CN111154783B

CN111154783B - Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize

Info

Publication number: CN111154783B
Application number: CN202010046197.8A
Authority: CN
Inventors: 沈亚欧; 张严玲; 陈珉; 侯凤霞; 李昭玲
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2020-01-16
Filing date: 2020-01-16
Publication date: 2021-06-04
Anticipated expiration: 2040-01-16
Also published as: CN111154783A

Abstract

The invention discloses application of a corn ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant corn, determines the relation between the corn ZmAKIN beta gamma 1 gene and the lead stress resistance of the corn, and can up-regulate the expression of the corn ZmAKIN beta gamma 1 gene by constructing an overexpression vector of the corn ZmAKIN beta gamma 1 gene and transfecting corn embryos by using agrobacterium, thereby effectively improving the lead resistance of the corn, having wide application prospect in the field of heavy metal pollution resistance of plants, particularly in the field of lead toxicity resistance of the corn, and having huge economic benefit potential.

Description

Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize

Technical Field

The invention relates to application of a corn ZmAKIN beta gamma 1 gene in cultivating lead stress resistant corn, belonging to the field of molecular biology.

Background

Corn is one of the important food crops worldwide. However, with the continuous deterioration of the ecological environment, the content of heavy metals in the soil is increased, the growth and development and the yield quality of the soil are seriously influenced by abiotic stress including the heavy metals, and the crop yield is severely limited. The method is the most effective way for coping with the adversity stress and improving the corn yield by excavating the adversity resistance related genes and researching the adversity response mechanism of the genes. At present, the stress-resistant germplasm resources of corn in China are very deficient, and the stress-resistant germplasm resources obtained by conventional breeding not only have a very difficult process, but also have a long breeding period, so that an ideal resistant variety is difficult to breed. With the rapid development of modern molecular biology, a good opportunity is provided for solving the problem. Researches in recent years show that protein kinase plays an important role in regulation and control of plant stress gene expression, family members of the protein kinase widely participate in a series of physiological and biochemical activities such as response of plants to environmental stress, growth and development of plants, metabolic regulation and the like, and particularly ZmAKIN beta gamma 1 is strongly concerned in disease resistance of corn. Therefore, the ZmAKIN beta gamma 1 gene and the gene interacting with the same are potential important stress resistance genes.

Plants are subjected to abiotic stress, and reversible phosphorylation of proteins is one of the major mechanisms of intracellular signal transduction, thereby maintaining normal metabolism, signal transduction, and growth and development of plants. Protein Kinases (PKs) are primarily involved in protein phosphorylation by transferring phosphate groups on Adenosine Triphosphate (ATP) to amino acid residues (typically serine, threonine, and tyrosine residues) of inactive protein molecules to provide biological functions. Reversible phosphorylation is an essential process in biological metabolism, including calcium-dependent protein kinase (CDPK), Receptor Protein Kinase (RPK), and transcriptional regulation protein kinase, which all play a role in signal transmission after plants are stressed by stress. Among them, CDPK-type protein kinases are most intensively studied, which mainly sense external stimuli on cell membranes and convert environmental signals into intracellular signals through membrane recognition, reception and transformation. Generally, in plants, protein kinases are induced to be expressed by abiotic stress. For example, the two calcium-dependent protein kinases, cATCDPK1 and cATCDPK2, in arabidopsis thaliana induce expression when subjected to salt stress. In maize, the calcium-dependent protein kinase CDPK1 gene is induced to express when maize plants are subjected to salt stress. SnRK shows a regulatory role in plant stress resistance and growth and development, and in rye, a homologue of SNF1 restores the phenotype of a mutant of yeast SNF1RKIN1, whereas AKIN protein kinase is a member of the SnRK subfamily. At present, the maize ZmAKIN beta gamma 1 gene is found to be related to maize diseases, but no report related to lead resistance exists.

Disclosure of Invention

The invention overcomes the defects of the prior art, provides the application of the corn ZmAKIN beta gamma 1 gene in the cultivation of the lead stress-resistant corn, determines the relation between the corn ZmAKIN beta gamma 1 gene and the lead stress resistance of the corn, and verifies the importance of the gene in the cultivation of the lead stress-resistant plant.

Application of a maize ZmAKIN beta gamma 1 gene in cultivating lead stress resistant maize.

Furthermore, the sequence of the corn ZmAKIN beta gamma 1 gene in the application is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2.

A method of breeding lead stress tolerant maize, the method comprising: up-regulating the expression of the maize ZmAKIN beta gamma 1 gene.

Further, the method for up-regulating the expression of the maize ZmAKIN beta gamma 1 gene comprises the following steps: constructing an overexpression vector of ZmAKIN beta gamma 1 in corn, infecting corn immature embryos by an agrobacterium-mediated genetic transformation method, transforming corn ZmAKIN beta gamma 1 genes into the corn immature embryos, selfing for three generations to obtain homozygous positive transformed plants, namely lead-resistant corn plants.

Furthermore, the over-expression vector of ZmAKIN beta gamma 1 in corn in the method is constructed by utilizing CUB vector framework, Ubi as a promoter, NOS as a terminator and bar as a selection marker gene, selecting a BamH I site and adopting a homologous recombination method

Has the advantages that:

the relation between the maize ZmAKIN beta gamma 1 gene and the maize lead stress resistance is determined for the first time, the importance of the gene in the maize lead resistance application is verified, and a theoretical basis and a utilization value are provided for improving the stress resistance by utilizing the application of the gene in maize and other plants. The maize ZmAKIN beta gamma 1 gene has wide application prospect in the field of heavy metal pollution resistance of plants, particularly in the field of soil lead toxicity resistance of maize, and has huge economic benefit potential.

Drawings

FIG. 1 shows the expression trend of ZmAKIN beta gamma 1 gene after the corn is stressed by lead.

Figure 2 genome-wide association analysis significant sites.

FIG. 3 growth of Arabidopsis mutants versus Columbia wild-type under lead stress.

FIG. 4 Columbia wild type and mutant under normal conditions (control) and 0.15g/L Pb (NO) respectively₃)₂Root length comparison under stress.

FIG. 5 interference vector map of ZmAKIN β γ 1.

FIG. 6 is a graph showing the detection of ZmAKIN. beta. -gamma.1 gene expression.

FIG. 7 shows the expression levels of ZmAKIN β γ 1 gene in ZmAKIN β γ 1 transgenic overexpressing plants and ZmAKIN β γ 1 gene RNA interfering plants.

FIG. 8 phenotype of transgenic maize after lead stress.

Detailed Description

In order to make the technical solutions in the present application better understood, the present invention is further described below with reference to examples, which are only a part of examples of the present application, but not all examples, and the present invention is not limited by the following examples.

Example 1 analysis of expression Pattern of maize ZmAKIN beta gamma 1 Gene under lead stress

1-1, lead stress treatment of maize inbred line material

The seeds of the full corn backbone inbred line 178 were selected and sterilized with 75% ethanol for 1min with 10% H₂O₂Soaking the solution for 15min and continuously shaking the solution during disinfection, and then rinsing the solution for 3-5 times by using deionized water until residual H is removed₂O₂Rinsing, soaking in deionized water for 4 hr, and soaking at 28 deg.CGerminating with filter paper at dark condition. After about 2-3 days, the germinated corns are transferred to a floating plate, cultured by Hoagland nutrient solution under the conditions of light (16 h)/dark (8h) at the temperature of 28 ℃ for water culture, the culture solution is changed twice a week, and the stress treatment is carried out when the seedlings grow to the three-leaf stage.

1-2, lead stress treatment:

selecting 30 seedlings with consistent growth vigor, removing endosperm, and transferring into a plastic container filled with nutrient solution. The experiment set up 2 treatments: normal water supply group (i.e. complete nutrient solution, CK) and lead stress treatment group (i.e. complete nutrient solution +3mmol/L Pb (NO)₃)₂T), 12 seedlings per group. The nutrient solution is prepared just before use, and the pH of the nutrient solution is adjusted to about 6.0 before use. The two groups take corn root tissues and extract RNA after 0h, 12h, 24h and 48h respectively, take 3 strains each time, and detect the concentration and quality of the RNA. Used for gene digital expression profiling. As shown in FIG. 1, 0h represents maize seedlings without lead stress and with two leaves and one heart, and 12h, 24h and 48h represent treatment times, respectively. The expression of ZmAKIN beta gamma 1 gene of the maize seedlings in the graph is basically 0 at 0h, the expression is induced after the maize seedlings are stressed by lead, and the expression reaches the highest level at 48 h. The ZmAKIN beta gamma 1 gene is induced and expressed by heavy metal lead, and the expression level is the highest at 48 h.

1-3 extraction of corn total RNA

The samples taken in 2-3 were subjected to extraction of total RNA with reference to the Trizol kit (Invitrogen Co.) operating manual. The method comprises the following specific steps: (1) cooling the grinder with liquid nitrogen: quickly putting the weighed materials into a mortar and quickly grinding until the materials are ground into superfine powder; (2) adding Trizol into a mortar according to the dosage of 1ml per 0.1 g of material; (3) after 20 minutes, the mortar is disassembled and continuously ground until Trizol in the mortar is transparent, and the Trizol is subpackaged into 2ml centrifuge tubes; (4) adding 300 μ l of chloroform into the centrifuge tube, reversing for 1 minute, mixing thoroughly, standing for 5 minutes, centrifuging for 15min (4 ℃, 12000rpm), and carefully sucking the supernatant into another 2ml centrifuge tube; (5) repeating the step 4, adding chloroform and the subsequent steps, sucking the supernatant again and transferring the supernatant into another 1.5ml centrifuge tube; (6) after the supernatant was aspirated again, total RNA was extracted using Trizol partner of beijing tianenz gene technology ltd. (7) After the RNA precipitate is dried, adding a proper amount of DEPC treatment water to dissolve.

Example 2 Whole genome Association analysis identified candidate genes.

The results of genome-wide association analysis using 312 maize inbred lines, the processing method and the phenotypic identification are as 1-2, and 56110 SNP genotype data are combined are shown in FIG. 2, wherein the location marked by the figure is the location of ZmAKIN β γ 1 gene.

4 SNP sites (PUT-163a-60399874-3004, SYN7988, SYN7984, PZE-101256211, respectively located at chromosome 1 298967209bp, 298967713bp, 298969383bp, 299548320bp, Maize B73 RefGen _ v3) were detected on chromosome 1, and were significantly correlated with root surface area, root dry weight, secondary root length, above-ground dry weight, biomass, total root length, and the like. The results of the correlation analysis are shown in table 1. The ZmAKIN. beta. gamma.1 (299461477-299469668bp) gene falls within the LD (500kb) segment of these four SNPs. The importance of the gene in the lead stress process of corn is further verified.

Table 1 genome-wide association analysis of SNP sites and associated traits associated with ZmAKIN β γ 1

Example 3. analysis of lead resistance of Arabidopsis thaliana homologous Gene mutant plants

The arabidopsis homologous gene, SALK _074210, was ordered in the pool of TAIR arabidopsis mutants, denoted Mutant in fig. 3 and 4. This mutant is a T-DNA insertion mutant in which the homologous gene of ZmAKIN. beta. gamma.1 in Arabidopsis is lost. Firstly, sterilizing the mutant and Columbia wild seeds for 1min by using 75% absolute ethyl alcohol, then sterilizing for 15min by using 1% NaClO, finally cleaning for 3-5 times by using sterile water, sowing the cleaned seeds on 1/2MS culture medium, culturing for 7 days, and then transplanting the wild plants and the mutant plants to 0g/L and 0.15g/L Pb (NO) respectively₃)₂Culturing on 1/2MS culture medium, and observing plant growth after 10 daysAs shown in FIGS. 3 and 4, the right panels in FIG. 3 show the growth vigor of Columbia wild type and Arabidopsis thaliana mutant under normal conditions, respectively (Arabidopsis thaliana on the left of the right panel shows the mutant, and Arabidopsis thaliana on the right of the right panel shows the wild type), and the left panels in FIG. 3 show the growth vigor of Columbia wild type and Arabidopsis thaliana mutant at 0.15g/L Pb (NO: 0.15g/L, respectively)₃)₂Growth under stress (left arabidopsis on the left of the left panel is mutant and right arabidopsis is wild type). Under normal conditions, the growth of mutant plants is not much different from that of wild plants, and under the lead stress condition, the lead stress obviously inhibits the growth of plant roots, but the growth of mutants is more obviously inhibited. The average root length of wild plants after being stressed by lead is reduced by 32.5%, while the average root length of mutant plants is reduced by 60%.

Experiments show that the root length of the Columbia wild type under lead stress is obviously higher than that of the mutant plant, and the growth vigor of the overground part is also obviously better than that of the mutant plant. The ZmAKIN beta gamma 1 gene is proved to be closely related to the lead stress resistance of plants.

Example 4. overexpression and RNAi lead tolerance analysis of maize plants.

4-1, Gene amplification

The ZmAKIN beta gamma 1 gene is amplified by PCR, the nucleotide sequence of the ZmAKIN beta gamma 1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.

Wherein the reaction system is shown in Table 2:

TABLE 2 PCR amplification System

The reaction procedure is as follows: 30s at 95 ℃; 10s at 98 ℃, 30s at Tm (optimal annealing temperature of primer), 1min at 68 ℃ for 10s, 40 cycles; storing at 68 deg.C for 10min and 4 deg.C. The sequences of the gene PCR primers used are shown in the following table:

TABLE 3 PCR primers

4-2, transforming corn RNAi vector, over-expression vector construction and agrobacterium-mediated genetic transformation

A CUB vector framework is utilized, Ubi is used as a promoter, NOS is used as a terminator, bar is used as a selective marker gene, a BamH I site is selected, and a homologous recombination method is adopted to construct an overexpression vector of ZmAKIN beta gamma 1 in corn. Meanwhile, a CUB vector framework is utilized, a BamH I enzyme and a Smal I enzyme are utilized to construct an interference vector of ZmAKIN beta gamma 1, and a vector map is shown in figure 5. Wherein, the Target gene in FIG. 5 is the location of the Target gene and the RNAi fragment. The RNAi sequence fragment is: GGATCCGCGACCTAATGCATCACTTAGTTCAAGAGACTAAGTGATGCATTAGGTCGCTTTTTCCCGGG (SEQ ID NO. 5). The constructed overexpression and interference vectors are respectively transformed into EHA105 agrobacterium-infected competent cells. And infecting the young embryo of the corn C01 by utilizing an agrobacterium-mediated genetic transformation method, and culturing to obtain T0 generation ZmAKIN beta gamma 1 corn. Selfing for three generations to obtain homozygous positive transformed plants. The positive detection picture is shown in FIG. 6. Wherein M in FIG. 6 represents a Marker of 2000bp, "+" and "-" represent a positive control and a negative control, respectively, and FIG. 6 represents an overexpression detection band on the left and an RNAi detection band on the right.

The positive detection reaction system comprises the following components:

TABLE 4 PCR amplification System

The reaction procedure is as follows: 30s at 95 ℃; 95 ℃ for 15s, Tm (optimal annealing temperature for primers) for 30s, 60 ℃ for 40s, 38 cycles; preserving at 72 deg.C for 10min and 4 deg.C. The sequences of the gene PCR primers used are shown in the following table:

TABLE 5 PCR primers

4-3 analysis of lead resistance

The obtained overexpression vector and RNAi corn plant (the treatment method and the phenotypic identification are the same as 4-2) are used for quantitative sampling of the corn seedlings without lead treatment on the third day of stress, and the phenotypic identification time is the seventh day of lead treatment. The results of the expression level of the ZmAKIN β γ 1 gene are shown in fig. 7, and under normal conditions, the expression level of the ZmAKIN β γ 1 gene is significantly lower than that of the wild type regardless of the leaf or root of the RNAi maize plant, while the expression level of the ZmAKIN β γ 1 gene is significantly higher than that of the wild type regardless of the leaf or root of the over-expressed plant. The phenotype identification results are shown in fig. 8, and the left one to the left three in fig. 8 are respectively the growth conditions of the untransformed maize seedlings, the maize seedlings overexpressing the ZmAKIN β γ 1 gene and the ZmAKIN β γ 1 gene RNA-interfered maize seedlings under the control conditions; the three right to one right are respectively untransformed corn seedlings under the lead stress condition, corn seedlings over expressing ZmAKIN beta gamma 1 genes and the growth condition of the ZmAKIN beta gamma 1 gene RNA interference corn seedlings. After the over-expression plants are stressed by lead, the leaf development is not stopped, the growth of wild leaves is obviously inhibited after the development of the wild leaves is stressed by lead, and the leaves are more wilted and yellow. After the ZmAKIN beta gamma 1 gene is interfered, the growth of root system and the development of leaves are inhibited more obviously than the wild type after being stressed by lead. The ZmAKIN beta gamma 1 gene is proved to be closely related to the lead stress resistance of the corn.

While the invention has been described in detail in the foregoing by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that certain modifications and improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

SEQUENCE LISTING

<110> Sichuan university of agriculture

Application of <120> corn ZmAKIN beta gamma 1 gene in cultivation of lead stress resistant corn

<130> 2020

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 1494

<212> DNA

<213> sequence

<400> 1

atgttctcgc acggcgctga ttccgcccac gacgccggga ccgttggcgt cagcagcggc 60

gtcggggcca ccgtccccgc ccgcttcgtc tggccctacg gtgggaagag ggtcttcgtc 120

tcaggctcct tcaccaggtg gtcggaacat ttgccgatgt ctcctgtcga aggctgcccc 180

actgtatttc aggctatttg cagcctgtct ccagggattc atgagtacaa gttctatgtg 240

gacggggagt ggcgtcatga tgagcgccaa cctactatat ctggggagtt cggcatagtt 300

aacacactat acttgacaag ggaatttaat caaataaacg ccttattaaa tccaagcaca 360

cctggaagca ggatgaacat ggatgtggat aatgaaaatt ttcaacatac ggttacattg 420

tcggatggta ccattccaga aggtactgtg agagtttcag aggctgcaat acaaatctca 480

aggtgccgcg tttctgagta tctcaatttg catacatgct atgatttact cccggattcg 540

ggcaaggtta ttgctctgga cattaattta cctgtgaagc aatcttttca tattctgcat 600

gaacagggga ttcctgtagc tcctctctgg gactcattca gaggtcaatt tgtcggcctt 660

ctgagcccat tggatttcat acttatattg cgggagctag aaactcatgg ctcgaacttg 720

acagaagatc agcttgaaac acacactata tctgcatgga aagaggctaa gcggcaaact 780

tgtggaagaa atgatggtca gtggcgagca catcagcatc tagtgcatgc caccccttat 840

gagtccttga gggacattgc agtaaagctt ttgcaaaatg acatttctac agtgccagtt 900

atttattcat catcatcaga tggatcattc cctcagttat tgcaccttgc atccctttct 960

ggaattttga aatgtatttt taggtatttt aaaaactcaa ctggtaattt gcctattctg 1020

aaccaaccgg tgtgctccat tccgctgggt tcctgggttc cgaaaatcgg tgatccaaac 1080

agtcgtccat tggctatgtt gcgacctaat gcatcactta gctctgccct taacatgttg 1140

gttcaagctg gagtgagctc aataccaatt gtggatgaaa acgactccct gcttgacact 1200

tactctagaa gtgacatcac agccctagct aaagacaagg tctacacaca tgttcgcctg 1260

gatgagatga ccattcatca ggctttacag cttggacaag atgccaatac gccttttggt 1320

ttttttaacg gtcagagatg ccagatgtgc ctccggtctg atcctttgct gaaggtgatg 1380

gagcgactgg ctaatccggg ggtgcggcgg gtgttcatag tagaagctgg gagcaaacgt 1440

gtggagggta ttatatcact gagtgatatt ttcaagttct tgctgagctt gtga 1494

<210> 2

<211> 497

<212> PRT

<213> sequence

<400> 2

Met Phe Ser His Gly Ala Asp Ser Ala His Asp Ala Gly Thr Val Gly

1 5 10 15

Val Ser Ser Gly Val Gly Ala Thr Val Pro Ala Arg Phe Val Trp Pro

20 25 30

Tyr Gly Gly Lys Arg Val Phe Val Ser Gly Ser Phe Thr Arg Trp Ser

35 40 45

Glu His Leu Pro Met Ser Pro Val Glu Gly Cys Pro Thr Val Phe Gln

50 55 60

Ala Ile Cys Ser Leu Ser Pro Gly Ile His Glu Tyr Lys Phe Tyr Val

65 70 75 80

Asp Gly Glu Trp Arg His Asp Glu Arg Gln Pro Thr Ile Ser Gly Glu

85 90 95

Phe Gly Ile Val Asn Thr Leu Tyr Leu Thr Arg Glu Phe Asn Gln Ile

100 105 110

Asn Ala Leu Leu Asn Pro Ser Thr Pro Gly Ser Arg Met Asn Met Asp

115 120 125

Val Asp Asn Glu Asn Phe Gln His Thr Val Thr Leu Ser Asp Gly Thr

130 135 140

Ile Pro Glu Gly Thr Val Arg Val Ser Glu Ala Ala Ile Gln Ile Ser

145 150 155 160

Arg Cys Arg Val Ser Glu Tyr Leu Asn Leu His Thr Cys Tyr Asp Leu

165 170 175

Leu Pro Asp Ser Gly Lys Val Ile Ala Leu Asp Ile Asn Leu Pro Val

180 185 190

Lys Gln Ser Phe His Ile Leu His Glu Gln Gly Ile Pro Val Ala Pro

195 200 205

Leu Trp Asp Ser Phe Arg Gly Gln Phe Val Gly Leu Leu Ser Pro Leu

210 215 220

Asp Phe Ile Leu Ile Leu Arg Glu Leu Glu Thr His Gly Ser Asn Leu

225 230 235 240

Thr Glu Asp Gln Leu Glu Thr His Thr Ile Ser Ala Trp Lys Glu Ala

245 250 255

Lys Arg Gln Thr Cys Gly Arg Asn Asp Gly Gln Trp Arg Ala His Gln

260 265 270

His Leu Val His Ala Thr Pro Tyr Glu Ser Leu Arg Asp Ile Ala Val

275 280 285

Lys Leu Leu Gln Asn Asp Ile Ser Thr Val Pro Val Ile Tyr Ser Ser

290 295 300

Ser Ser Asp Gly Ser Phe Pro Gln Leu Leu His Leu Ala Ser Leu Ser

305 310 315 320

Gly Ile Leu Lys Cys Ile Phe Arg Tyr Phe Lys Asn Ser Thr Gly Asn

325 330 335

Leu Pro Ile Leu Asn Gln Pro Val Cys Ser Ile Pro Leu Gly Ser Trp

340 345 350

Val Pro Lys Ile Gly Asp Pro Asn Ser Arg Pro Leu Ala Met Leu Arg

355 360 365

Pro Asn Ala Ser Leu Ser Ser Ala Leu Asn Met Leu Val Gln Ala Gly

370 375 380

Val Ser Ser Ile Pro Ile Val Asp Glu Asn Asp Ser Leu Leu Asp Thr

385 390 395 400

Tyr Ser Arg Ser Asp Ile Thr Ala Leu Ala Lys Asp Lys Val Tyr Thr

405 410 415

His Val Arg Leu Asp Glu Met Thr Ile His Gln Ala Leu Gln Leu Gly

420 425 430

Gln Asp Ala Asn Thr Pro Phe Gly Phe Phe Asn Gly Gln Arg Cys Gln

435 440 445

Met Cys Leu Arg Ser Asp Pro Leu Leu Lys Val Met Glu Arg Leu Ala

450 455 460

Asn Pro Gly Val Arg Arg Val Phe Ile Val Glu Ala Gly Ser Lys Arg

465 470 475 480

Val Glu Gly Ile Ile Ser Leu Ser Asp Ile Phe Lys Phe Leu Leu Ser

485 490 495

Leu

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

atgttctcgc acggcgctga t 21

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence

<400> 4

tcacaagctc agcaagaac 19

<210> 5

<211> 68

<212> DNA

<213> Artificial sequence

<400> 5

ggatccgcga cctaatgcat cacttagttc aagagactaa gtgatgcatt aggtcgcttt 60

ttcccggg 68

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

gccctgcctt catacgct 18

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<400> 7

gcaaatgttc cgaccacc 18

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence

<400> 8

ggctttacac tttatgcttc cg 22

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<400> 9

gccttcatac gctatttatt tgct 24

Claims

1. A method for cultivating lead stress-resistant corn, characterized in that the corn is up-regulatedZmAKINβγ1Expression of the gene; the corn isZmAKINβγ1The sequence of the gene is shown as SEQ ID NO. 1; the corn isZmAKINβγ1The amino acid sequence of the gene code is shown in SEQ ID NO. 2.

2. The method of claim 1, wherein the corn is upregulatedZmAKINβγ1The expression of the gene is: construction ofZmAKINβγ1The overexpression vector in the corn is used for infecting the young embryo of the corn by the constructed overexpression vector through agrobacterium-infected cells, and the corn is subjected to the infectionZmAKINβγ1The gene is transformed into young maize embryo, selfing is carried out for three generations, and homozygous positive transformed plants, namely the lead-resistant maize plants, are obtained.