WO2017028752A1 - Multiplex pcr primer and application thereof - Google Patents

Abstract

Provided are multiplex PCR primers, comprising a forward primer and a reverse primer. The forward primer consists of a sequence in one-to-one correspondence with a nucleotide sequence represented by SEQ ID NO:1-SEQ ID NO:13. The sequence in the forward primer has 0-3 nucleotides greater or fewer than the corresponding sequence in SEQ ID NO:1-SEQ ID NO:13. The reverse primer consists of a sequence in one-to-one correspondence with a nucleotide sequence represented by SEQ ID NO:14-SEQ ID NO:17. The sequence in the reverse primer has 0-3 nucleotides greater or fewer than the corresponding sequence in SEQ ID NO:14-SEQ ID NO:17.

Description

Multiplex PCR primers and their applications

This application claims the priority of a Chinese patent application filed on August 14, 2015, filed on the Chinese Patent Office, Application No. 201510500391.8, entitled "Multiple PCR Primers and Methods for Constructing BCR Libraries Based on High-throughput Sequencing to Establish Leukemia Residual Bacterial BCR Libraries" The content of the above-mentioned prior application is incorporated herein by reference.

Technical field

The invention belongs to the field of molecular biology, relates to multiplex PCR primers and applications thereof, and in particular to a multiplex PCR primer and application for amplifying human BCR.

Background technique

Leukemia is a malignant clonal disease of the blood system characterized by an increase in immature cells in bone marrow and/or peripheral blood. At the time of initial diagnosis, the total number of leukemia cells in the patient is about 10 ¹² . After complete morphological complete remission (CR), the total number of residual leukemia cells is less than 10 ⁹ . This morphological method is difficult to detect and in vivo. The state in which a small amount of leukemia cells remain remains called minimal residual disease (MRD). Residual MRD in the body has a >50% recurrence rate in patients with acute T lymphocytic leukemia. Therefore, it is more important to design an individualized treatment plan to regularly detect MRD.

A large number of V and J gene segments at the B cell locus will produce various rearrangements in the synthesis of receptors. Nucleotides between VJ, VD and DJ junctions are independent of template insertion or deletion, and high frequency variation. Similarly, this further increases the potential diversity of the receptor. This potential diversity of receptors is difficult to randomly generate the same CDR3 sequence, making each CDR3 sequence effectively a unique tag for a B cell clone. Therefore, sequencing the sequence composition of the CDR3 region of the B lymphocyte IGH gene can well reflect the composition and response status of the BCR immune library.

At present, the main detection methods of clinical MRD are: multiparametric flow cytometry (mpFC) and real-time quantitative PCR. Although mpFC has a sensitivity of 10 ^-4 for recurrent disease, complex multidimensional data relies on the analysis of experimental personnel, and human factors have a large impact, which is not conducive to clinical standardized testing. In addition, the expression level of leukemia antigen after chemotherapy has an interference effect on mpFC detection of MRD. Dependence on molecular means can improve the sensitivity of detecting MRD, which can reach 10 ^-5 ; however, real-time quantitative PCR needs to expand the diversity of rearranged sequences according to the special primers designed by patients, which is expensive to detect, labor intensive, and very It is difficult to form a standardized experimental process.

At present, human BCR or acquisition or analysis methods still need to be improved.

Summary of the invention

In view of this, the present invention provides a multiplex PCR primer and application for amplifying human BCR.

In a first aspect, the present invention provides a multiplex PCR primer comprising an upstream primer and a downstream primer, the upstream primer being one-to-one corresponding to the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: a sequence consisting of the sequence in the upstream primer being more or less 0 to 3 nucleotides than the corresponding sequence in SEQ ID NO: 1 to SEQ ID NO: 13; the downstream primer consisting of SEQ ID NO: 14 The nucleotide sequence shown in SEQ ID NO: 17 is composed of a set of sequences corresponding one-to-one, and the sequence in the downstream primer is more or less 0 to 3 than the corresponding sequence in SEQ ID NO: 14 to SEQ ID NO: 17. Nucleotides.

As described herein, a "base" can represent a nucleotide, for example, when counting, 1 bp is used to represent 1 nucleotide.

As described herein, "more or less 0 to 3 nucleotides" is preferably 0 to 3 nucleotides more or less at the 3' end of the corresponding primer.

The present invention sets at least 13 upstream primer sequences for the variable region V region of human BCR, and at least 4 downstream primer sequences for the joining region J region of BCR, and obtains the target fragment by multiplex PCR. Multiplex PCR products construct a BCR high throughput sequencing library.

According to an embodiment of the present invention, the upstream primer is an upstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 13, and the downstream primer is SEQ ID NO: 14 to SEQ ID NO A downstream primer set consisting of the nucleotide sequence shown in 17:

As described in the present invention, the 1-3 bases excluding the nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 17 are bases complementary to the BCR of interest.

In the present invention, "a set of sequences one-to-one corresponding to the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 13" means that the set of sequences also contains 13 sequences, and the 13 sequences Each of the sequences is more or less 0 to 3 nucleotides than the corresponding sequence in SEQ ID NO: 1 to SEQ ID NO: 13. For example, the sequence of the set has a sequence of 0 to 3 nucleotides more or less than the sequence shown in SEQ ID NO: 1, and the other sequence of the set has a sequence other than the sequence shown in SEQ ID NO: 2. More or less sequences of 0 to 3 nucleotides... The sequence of the group also has a sequence of 0 to 3 nucleotides more or less than the sequence shown in SEQ ID NO: 13, and the sequence consisting of 13 sequences The group formed the upstream primer in the present invention. Similarly, the meaning of "a set of sequences one-to-one corresponding to the nucleotide sequences shown in SEQ ID NO: 14 to SEQ ID NO: 17" is similar to the above.

As described in the present invention, the nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 13 or SEQ ID NO: 14 to SEQ ID NO: 17 can be understood by those skilled in the art. More or less 0 to 3 nucleotides" is suitable for those skilled in the art when designing PCR primers, based on the corresponding nucleotide sequences shown in "SEQ ID NO: 1 to SEQ ID NO: 17" The extension or truncation of the length of the PCR primer can be obtained (the extension is still complementary to the corresponding fragment of interest). The extension or truncation may be contiguous nucleotides or non-contiguous nucleotides, either extended or truncated at the ends or extended or truncated in the middle. According to one embodiment of the invention, the ends are elongated or truncated. According to another embodiment of the present invention, the extension or truncation of the nucleotide in the middle of the corresponding sequence may be continuously 0-3 nucleotides less, or may be continuously 0-3 nucleotides.

Those skilled in the art will appreciate that if the multiplexed primer set is explored ("Nuclear as shown in SEQ ID NO: 1 to SEQ ID NO: 17" The nucleotide sequence ") obtains a better amplification effect, and within the predictable range, the multiplex PCR primer set obtained by prolonging or truncating each primer by 0 to 3 bases can also obtain a better multiple. PCR amplification effect.

In an embodiment of the present invention, the 5' end of the downstream primer and/or the 5' end of the upstream primer respectively comprise a tag sequence, and the tag sequence is a sequence bar code composed of 6-8 nucleotide sequences, wherein At least one nucleotide difference between the sequence barcodes is described.

The primer sequence-providing primer provided by the invention can add a tag sequence to each RNA molecule or DNA molecule in the sample to be tested, the tag sequence is randomly combined by four basic bases of ATCG, and the tag sequence is different from each other, e.g., the number of the nucleotide sequence of the tag is eight (example 8N tag sequence as represented embodiment of the present invention), may be obtained ¹⁰⁹ different combinations of tag sequence; number seven nucleotide sequence tag At this time, 10 ⁸ different combinations of tag sequences can be obtained; when the number of bases of the tag sequence is six, 10 ⁷ different combinations of tag sequences can be obtained, and the number of bases of the tag sequence is eight. Or seven, or six.

According to an embodiment of the present invention, the upstream primer further comprises an upstream primer set consisting of the nucleotide sequence shown in SEQ ID NO: 20 to SEQ ID NO: 32, and/or the downstream primer further comprises SEQ ID NO A downstream primer set consisting of a nucleotide sequence represented by 33 to SEQ ID NO: 36.

In a second aspect, the present invention provides a method of obtaining a BCR, comprising the steps of:

Taking the sample nucleic acid to be tested;

The nucleic acid is amplified using a multiplex PCR reaction to obtain a multiplex PCR amplification product using the multiplex PCR primer of the first aspect of the invention.

In an embodiment of the invention, the sample nucleic acid to be tested is DNA and/or RNA.

In an embodiment of the invention, the amount of the nucleic acid is not less than DNA and/or RNA contained in 0.5 cells.

When the nucleic acid of the sample to be tested is DNA, the system for performing multiplex PCR is configured with reference to a common PCR system; when the nucleic acid of the sample to be tested is RNA, the cDNA is first synthesized by reverse transcription, and then synthesized into a second. Chain DNA, in this case, the step of reverse transcription synthesis of cDNA is equivalent to one cycle of multiplex PCR (using only the upstream primer set or the downstream primer set), and the step of synthesizing the second strand DNA is equivalent to one cycle of multiplex PCR (only downstream) Primer set or upstream primer set).

According to an embodiment of the invention, the sample to be tested is human peripheral blood mononuclear cells.

In an embodiment of the invention, the RNA sample to be tested is a total RNA obtained by extracting human peripheral blood mononuclear cells (preferably using an RNA kit).

According to an embodiment of the invention, the sample to be tested is derived from a small residual lesion of human leukemia.

In an embodiment of the present invention, when the sample to be tested is an RNA sample, the step of amplifying the sample to be tested by using a multiplex PCR reaction to obtain a multiplex PCR product is: first using a downstream primer as a reverse transcription primer to synthesize cDNA; then, using the synthesized cDNA as a template, adding an upstream primer, performing multiplex PCR, and amplifying the cDNA to obtain a multiplex PCR product.

In another embodiment of the present invention, when the sample to be tested is an RNA sample, the multiplex PCR reaction is used to amplify the sample to be tested, The multiplex PCR amplification product is obtained by first synthesizing cDNA by using the upstream primer as a reverse transcription primer; then, using the synthesized cDNA as a template, adding a downstream primer, performing multiplex PCR, and amplifying the cDNA to obtain a multiplex PCR product.

Preferably, in the system of the multiplex PCR reaction, in the upstream primer set composed of 13 upstream primers, each upstream primer is equimolar mixed; in the downstream primer set composed of 4 downstream primers, each downstream primer is equimolar mixed.

According to an embodiment of the invention, in the system of the multiplex PCR reaction, the amount of the template is 1-3 ug/50 ul system.

According to an embodiment of the invention, the procedure of the multiplex PCR reaction is:

The above procedure is specifically: pre-denaturation at 95 ° C for 15 min, denaturation at 94 ° C for 15 s, annealing at 65 ° C for 90 s, extension at 72 ° C for 30 s, cycle 25 to 30 times, and finally extension at 72 ° C for 10 min.

Preferably, after the multiplex PCR reaction is completed, electrophoresis, gel extraction recovers a DNA fragment having a fragment length of 100-150 bp.

Preferably, the resulting multiplex PCR product is engineered for high throughput sequencing and high throughput sequencing results are analyzed by bioinformatics.

In a third aspect, the invention provides a method of obtaining a BCR sequencing library, comprising the steps of:

A multiplex PCR amplification product is obtained using the method for obtaining BCR as described in the second aspect of the invention;

The multiplex PCR amplification product was subjected to sequencing library construction to obtain a BCR sequencing library.

The BCR high-throughput sequencing library provided by the present invention can obtain a length and a sufficient number of BCR sequences, which is beneficial to the analysis of the polymorphism degree of the BCR sequence and the distribution of the BCR high clone CDR3 region length polymorphism.

In a fourth aspect, the invention provides a method of sequencing a BCR, comprising the steps of:

Obtaining a BCR sequencing library using the method for obtaining a BCR sequencing library according to the third aspect of the present invention;

The BCR sequencing library was sequenced.

In a fifth aspect, the present invention provides an analysis method for BCR diversity, including:

Sequencing results obtained by the sequencing method of the fourth aspect of the invention;

The sequencing results were analyzed to obtain analysis results of BCR diversity.

Preferably, the sequencing is high throughput sequencing.

Based on the high-throughput sequencing platform, through comprehensive bioinformatics analysis of the CDR3 region of human BCR gene, the gene expression patterns, gene combinations and connection diversity information of BCR in VDJ recombination were obtained. Ammonia in CDR3 sequence The basic patterns of the acid, the length diversity of the CDR3 amino acid sequence, and the nature of the N-terminal base at the junction. It is these factors that form a large and diverse range of BCR receptor libraries.

In a sixth aspect, the invention provides a kit comprising a multiplex PCR primer according to the first aspect of the invention.

The kit can be used to detect BCR diversity, for example, to detect BCR diversity in minimal residual disease of leukemia.

In a seventh aspect, the present invention provides the use of the multiplex PCR primer according to the first aspect of the present invention or the method for obtaining BCR according to the second aspect, for detecting BCR diversity, for example, detecting a small residual BCR of leukemia The application of diversity.

The multiplex PCR primers and applications provided by the present invention have the following beneficial effects:

1) A human BCR sequence was obtained; 2) A human-specific BCR CDR3 sequence was obtained, in particular, the detection rate of low copy number B cell clones was increased.

DRAWINGS

1 is an agarose gel electrophoresis pattern of a genome and a PCR product according to an embodiment of the present invention;

2 is a result of VDJ recombination analysis of the sequence obtained in the embodiment of the present invention.

detailed description

Material and reagent description:

B lymphocyte-associated leukemia patients: from Shenzhen People's Hospital, patient informed consent. Unless otherwise stated, the reagents used in the embodiments of the present invention are all commercially available products, and the databases used in the embodiments of the present invention are all public online databases.

The nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 17 in the present invention are designed primer sequences. The nucleotide sequences shown in SEQ ID NO: 18 to SEQ ID NO: 19 are the linker sequences used in the construction of the Chinese library of the examples; the nucleotide sequences shown in SEQ ID NO: 20 to SEQ ID NO: 36 are Primer sequences used in the inventive examples.

Wherein SEQ ID NO: 1 is AGAGTCACCATGACCACAG.

SEQ ID NO: 2 is AGAGTCACCAKKACCAGGGA. SEQ ID NO: 3 is AGAGTCACCATGACCGAGG.

SEQ ID NO: 4 is AGAGTCACCATTACYAGGG. SEQ ID NO: 5 is AGAGTCACGATWACCRCGG.

SEQ ID NO: 6 is AGAGTCACCATGACCAGGA.

SEQ ID NO: 7 is ACCAGGCTCACCATYWCCAAG.

SEQ ID NO: 8 is GGCCGATTCACCATCTCMA.

SEQ ID NO: 9 is CGAGTCACCATTCGCTAG.

SEQ ID NO: 10 is CAGCCGACAAGTCCATCA.

SEQ ID NO: 11 is AGTCGAATAACCATCAACCC.

SEQ ID NO: 12 is GACGGTTTGTCTTCTCCTTG.

SEQ ID NO: 13 is AGAGTCACCATGACCACAG.

SEQ ID NO: 14 is CTGAGGAGACRGTGACCAGGGTG.

SEQ ID NO: 15 is CTGAAGAGACGGTGACCATTGTC.

SEQ ID NO: 16 is CTGAGGAGACGGTGACCAGGGT.

SEQ ID NO: 17 is TGAGGAGACGGTGACCGTGGTC.

SEQ ID NO: 18 is CAGACGTGTGCTCTTCCGATCTAG.

SEQ ID NO: 19 is CTACACGACGCTCTTCCGATCT.

Specifically, the primers of the present invention are as follows (the underlined portion is the sequencing company linker sequence):

Table 1. Multiplex PCR primer sequences

Note that those skilled in the art will understand that the nucleotide abbreviations are as follows: R = A / G, Y = C / T, M = A / C, K = G / T, S = C / G, W = A /T, H=A/C/T, B=C/G/T, V=A/C/G, D=A/G/T, N=A/C/G/T.

Design primers: aligned analysis of all V and J genes of BCR, analysis of primer dimer and stem-loop mismatch using Oligo 7.0 and MFEprimer-2.0, set upstream of the CDR3 region of BCR (ie FR3 region) The upstream primer, designed a reverse primer for the downstream of the J gene, amplifies the CDR3 region sequence.

The primer set provided in this example covers most of the VDJ recombination fragments. Since the small sequence changes will lead to a significant decrease in the amplification effect of the primers, the inventors designed three sets of multiplex PCR primer sets for different segments of the BCR region for different purposes. After three sets of pre-experimental screening, the present invention selects the expansion. The primer set with the best effect is shown in the above table.

Example 1

Embodiment 1 of the present invention provides a method for preparing a B lymphocyte receptor (BCR) DNA sample, comprising the following steps:

(1) 10 ml (ml) of each collected fresh peripheral blood sample, according to the instructions of LymphoPrep kit (Axis-shield, Cat. No. AS1114544UK), to obtain relatively pure PBMC;

(2) The genomic DNA of the cells obtained in the step (1) was extracted using a PureLink Genomic DNA Mini Kit (Life Technology, Cat. No: K1820-00) kit, and the concentration and purity of the DNA were measured using Nanodrop 2000 (Thermo), and then the genomic DNA was preserved. .

The results of DNA extraction electrophoresis are shown in Figure 1-a (for genomic DNA fragments, see lanes 1-2; M is DNA Marker).

Example 2

Embodiment 2 of the present invention provides a method for constructing a BCR high-throughput sequencing library of a minimal residual disease of leukemia using a multiplex PCR primer of a BCR library of a minimal residual disease of leukemia, comprising the following steps:

Using the genomic DNA obtained in Example 1 as an amplification template, the BCR primer was taken, and the multiplex PCR system was configured according to the kit instructions using QIAGEN Multiplex PCR Kit (Cat. No. 206143), wherein the BCR primer included an upstream primer and a downstream primer. The upstream primer is an upstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 13, and the downstream primer is A downstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 14 to SEQ ID NO: 17.

Each of the upstream primers was equimolarly mixed, the total concentration of the primers was 10 micromoles, and the respective downstream primers were mixed in an equimolar amount, and the total concentration of the primers was 10 micromoles, and the amount of the template was adjusted, and 3 ug was used in this example.

In order to facilitate the delivery of the test, unless otherwise specified, in the multiplex PCR of the embodiment of the present invention, the sequencing primer is added to the upstream primer and the downstream primer respectively, specifically: the upstream primer of the illumina sequencing company is respectively connected to the 5' end of the upstream primer. The linker sequence (such as the nucleotide sequence shown in SEQ ID NO: 18) is ligated to the downstream primer linker sequence of Illumina Sequencing Co., Ltd. at the 5' end of the downstream primer (such as the nucleotide sequence shown in SEQ ID NO: 19) ), the specific steps refer to the illumina high-throughput sequencing library construction specification;

The PCR instrument program is set up according to the following multiplex PCR conditions to perform multiplex PCR:

After the end of PCR, the PCR product was stored at 4 ° C and detected by electrophoresis. The result is shown in Figure 1-b. The target fragment of about 250 bp was cut under ultraviolet light (see the lanes 1-3 for the target fragment; M is DNAMarker, and the horizontal line is the present invention). In order to make the target fragment more prominently added).

The CDR3 fragment with a fragment length of about 250 bp was selected, and the purified CDR3 fragment was obtained by tapping. The gel recovery step was carried out by QIAGEN QIAquick gel purification kit according to routine laboratory procedures; Nanodrop 2000 was tested for DNA concentration and sent to the company for high concentration. Flux sequencing (sequencing with Illumina hiseq 2000, 2*100 pair-end).

After using the primer set of the present invention and the multiplex PCR library, high throughput sequencing yielded approximately one million sequences. The sequencing results were statistically analyzed by bioinformatics (bioinformatics analysis was performed using Immune Repertoire Analysis Pipeline (iRAP, http://www.sustc-genome.org.cn/irap/), the online software of Southern University of Science and Technology. Table 2 shows that Table 2 shows the number and distribution of CDR3unique clones, including Table 2-1 and Table 2-2.

Table 2-1. Number and distribution of CDR3unique clones

Total reads number	2031308	1987751	1438302	783456	960837	1073258
Immune sequences number	1997429	1895548	1373941	757634	921853	1027270
Unknown sequences numebr	33879	92203	64361	25822	38984	45988
Productive sequences number	1665974	1485444	1069650	617752	683431	630666
Non_productive sequences number	331455	410104	304291	139882	238422	396604
In-frame sequences number	1742745	1554969	1130464	648423	751370	823125
Out-of_frame sequences number	249753	336743	240804	107677	168555	201943
Total CDR3 sequences number	1247543	1458146	1048736	607143	668171	615392
Unique cdr3 nt sequences number	97346	68127	103347	56940	76489	60181
Unique cdr3 aa sequences number	85832	56874	90119	50791	67745	52124

Table 2-2. Number and distribution of CDR3unique clones

CDR3ID	CDR3Sequence(nt)	CDR3Sequence(aa)	Reads unique	Ratio
>CG2_uniquecdr3nt_1	AGCGTGAGAGCGGTACAAGAGACCCAGTAC	SVRAVQETQY	11553	6.54%
>CG2_uniquecdr3nt_2	GCCACCAGTGATTTGCAGGGGGATGCCGGGGAGCTGTTT	ATSDLQGDAGELF	6669	3.78%
>CG2_uniquecdr3nt_3	GCCAGCACTGGTCACCTAAATGAAAAACTGTTT	ASTGHLNEKLF	6439	3.64%
>CG2_uniquecdr3nt_4	GCCAGCAGCTTAGAGGCGCATGCGAACACCGGGGAGCTGTTT	ASSLEAHANTGELF	5730	3.24%
>CG2_uniquecdr3nt_5	GCTAGTGGTGCAGGGTTACTCTGGACTGAAGCTTTC	ASGAGLLWTEAF	5673	3.21%
>CG2_uniquecdr3nt_6	GCCACCAGCAGAGATACGTTGGCGGGGGGCCGGGGGGATACGCAGTAT	ATSRDTLAGGRGDTQY	1907	1.08%
>CG2_uniquecdr3nt_7	GCCAGCAGCTACACCTCGAACACCGGGGAGCTGTTT	ASSYTSNTGELF	1743	0.99%
>CG2_mniquecdr3nt_8	GCCAGCAGCTTATCCCAGGGCCAGGACACTGAAGCTTTC	ASSLSQGQDTEAF	1154	0.65%
>CG2_uniquecdr3nt_9	GCCACCAGTTGGGGCACCACCACCTACAATGAGCAGTTC	ATSWGTTTYNEQF	1035	0.59%
>CG2_uniquecdr3nt_10	GCCAGCAGCGAGCTGACAGGGGGGGGGCTCGAGCAGTAC	ASSELTGGGLEQY	934	0.53%

In Table 2-1, Total reads number: total sample comparison reads; Immune sequences numebr: compares the number of reads to the target area; Unknown sequences numebr: failed to compare the number of reads in the database; productive sequences number: Number of reads identified as TCR β chain and capable of efficient translation; Non_productive sequences number: number of reads identified as TCR β chain but not efficiently translated; In-frame sequences number: number of reads identified as TCR β chain and still in the normal reading frame; Out-of_frame sequences number: the number of reads identified as TCRβ chains but with frameshift mutations; Total CDR3sequences number: total number of all sequences capable of detecting CDR3; Unique CDR3nt sequences number: all CDR3 sequences de-duplicated bases Sequence number number; Unique CDR3aa sequences number: The number of amino acid sequence species after all the CDR3 sequences have been de-redundant.

Through alignment and bioinformatics analysis, the sequence information, amino acid information, number of fragments and proportion of each CDR3 sequence can be accurately known. After BCR alignment analysis, the present invention obtained statistical analysis results of representative clones of CDR3 of high-throughput sequencing sequence, and the results are shown in FIG. 2, and FIG. 2 shows the combined use of VJ in BCR CD3 region. As can be seen from Fig. 2, in the BCR sequence of the near-white stalk obtained by the primer of the present invention, the unique CDR3 sequence is more than 10 ⁴ .

The above results indicate that the BCR library of minimal residual disease of leukemia can be constructed by the method of the present invention to cover the diversity information of the IGH gene.

The above is only the preferred embodiment of the present invention, and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection of the present invention. Within the scope.

Claims (16)

1. A multiplex PCR primer comprising an upstream primer and a downstream primer, the upstream primer consisting of a set of sequences one-to-one corresponding to the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: The sequence in the upstream primer is more or less 0 to 3 nucleotides than the corresponding sequence in SEQ ID NO: 1 to SEQ ID NO: 13,

   The downstream primer consists of a set of sequences corresponding one-to-one with the nucleotide sequences set forth in SEQ ID NO: 14 to SEQ ID NO: 17, and the sequence in the downstream primer is SEQ ID NO: 14 to SEQ ID NO The corresponding sequence in 17 is more or less 0 to 3 nucleotides.
2. The multiplex PCR primer according to claim 1, wherein the 5' end of the downstream primer and/or the 5' end of the upstream primer comprises a tag sequence, wherein the tag sequence is from 6 to 8 nucleotide sequences A sequence of barcodes consisting of wherein at least one nucleotide differs between the sequence of barcodes.
3. The multiplex PCR primer according to claim 1, wherein the upstream primer is an upstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 13, and the downstream primer is SEQ. ID NO: A downstream primer set consisting of the nucleotide sequence shown in 14 to SEQ ID NO: 17.
4. The multiplex PCR primer according to any one of claims 1 to 3, wherein the upstream primer further comprises an upstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 20 to SEQ ID NO: 32, and /or,

   The downstream primer further includes a downstream primer set consisting of the nucleotide sequences shown in SEQ ID NO: 33 to SEQ ID NO: 36.
5. A method for obtaining a BCR, comprising the steps of:

   Obtaining a sample nucleic acid to be tested;

   The nucleic acid is amplified using a multiplex PCR reaction to obtain a multiplex PCR amplification product using the multiplex PCR primer of any one of claims 1-4.
6. The method of obtaining a BCR according to claim 5, wherein the sample nucleic acid to be tested is DNA and/or RNA.
7. The method of obtaining BCR according to claim 5, wherein the amount of the nucleic acid is not less than DNA and/or RNA contained in 0.5 cells.
8. The method of obtaining BCR according to claim 5, wherein the sample to be tested is human peripheral blood mononuclear cells.
9. The method of obtaining a BCR according to claim 5, wherein the sample to be tested is derived from a minimal residual disease of human leukemia.
10. The method for obtaining a BCR according to claim 5, wherein when the sample nucleic acid to be tested is RNA, the step of amplifying the nucleic acid by a multiplex PCR reaction to obtain a multiplex PCR product is:

    Reverse transcription is performed by using the upstream primer or the downstream primer as a reverse transcription primer to obtain a cDNA product;

    The multiplex PCR reaction product is obtained by using the cDNA product as a template and adding a corresponding downstream primer or an upstream primer to obtain the multiplex PCR amplification product.
11. A method for obtaining a BCR sequencing library, comprising the steps of:

    Obtaining a multiplex PCR amplification product using the method of any one of claims 5-10;

    The multiplex PCR amplification product was subjected to sequencing library construction to obtain a BCR sequencing library.
12. A method for sequencing a BCR, comprising:

    Obtaining a BCR sequencing library using the method of claim 11;

    The BCR sequencing library was sequenced.
13. An analysis method for BCR diversity, characterized in that it comprises:

    Using the method of claim 12, obtaining sequencing results;

    The sequencing results were analyzed to obtain analysis results of BCR diversity.
14. Use of a multiplex PCR primer according to any one of claims 1 to 4 for detecting BCR diversity.
15. A kit, comprising the multiplex PCR primer of any one of claims 1-4.
16. Use of the kit of claim 15 for detecting BCR diversity.

Images