA ratio of the poor gene in type ground
2；
Also, the upstream specific primer group 2 is compared to the upstream specific primer group 1 closer to corresponding amplification target position
Point, the downstream specific primer group 2 is compared to the downstream specific primer group 1 closer to corresponding amplification target site；Institute
Contain the joint for high-throughput sequencing library in the 5 ' ends for stating upstream specific primer group 2 and the downstream specific primer group 2
Sequence.
7. library construction Kit according to claim 6, it is characterised in that the upstream specific primer group 1 and under
The 5' ends of trip specific primer group 1 carry the modification for separating amplified production, preferably with biotin modification.
8. library construction Kit according to claim 6, it is characterised in that pin in the upstream specific primer group 1
To being directed to the primer of the target site in 3 ' ends of the primer in specific objective site, with the upstream specific primer group 25 '
There is the 10-15 coincidence of base at end；3 ' ends of the primer in specific objective site are directed in the downstream specific primer group 1, with
There is the 10-15 coincidence of base at 5 ' ends of the primer in the downstream specific primer group 2 for the target site.
9. the library construction Kit according to claim any one of 6-8, it is characterised in that described for expanding α-SEAType
The sequence of the sense primer 1 such as SEQ ID NO of the poor gene in ground：Shown in 1；
The sequence of the sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：2-11
It is shown；
It is described for expanding α-SEAThe sequence of the anti-sense primer 1 such as SEQ ID NO of the poor gene in type ground：Shown in 12；
The sequence of the anti-sense primer group 1 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：13-
Shown in 22；
It is described for expanding α-SEAThe sequence of the sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 23；
The sequence of the sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：24-
Shown in 33；
It is described for expanding α-SEAThe sequence of the anti-sense primer 2 such as SEQ ID NO of the poor gene in type ground：Shown in 34；
The sequence of the anti-sense primer group 2 such as SEQ ID NO for calculating multiple SNP sites of fetus dissociative DNA ratio：35-
Shown in 44.
10. the library construction Kit according to claim any one of 6-8, it is characterised in that the kit also includes：
C () joint sequence, it carries special sequence label and optional sample label sequence, dissociates for connecting maternal peripheral blood
DNA, to obtain connection product；
D () pre- amplified library primer sequence, itself and joint sequence complementation are combined, for carrying out pre- text to the connection product
Storehouse expands；
(e) universal primer, for after the upstream specific amplification products 2 and downstream specific amplification products 2 mix, to mixed
Close product to be expanded, with the library of the sequencing that obtains being available on the machine；
Preferably,
The joint sequence such as SEQ ID NO：Shown in 45-46；
The pre- amplified library primer sequence such as SEQ ID NO：Shown in 47-48；
The universal primer such as SEQ ID NO：Shown in 49-50.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710044342.7A CN106755484A (en) | 2017-01-19 | 2017-01-19 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710044342.7A CN106755484A (en) | 2017-01-19 | 2017-01-19 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755484A true CN106755484A (en) | 2017-05-31 |
Family
ID=58945086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710044342.7A Pending CN106755484A (en) | 2017-01-19 | 2017-01-19 | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755484A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108148900A (en) * | 2018-01-24 | 2018-06-12 | 深圳因合生物科技有限公司 | Sequencing approach, kit and its application of sequencing mistake are reduced based on molecular label and the sequencing of two generations |
| CN112831555A (en) * | 2021-02-01 | 2021-05-25 | 人和未来生物科技（长沙）有限公司 | Reference substance for detecting thalassemia gene and preparation method and application thereof |
| CN112996926A (en) * | 2018-12-07 | 2021-06-18 | 深圳华大生命科学研究院 | Construction method, detection device and application of target gene library |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421903A (en) * | 2013-08-14 | 2013-12-04 | 邯郸市康业生物科技有限公司 | Alpha-thalassemia screening kit and application thereof in prenatal screening |
| CN104894279A (en) * | 2015-06-25 | 2015-09-09 | 北京嘉宝仁和医疗科技有限公司 | Test kit for alpha-thalassemia gene mutations |
| CN105861742A (en) * | 2016-02-02 | 2016-08-17 | 南方医科大学 | Specific detection target sequence for DENV type I-III, standard plasmid molecule, and detection kit for DENV type I-III |
-
2017
- 2017-01-19 CN CN201710044342.7A patent/CN106755484A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421903A (en) * | 2013-08-14 | 2013-12-04 | 邯郸市康业生物科技有限公司 | Alpha-thalassemia screening kit and application thereof in prenatal screening |
| CN104894279A (en) * | 2015-06-25 | 2015-09-09 | 北京嘉宝仁和医疗科技有限公司 | Test kit for alpha-thalassemia gene mutations |
| CN105861742A (en) * | 2016-02-02 | 2016-08-17 | 南方医科大学 | Specific detection target sequence for DENV type I-III, standard plasmid molecule, and detection kit for DENV type I-III |
Non-Patent Citations (5)
| Title |
|---|
| 宋春林 等: "二代高通量测序仪在大规模地中海贫血基因检测的应用价值", 《中国医疗设备》 * |
| 林晓容 等: "孕妇血浆游离胎儿DNA 中地中海贫血突变的基因诊断", 《中国实验血液学杂志》 * |
| 王逾男 等: "基于孕妇外周血浆游离胎儿ＤＮＡ的地中海贫血无创产前基因诊断研究进展", 《中国产前诊断杂志（电子版）》 * |
| 陆国辉 等: "《临床遗传咨询》", 31 March 2007, 北京大学医学出版社 * |
| 陈芳 等: "母血中胎儿游离DNA 进行地中海贫血的无创产前诊断研究", 《中国当代医药》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108148900A (en) * | 2018-01-24 | 2018-06-12 | 深圳因合生物科技有限公司 | Sequencing approach, kit and its application of sequencing mistake are reduced based on molecular label and the sequencing of two generations |
| CN112996926A (en) * | 2018-12-07 | 2021-06-18 | 深圳华大生命科学研究院 | Construction method, detection device and application of target gene library |
| CN112831555A (en) * | 2021-02-01 | 2021-05-25 | 人和未来生物科技（长沙）有限公司 | Reference substance for detecting thalassemia gene and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2945311T3 (en) | Rapid detection of aneuploidy | |
| ES2745556T3 (en) | Nucleic acids and methods to detect chromosomal abnormalities | |
| CN106755485A (en) | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α types ground, detection method and kit | |
| CN107077537B (en) | Detection of repeat amplification with short read sequencing data | |
| JP6161607B2 (en) | How to determine the presence or absence of different aneuploidies in a sample | |
| CN109797197A (en) | It a kind of single chain molecule label connector and single stranded DNA banking process and its is applied in detection Circulating tumor DNA | |
| CN107177670A (en) | A kind of method of high flux detection Parkinson's Disease-causing gene mutation | |
| WO2013053183A1 (en) | Method and system for genotyping predetermined region in nucleic acid sample | |
| CN105603100B (en) | Detect amplimer, kit and the method for F8 gene mutation | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN108085395A (en) | Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence | |
| CN106755486A (en) | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal β types ground, detection method and kit | |
| CN112639983B (en) | Microsatellite instability detection | |
| CN108796061A (en) | For the primer sets of thalassaemia mutations type genetic test, kit, its application and library constructing method | |
| CN105734679B (en) | Nucleic acid target sequence captures the preparation method of sequencing library | |
| JP2023123658A (en) | Circulating rna signatures specific to preeclampsia | |
| WO2023098137A1 (en) | Method and kit for detecting methylation mutation of free dna | |
| WO2015042980A1 (en) | Method, system, and computer-readable medium for determining snp information in a predetermined chromosomal region | |
| CN107312770A (en) | A kind of construction method in tumour BRCA1/2 genetic mutations library detected for high-flux sequence and its application | |
| CN106755484A (en) | The poor detection in Gene Mutation library constructing method in noninvasive prenatal foetal α SEA types ground, detection method and kit | |
| CN103966228B (en) | A kind of Rh blood group DEL type RHD93T > A allelotrope and detection method thereof | |
| CN105886605A (en) | Amplification primer for detecting PKD2 gene mutation and detection method | |
| CN106086193B (en) | A method of mixing sample DNA is analyzed based on INDEL-SNP linkage relationship | |
| CN105624308B (en) | A kind of product that detection chromosome 16p11.2 is micro-deleted | |
| CN107604067A (en) | A kind of primer and kit for the mutation of testing goal gene low frequency |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Xiaofeng Inventor after: Xu Xiangmin Inventor after: Zeng Huaping Inventor after: Song Zhuo Inventor before: Wang Xiaofeng Inventor before: Zeng Huaping Inventor before: Song Zhuo |
|
| CB03 | Change of inventor or designer information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |