CN114807191B

CN114807191B - Barley HvChit34 gene and application thereof

Info

Publication number: CN114807191B
Application number: CN202210220072.1A
Authority: CN
Inventors: 陈沁�; 邬飞波
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2022-03-08
Filing date: 2022-03-08
Publication date: 2024-02-13
Anticipated expiration: 2042-03-08
Also published as: CN114807191A

Abstract

The invention discloses a barley HvChit34 gene and application thereof, belonging to the technical field of genetic engineering. The nucleotide sequence of the CDS region of the barley HvChit34 gene is shown in SEQ ID NO. 1. According to the invention, through cloning and analyzing the HvChit34 gene of the barley and combining with a homologous genetic transformation over-expression technology, functional verification of the HvChit34 gene on a barley variety golden hope GP is found, the cadmium resistance of a HvChit34 over-expression plant is obviously enhanced, the instantaneous Cd absorption capacity of the rhizosphere is obviously reduced, and the cadmium content in the plant is obviously reduced. The invention provides theoretical basis and related genes for barley cadmium-resistant and low-cadmium accumulation breeding and production.

Description

Barley HvChit34 gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a barley HvChit34 gene and application thereof in regulating and controlling tolerance of barley to cadmium stress.

Background

Soil heavy metal pollution is a global problem and has great threat to the quality safety of agricultural products and the health of human bodies. Soil heavy metal pollution has latency, irreversibility, chronicity and severity of consequences (Chen Huaiman et al, 1996). Cadmium (Cd) is a non-biological essential heavy metal element with strong toxicity and is listed by the U.S. poison management committee (attr) as a 6 th toxic substance that is hazardous to human health. The cadmium pollution of the soil can not only poison crops and reduce the yield and the quality of the crops, but also enrich the harm to the human body through food chains (Obata et al, 1994). Excessive cadmium intake in the human body can lead to a series of chronic poisoning symptoms such as anemia, kidney injury, liver injury and the like, cause osteoporosis, increase the chances of carcinogenesis and teratogenesis, and even cause death (Weigong et al, 2007). Cadmium pollution has created a great threat to the sustainable development of agricultural production and human quality of life (Davis, 1984). The control and reduction of cadmium pollution of crops are in need of solving.

The fundamental approach to alleviating the toxic heavy metals on crops and realizing the safe production of crops is to control the heavy metal pollution of the soil, and for the polluted soil, although various methods (technologies) including bioremediation by super-accumulated plants to reduce the heavy metal content of the soil have been proposed, the methods have not been effectively applied to the treatment of large-area soil so far (cobrett, 2000; alkorta et al, 2004). For farmlands with medium and slight cadmium pollution and large area, screening of crop varieties with low cadmium accumulation in edible organs and improvement of agriculture and chemical regulation technology to relieve cadmium toxicity and reduce cadmium absorption and accumulation of crops are important ways for effectively utilizing natural resources and ensuring safe production of agricultural products.

In recent years, in order to reduce the cadmium content of grains of grain crops and realize safe production of crops on medium and light cadmium-polluted soil, some countries have implemented screening and cultivation of low-cadmium accumulation varieties, namely, reduction of accumulation of cadmium of crops through breeding approaches (Grant et al, 2008). However, the cultivation and utilization of low-cadmium accumulation varieties are restricted by the lack of excellent germplasm resources, the unknown genetic mechanism of cadmium absorption and accumulation of crops, the lack of matching of breeding technology and the like, wherein the research on genes related to the low accumulation of cadmium is particularly weak (Wu et al, 2007; xue et al, 2009).

Chitinase (EC 3.2.1.14), a glycoside hydrolase that hydrolyzes beta-1, 4-glycosidic linkages in chitin, chitosan, lipo-chitooligosaccharides, peptidoglycans, arabinogalactans and glycoproteins containing N-acetylglucosamine, is widely available in plants (Collinge et al, 1993). Chitin has not been detected in plants, but chitin is a major component of the cell wall of pathogenic fungi, and is also an essential structural component for organisms such as arthropods (Li and Roseman,2004; nagpure et al, 2013); plant chitinase is a disease-associated protein that can destroy its cytoskeleton and inhibit its proliferation by degrading chitin in the structures of fungal cell walls, insect's foodmembranes, and exoskeletons, and has therefore been of interest to plant pathologists (Chandra et al, 2015). The response of Chit to cadmium stress or various abiotic stress is still limited to the expression analysis of Chit under the stress, and the expression characteristics, functions and molecular mechanisms of the family genes involved in regulating the stress tolerance are still lack of research.

Barley (Hordeum vulgare L.) is the fourth cereal crop cultivated universally throughout the world and is one of the major sources of direct or indirect uptake of cadmium by humans (Hayes et al 2020; lei et al 2020). Meanwhile, barley is a diploid self-pollinated crop, has a small chromosome number, can be used as a model plant of other wheat crops, and is very suitable for physiological and genetic mechanism research (Forster et al, 2000). Therefore, the effect and molecular mechanism of the barley Chit gene in cadmium accumulation and tolerance are studied deeply, and the method has important significance.

Disclosure of Invention

The invention aims to provide a gene cloned from barley and having cadmium resistance, and provides theoretical basis and related genes for barley cadmium resistance and low cadmium accumulation breeding and production.

In order to achieve the above purpose, the invention adopts the following technical scheme:

the invention uses barley Weisu (cadmium-resistant genotype) and east 17 (cadmium-sensitive genotype) screened in the earlier stage of a subject group as materials, and utilizes a gene chip technology to compare and analyze genotype differences of Weisu (cadmium-resistant genotype) and east 17 transcriptomes in response to cadmium stress, and identifies candidate genes related to cadmium resistance, wherein the genes are annotated as Chitinase (Chitinase; HORVU7 Hr1G113270.1) and belong to endochitinase families. The barley chitinase gene (HvChit) homologous gene was further subjected to genome-wide scanning and screening, and the HORVU7Hr1G113270.1 gene located at 7H was named HvChit34.

Cloning and analysis of HvChit34 gene: the gene HvChit34 with cadmium resistance is cloned from barley Weisu obuzhi, and the nucleotide sequence of the CDS region of the gene is shown as SEQ ID NO. 1.

The total length of CDS region of HvChit34 gene is 972bp, and the coded protein sequence contains 323 amino acid residues. The molecular weight of the protein is 34.09kDa; isoelectric point pi=7.36. Functional domain and protein structural analysis prediction results show that the protein has 3 conserved functional domains: the 1 st to 27 th amino acid sequence is signal peptide; the 29 th to 66 th amino acid sequence is the CtBD 1 domain, which is responsible for binding to N-acetylglucosamine; pfam.Glyco_hydro_19domain of amino acid sequence 79-310, responsible for catalyzing hydrolysis of glycosidic linkages.

The HvChit34 protein sequence is subjected to evolutionary tree analysis, and the result shows that the protein, zmChit27, osChit2 and AtCHI-B are positioned on the same evolutionary branch and have the nearest relationship with the ZmChit 27. Sequence comparison results show that the sequence similarity of HvChit34 and OsChit2 and ZmChit27 is higher and is 75.33% and 74.3% respectively; but the sequence similarity with AtCHI-B is low, only 63.47%.

Analysis of expression pattern of HvChit34 gene: the expression level of HvChit34 gene in the stem and leaf of the overground part is higher than that of the root system, and the cadmium stress obviously induces the expression of the gene in the overground part. Further analysis of response changes in cadmium stress time showed that: the HvChit34 gene can rapidly respond to cadmium stress in a short time, and the relative expression quantity of the HvChit34 gene is obviously up-regulated after Cd treatment for 6 hours and then gradually reduced until the Cd treatment is 3 days and even lower than the initial level; however, the HvChit34 gene expression level was significantly increased to a maximum value of 10d as the treatment time was prolonged to 7 d.

Culturing and screening by using agrobacterium-mediated barley young embryo genetic transformation technology to obtain an overexpression plant of the HvChit34 gene. Under the condition of cadmium stress, the growth vigor of the HvChit34 over-expressed plant is obviously superior to that of a wild plant, and is mainly expressed in chlorophyll content, root length and root fresh weight.

Therefore, the invention provides the application of the barley HvChit34 gene in regulating and controlling the cadmium stress tolerance of barley, and particularly, the overexpression of the barley HvChit34 gene enhances the cadmium tolerance of plants.

The application comprises: by using biotechnology means, the HvChit34 gene in the barley is up-regulated for expression, and the tolerance of the barley to cadmium stress is improved.

Research shows that after HvChit34 gene in barley is over-expressed, the tolerance of the plant to cadmium stress is obviously enhanced, and the plant is characterized by reducing the active oxygen increase caused by cadmium stress, promoting the accumulation of antioxidant substances and increasing the activity of antioxidant enzyme.

Further research shows that after HvChit34 gene is over-expressed, the instantaneous Cd absorbing capacity of the rhizosphere of the barley plant is obviously reduced, and the cadmium content in the barley plant is obviously reduced. Specifically, the HvChit34 gene regulates and controls the cadmium absorption of barley, and the over-expression of the HvChit34 gene of the barley reduces the cadmium absorption of plants.

Further, the application includes: inserting the barley HvChit34 gene into an over-expression vector to construct a recombinant plasmid, then introducing a target gene fragment into a receptor barley by using an agrobacterium-mediated technology, and screening to obtain a transgenic plant obtained functionally.

The construction of the recombinant plasmid may be carried out by a conventional method. If a Gateway system is adopted, the HvChit34 gene fragment is firstly connected into an entry vector pDONR (Zeo) through BP reaction and then connected into an over-expression vector through LR reaction.

Preferably, the overexpression vector is pBract214.

Preferably, the host bacterium used in the agrobacterium-mediated technique is agrobacterium AGL1. The genetic transformation material adopts barley embryo. The recipient barley variety is Golden hope (GP; H.vulgare L.).

The invention has the beneficial effects that:

according to the invention, through cloning and analyzing the HvChit34 gene of the barley and combining with a homologous genetic transformation over-expression technology, functional verification of the HvChit34 gene on a barley variety golden hope GP is found, the cadmium resistance of a HvChit34 over-expression plant is obviously enhanced, the instantaneous Cd absorption capacity of the rhizosphere is obviously reduced, and the cadmium content in the plant is obviously reduced. The invention provides theoretical basis and related genes for barley cadmium-resistant and low-cadmium accumulation breeding and production.

Drawings

FIG. 1 is an alignment of CDS sequences of HvChit34 genes in three barley genotypes (Weisuobuzhi, cadmium tolerant barley genotype; east 17, cadmium sensitive barley; golden hope, GP).

FIG. 2 shows the structure prediction of barley HvChit34 protein, wherein (A) is the HvChit34 protein functional domain predicted by SMART; (B) is the predicted HvChit34 protein structure of the Protter.

FIG. 3 is a comparison of the evolutionary analysis of HvChit34 with homology, wherein (A) is the treeing analysis of HvChit34 with rice, maize, arabidopsis GH19 subfamily chitinase; (B) The amino acid sequence comparison chart of the barley HvChit34 and the rice OsChit2, the corn ZmChit27 and the arabidopsis AtCHI-B shows that the dark blue, the pink and the blue-green respectively represent 100 percent, 75 percent and 50 percent of matching degree.

FIG. 4 shows the expression pattern analysis and subcellular localization of HvChit34 gene, wherein (A) is the expression level of HvChit34 gene in different tissues of barley; (B) The expression quantity of the HvChit34 gene under different Cd stress treatment time is shown; (C) In-situ PCR verification of HvChit34 of barley leaves and roots, and positive control of an action gene on the left; the middle is a negative control which does not carry out reverse transcription; the right is HvChit34 specific expression; en: an endothelial layer; PPC: phloem parenchyma cells; BS: a vascular bundle sheath; XV: a xylem vessel; co: a cortex layer; pe: a columella sheath; ph: phloem, scale represents 100 μm; (D) For subcellular localization of HvChit34 in barley protoplasts (first, second row) and tobacco epidermal cells (third, fourth row), endoplasmic reticulum markers were used in protoplasts, while nuclear markers were used in tobacco, in order from left to right: GFP channels, RFP channels, bright field and fusion channels, scale bars represent 50. Mu.m.

FIG. 5 shows the expression level and phenotype analysis of HvChit34 over-expressed lines under Cd stress, wherein (A) is the growth phenotype of wild type GP and HvChit34 over-expressed lines under control and Cd treatment, and the scale represents 5cm; (B) The relative expression quantity of HvChit34 genes at the ground and underground parts of each strain under the control and Cd treatment; (C) Chlorophyll a, chlorophyll b and total chlorophyll content in the leaves after 14d of Cd treatment for each line; (D) Chitinase activity of the overground and underground parts of each strain under control and Cd treatment; (E) The plant height and root length of each plant under the control and Cd treatment are determined; (F) And (G) the dry fresh weights of the overground and underground parts of each strain under the control and Cd treatment respectively, and the different lowercase letters represent significant differences (p < 0.05).

FIG. 6 shows transient Cd at root tip of HvChit34 over-expressed strain ²⁺ Ion flow variation analysis wherein (A) is transient Cd ²⁺ Ion flow variation; (B) Is the maximum Cd ²⁺ Ion flow; (C) Is average Cd ²⁺ Ion flow; (D) Is steady state Cd ²⁺ Ion flow; (E) As total Cd ²⁺ Ion flow.

FIG. 7 is a graph showing the effect of Cd stress on active oxygen accumulation and antioxidant enzyme activity in HvChit 34-overexpressing lines, wherein (A) and (B) are hydrogen peroxide and malondialdehyde, respectively, in leaves of each lineThe content is as follows; (C) (D) reducing ascorbic acid and glutathione contents in the leaves of each strain respectively; (E) (F), (G), (H) and (I) are SOD, POD, CAT, GR, APX enzyme activities in the leaves of each strain, respectively. Wheat seedlings of 3 weeks old were used as controls or 10. Mu.M CdCl ₂ Treatment under stress for 3 days, the different lower case letters represent significant differences (p<0.05)。

FIG. 8 is a graph showing the effect of Cd stress treatment on Cd content in different tissues of HvChit34 overexpressing strain, wherein (A) is 10. Mu.M CdCl obtained by hydroponic 3-week-old wheat seedlings ₂ 2 weeks of treatment, and respectively measuring Cd content in roots, leaf sheaths and leaves of the GP and HvChit34 over-expression strain; (B) (C), (D), (E) and (F) are controls, 5mg Kg, respectively, for GP and OX strains, respectively ^-1 、15mg Kg ^-1 Soil culture Cd treatment, harvesting and measuring Cd content in roots, leaves, leaf sheaths, cobs and seeds after growing to maturity, and obvious difference of different lowercase letters (p<0.05)。

Detailed Description

The technical scheme of the invention is further specifically described by the following specific examples. It should be understood that the practice of the invention is not limited to the following examples, but is intended to be within the scope of the invention in any form and/or modification thereof.

In the present invention, the equipment, materials, etc. used are commercially available or commonly used in the art, unless otherwise specified. The methods in the following examples are conventional in the art unless otherwise specified.

The invention takes the cadmium stress resistant genotype Weiso obuzhi of the barley screened in the earlier stage of the subject group and the cadmium stress sensitive genotype east 17 (published in Chen F, wang F, zhang GP, et al identification of barley varieties tolerant to cadmium biological Trace Element Research,2008,121 (2): 171-179) as main materials, clones the cadmium stress resistant related gene HvChit34 of the barley, and has important significance for elucidating the molecular mechanism of the barley responding to cadmium stress and breeding and production with low cadmium accumulation.

Example 1 cloning and analysis of CDS region of HvChit34 Gene

1. Barley growth conditions

Barley Weisu obuzhi, dong 17 seeds with 2% H ₂ O ₂ Sterilizing for 30min, washing with distilled water for 5-6 times, placing the sterilized seeds on a germination box paved with double-layer wet filter paper, modifying the germination box by a storage box, punching holes on a cover, adding distilled water into the germination box and ventilating, performing dark culture (22 ℃/18 ℃) in a growth chamber, and performing light supplementing (22 ℃/18 ℃) in daytime/nighttime after germination. On day 6, seedlings with consistent growth vigor are selected and transferred into a 1L black plastic bucket filled with barley basic culture solution, each hole is covered by 5 holes of plastic, two seedlings are fixed by using sponge, the seedlings are cultured in a barley culture room, and the barley basic culture solution adopts a 1/5Hogland formula. The plants after 3d of preculture were subjected to a cadmium stress (10. Mu.M Cd in basic nutrient solution, pH 5.8) test, with the basic nutrient solution as a control.

2. Cadmium-resistant genetic analysis

The genotype differences of Weiso obuzhi and Dong 17 transcriptome in response to cadmium stress are compared and analyzed by using a gene chip technology, a candidate gene (probe number Contig3574_s_at) related to cadmium resistance is identified, the candidate gene is translated into a protein sequence according to the nucleic acid sequence of Contig3574_s_at, BLAST comparison is carried out through NCBI and barley database IPK, and the result shows that the protein contains Chitin-binding domain (CBD) and Glycoside hydrolase family domain (GH 19), is annotated as Chitinase (Chitinase, chit; HORVU7Hr1G 113270.1) and belongs to the endochitinase family.

The qRT-PCR verification and chitinase activity measurement results show that the chitinase gene in the cadmium-resistant genotype Weisuobuzhi is obviously up-regulated for expression under the cadmium stress, and the chitinase activity is obviously higher than that of east 17.

The genome-wide scanning and screening of barley chitinase (HvChit) homologous genes were carried out by the HMM search and BlastP methods, and 37 HvChit were identified in total, named HvChit 1-HvChit 37 according to their chromosome distribution sequence, wherein the HORVU7Hr1G113270.1 gene located at 7H was named HvChit34.

3. Cloning of CDS region sequence of HvChit34 Gene

The extraction of Weisuobuzhi, east 17 and GP leaf total RNA was performed according to the instructions of the RNA extraction kit (Takara, japan), and the extracted total RNA was reverse transcribed into cDNA by removing genomic DNA contamination in the total RNA using DNaseI. Specific primer design is carried out according to a blast sequence, and the specific primer sequence is as follows:

HvChit34-CDS-F：5'-ATGTCCGCGCTGAGAGCACCTTG-3'(SEQ ID No.3)；

HvChit34-CDS-R：5'-CTGCACCGCGAGCCCGATG-3'(SEQ ID No.4)；

and (3) after gel running verification of the amplified product, gel recovery is carried out, a pMD18-T vector is connected, escherichia coli DH5 alpha is transformed, positive clones are sent to a company for sequencing, plasmid extraction and glycerol preservation are respectively carried out after correct sequencing, and the obtained plasmid is named pMD18-T-HvChit34 plasmid.

The nucleotide sequence alignment of CDS regions of three barley genotypes of Weisuobuzhi, east 17 and GP revealed that there were no differences between the CDS sequences of Weisuobuzhi and east 17, but they had 3 SNPs to the CDS sequence in GP (FIG. 1), where missense mutation was at 2, the 41 st amino acid residue in GP was changed from aspartic acid to asparagine and the 113 st amino acid residue was changed from serine to glycine.

PCR primers were performed by Shanghai Biotechnology Co., ltd, and gene sequencing was performed by Shanghai platinum Biotechnology Co., ltd. The nucleotide sequence of the CDS region of the HvChit34 gene of barley Weisu obuzhi is shown in SEQ ID NO. 1.

4. HvChit34 protein sequence analysis

The protein sequence encoded by HvChit34 comprises 323 amino acid residues, the basic quality and the nature of the protein are analyzed on line by Expasy (http:// www.expasy.org/tools/protparam. Html), and the molecular weight of the protein is 34.09kDa; isoelectric point pi=7.36.

The HvChit34 protein sequence was analyzed for functional domain prediction via SMART (http:// SMART. Embl-heidelberg. De /) and Protter 1.0 (http:// wlab. Ethz. Ch/procter/#) websites, and the results are shown in FIG. 2, which shows that the protein has 3 conserved functional domains: wherein the red moiety is a signal peptide comprising amino acid residues 1-27; the green part is a ChtBD1 domain, positioned at the 29 th-66 th amino acid sequence and responsible for combining with N-acetylglucosamine; and pfam. Glyco_hydro_19domain located at amino acid sequences 79-310, responsible for catalyzing hydrolysis of glycosidic linkages.

Since HvChit34 belongs to a GH19 subfamily member, it was constructed with 47 GH19 subfamily members from other species into a phylogenetic tree comprising 16 rice (Oryza sativa l.) oschi proteins, 17 maize (Zea mays l.) zmcit proteins, 14 arabidopsis thaliana (Arabidopsis thaliana l.) atchi proteins. The results of the evolutionary tree showed that HvChit34 was located in the same evolutionary branch as ZmChit27, osChit2 and AtCHI-B and was closest to ZmChit27 (FIG. 3A). Subsequent sequence comparison results show that the sequence similarity of HvChit34 and OsChit2 and ZmChit27 is higher and is 75.33% and 74.3% respectively; but the sequence similarity to AtCHI-B was low, only 63.47% (fig. 3B).

5. Expression pattern analysis of HvChit34 Gene

Analysis of expression pattern of HvChit34 gene: as shown in FIG. 4A, under the control condition, the HvChit34 gene is mainly expressed in the upper part of Weisoubuzhi, and the expression amount is the highest in the leaves; and after 10 mu M Cd treatment, the expression quantity in the leaf is still highest, and meanwhile, cadmium stress has no obvious influence on the root expression quantity, but the expression quantity in the induced stem and the leaf is obviously up-regulated. The HvChit34 gene is induced by cadmium stress and mainly occurs in the overground part.

The Weisoubuzhi leaf tissues at 9 time points of 0h, 1h, 6h, 12h, 24h, 3d, 7d, 10d and 15d of cadmium treatment are selected, and the response change of HvChit34 gene to cadmium stress time is further analyzed. As shown in FIG. 4B, the HvChit34 gene can rapidly respond to cadmium stress in a short time, and the relative expression level of the HvChit34 gene is significantly up-regulated after Cd treatment for 6 hours and then gradually reduced until the Cd treatment is 3d and even lower than the initial level; however, the HvChit34 gene expression level was significantly increased to a maximum value of 10d as the treatment time was prolonged to 7 d.

The tissue localization of the HvChit34 gene is analyzed by adopting an in-situ PCR technology with Digoxin (DIG) as a marker, and the result is shown in fig. 4C, and compared with a negative control without reverse transcription, the transcript (blue signal) of the HvChit34 gene is expressed in leaves and root systems, the expression abundance in the leaves is higher, and the signals are intensively distributed in mesophyll cells and phloem parenchyma cells; in the root system, although signals can be detected in the epidermal cells, the intensity is obviously lower than that of the center column. DIG signals are concentrated in xylem parenchyma cells and pericycle cells around the catheter.

Subcellular localization results of HvChit34 showed that HvChit34 was localized to the endoplasmic reticulum and cell membrane as shown in fig. 4D.

Example 2 Gene overexpression verification of HvChit34 Gene function in barley GP

1. Construction of the overexpression vector

The method for constructing the over-expression vector in the experiment is Gateway. Total RNAs of Weisuobuzhi and Golden hope (Golden promisc) of barley were extracted and reverse transcribed into cdnas, over-expression primers for the hvChit34 gene were designed, and amplification of the CDS region of the target gene was performed using the Weisuobuzhi cDNA as a template.

The primer sequence of the CDS region of the 972bp target gene amplified by the overexpression primer of the HvChit34 gene is as follows:

HvChit34-OX-F：5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGTCCGCGCTGAGAGCAC-3'(SEQ ID No.5)；

HvChit34-OX-R：5'-GGGGACCACTTTGTACAAGAAAGCTGGGT TCACTGCACCGCGAGCC-3'(SEQ ID No.6)；

detecting PCR amplified products by 1% agarose gel electrophoresis, performing gel recovery and purification on target products, and measuring the concentration of recovered products. The recovered gene product of known concentration was then subjected to BP recombination as follows.

BP recombination reaction system:

reacting at 25deg.C for 4 hr, adding 1 μl of protease K, continuing to react at 37deg.C for 10min, immediately transforming E.coli DH5 alpha competent cells with the reaction product, coating bleomycin-resistant LB solid medium, culturing at 37deg.C for about 16 hr, picking up monoclonal, shaking for bacterial liquid PCR, sequencing positive clone bacterial liquid, sequencing correct monoclonal, and propagating, and respectively named pDONR (Zeo) -HvChit34-OX. The above plasmid of known concentration was subjected to LR reaction (pBract 214 vector is an over-expression vector) as follows.

LR reaction system:

reacting for 4h at 25 ℃, adding 1 mu L of protease K, continuing to react for 10min at 37 ℃, immediately converting the reaction product into escherichia coli DH5 alpha competent cells, coating kanamycin-resistant LB solid culture medium, culturing for about 16h at 37 ℃, picking up monoclonal, shaking to turbidity, carrying out bacterial liquid PCR, sequencing the bacterial liquid of a target strip to a company, sequencing the correct monoclonal for propagation, preserving bacterial liquid glycerol and extracting plasmids, wherein the plasmids are named pBract214-HvChit34 respectively. The correctly sequenced plasmid was transformed into Agrobacterium competent cells AGL1 (pSoup), coated with a rifampicin+kanamycin resistant YEB plate, incubated at 28℃for about 40-48h, and positive clones were verified by PCR. 100. Mu.L of positive clone bacteria solution is added into 10mL of MG culture solution (pH=7.2, containing 25. Mu.g/mL rifampicin and 50. Mu.g/mL kanamycin) for culture, the temperature is 28 ℃, the speed is 180rpm, and bacteria shaking is carried out until the OD ₆₀₀ =0.6-0.7, adding 30% sterile glycerol with equal volume, mixing, rapidly freezing with liquid nitrogen, and storing at-80deg.C.

2. Genetic transformation of young barley embryo

2.1 genetic transformation Material preparation

Genetic transformation takes young embryo of cultivated barley variety Golden hope (Golden Promise, GP; H.vulgare L.) as explant, grain is generally harvested after 2-3 weeks of flowering of barley, and ear is harvested when young embryo diameter is 1.5-2 mm.

2.2 separation and Disinfection of young embryos

Selecting immature embryo seeds of barley meeting the standard, peeling the immature embryo seeds from the ears, removing awns, sterilizing the seeds with 70% alcohol for 30s, and washing with sterilized water for several times. Soaking with 10% sodium hypochlorite for 4min, and washing with sterilized water for several times. Separating immature embryo on sterile filter paper, removing hypocotyl, and culturing on callus induction medium at 23-24deg.C in dark for 1-2d.

2.3 Agrobacterium infection and Co-cultivation

400 mu L of the stored Agrobacterium solution was added to 10mL of MG liquid medium without antibiotics, and cultured overnight at 28℃at 180rpm, OD ₆₀₀ =1.8-2.0 for young embryo infestation. And (5) dripping the prepared agrobacterium infection onto each young embryo, and airing. Sealing the plate with sealing film, culturing in dark at 23-24deg.C for 3d.

2.4 selection culture

After 3d co-cultivation with Agrobacterium, the young embryos are transferred to fresh callus induction medium plates for selection. At this time, the medium contained 50mg/L hygromycin to screen positive calli and 160mg/L ter-mina to inhibit Agrobacterium growth. After 56d of dark culture at 23-24 ℃ (medium plates are replaced every 14 d), calli isolated from young embryos are transferred to transfer medium and incubated for 21d at 24 ℃ in low light, at which point green spots will be produced.

2.5 transgenic plant regeneration

Transferring green spots to a secondary culture medium for continuous culture, and when the leaves on the upper part reach 2-3cm, constructing the root. Transferring the young seedling into rooting culture medium, and adding no growth regulator, with unchanged antibiotic. And then taking out the seedlings with root systems built, washing off the culture medium, transferring the seedlings into a small basin containing vermiculite and nutrient media, and growing in a climatic chamber (22 ℃/18 ℃ in daytime/nighttime) until seeds are harvested.

3. Verification of transgenic plants and phenotypic identification of HvChit34 over-expressed lines

Dormancy of transgenic barley seeds was broken by pre-freezing and heat drying, and the seeds germinated on a moist sand bed. After 7d of emergence, the seedlings are transferred to a hydroponic container containing basic nutrient solution for continuous growth. In the two-leaf stage, transgenic plant leaves are selected, DNA is extracted, wild GP is taken as a negative control, pBract214-HvChit34 plasmid is taken as a positive control, whether a vector carrying a target fragment is transferred into a barley genome is verified, and an over-expression plant of HvChit34 gene is obtained through screening: hvChit34-OX11 and HvChit34-OX12.

DNA verification positive plants, carrying out RNA extraction and reverse transcription on overground parts and root systems of the plants, and verifying the expression level of HvChit34 genes by RT-PCR semi-quantitative and fluorescent quantitative PCR by taking the expression level of HvChit34 genes in wild GP as a reference.

The DNA verification primers of the over-expressed plants are:

pBract-F:GCATATGCAGCAGCTATATGTG(SEQ ID No.7)；

HvChit34-OX-R:GGGGACCACTTTGTACAAGAAAGCTGGGT TCACTGCACCGCGAGCC(SEQ ID No.6)；

the verification primers used for qRT-PCR were:

Actin-F：CCAAAAGCCAACAGAGAGAA(SEQ ID No.8)；

Actin-R：GCTGACACCATCACCAGAG(SEQ ID No.9)；

GAPDH-F：AAGCATGAAGATACAGGGAGTGTG(SEQ ID No.10)；

GAPDH-R：AAATTTATTCTCGGAAGAGGTTGTACA(SEQ ID No.11)；

HvChit34-qRT-F：CATCCAGCTCACCCACAAAT(SEQ ID No.12)；

HvChit34-qRT-R：ATCCAGAACCAAATCGCCGT(SEQ ID No.13)；

the results are shown in FIG. 5, the growth phenotype of the wild type and HvChit34 over-expressed plants under normal growth conditions (Control) and Cd treatment conditions (Cd), and the growth vigor and growth traits of the wild type and the over-expressed plants under the Control conditions are not significantly different; after 14 days of 10 μm Cd treatment, the growth vigor of the HvChit34 overexpressing plants was significantly better than that of the wild type (fig. 5A), the chlorophyll a, chlorophyll b and total chlorophyll content in leaves of the HvChit34-OX11 plants were significantly higher than that of the wild type (fig. 5C), and root length and root fresh weight of the overexpressing plants were significantly higher than that of GP (fig. 5E, F), but the plant height and dry fresh weight of the aerial parts were not significantly different from one plant to another.

The expression level of HvChit34 gene was significantly increased in each over-expressed strain, with the average expression level in the aerial part being 11.2 times that of wild-type GP, and in the root system being 21.1 times that of GP, both under control and Cd stress conditions (fig. 5B). Consistent with the expression level results, chitinase activity in root system and leaf of hvchat 34 over-expressed strain was also significantly higher than that of wild type (fig. 5D).

4. Overexpression of HvChit34 on barley rhizosphere Cd ²⁺ Influence of ion flow

Barley wild type GP and HvChit34 over-expression strain T subjected to germination accelerating treatment ₂ Seed generation, placing in BSM solution (1mM KCl+0.05mM CaCl) ₂ ) After medium aeration culture for 5 days, selecting seedlings with consistent sizes, and performing Cd in root tip mature region (about 30mm from root tip) by microelectrode ion flow detection (MIFE, microelectrode ion flux estimation) technology ²⁺ Ion flow measurement.

Fixing seed roots of seedlings on a glass slide horizontally by using a Parafilm sealing film, and placing the seedlings in a culture dish containing BSM solution for dark culture for 60min to stabilize ions on the surface of root systems; then put it into a detection tank while being filled with Cd ²⁺ The microelectrode of the ion exchanger was fixed at 40 μm from the root surface and was controlled by a micro motor (Patchman NP2, eppendorf, hamburg, germany) to oscillate back and forth with an amplitude of 40 μm for a period of 6s during the measurement. The first 5min of the assay was performed under control conditions (BSM solution) to confirm that the root system was in an initial stable state; the BSM solution was then changed to 10. Mu. MCdCl ₂ The measurement was continued for 25 minutes. The rhizosphere net ion flux was calculated after the assay was completed using the MIFEFLUX program (Newman, 2001) and repeated 8 times per strain.

The results are shown in FIG. 6, and the MIFE test results show that the root tips of barley of each strain have a net Cd effect under the control condition ²⁺ The flows are all around zero; while at 10. Mu.M CdCl ₂ Under treatment, significant Cd occurred in both the wild-type GP and the root tip maturation region of the overexpressing strain ²⁺ The average Cd in the mature region of the root tip of barley can be obviously reduced by the internal flow and the overexpression of HvChit34 gene ²⁺ Cd in ion flow rate and steady state ²⁺ Ion flow rate and rhizosphere absorbed Cd ²⁺ Total ion but for maximum Cd ²⁺ The ion flow rate has no significant effect.

5. Overexpression of HvChit34 significantly enhances cadmium tolerance in barley

Wild type barley GP and HvCh of two leaves and one heart stageThe it34 over-expression plants are subjected to a water culture cadmium stress test, 10 mu M Cd is treated for 3 days, and then leaves are respectively sampled to determine H ₂ O ₂ The contents of MDA, GSH and AsA, and activities of various antioxidase (including SOD, POD, CAT, APX, GR) are measured by using corresponding kits (Nanjing built Biotechnology Co., ltd.) and each treatment is repeated at least 3 times.

As shown in FIG. 7, the Cd treatment 3d significantly increased MDA and H in the leaves of each strain ₂ O ₂ Accumulated, but H in HvChit34 overexpressing lines ₂ O ₂ The accumulation was significantly lower than the wild type (fig. 7A, B); in contrast, the antioxidant content (reduced AsA and GSH) was significantly higher in the Cd stress over-expressed lines than in the wild type (fig. 7C, D). Regarding antioxidant enzyme activity, cd stress significantly reduced SOD enzyme activity in wild-type leaves, but had no significant effect on HvChit34 overexpressing lines (fig. 7E); cd treatment significantly induced POD, CAT and GR activity in each strain leaf, while overexpression of HvChit34 gene resulted in a further increase in these three antioxidant enzyme activities relative to wild-type GP (fig. 7F, G, H); APX activity in GP was not significantly different under control and Cd treatment, but APX enzyme activity in the over-expressed strain was significantly increased under Cd treatment (fig. 7I). The result shows that the over-expression of the HvChit34 gene can obviously reduce the active oxygen increase caused by Cd stress, promote the accumulation of antioxidant substances and obviously increase the activities of various antioxidant enzymes, thereby relieving the oxidative stress caused by Cd stress.

6. Overexpression of HvChit34 significantly reduces the accumulation of endogenous Cd in barley

After 14 days of water culture cadmium stress treatment, each plant line is taken out, and the root system is firstly treated by 20mM EDTANa ₂ Chelating for 30min, and then washing with deionized water to remove ions adsorbed on the surface of the rhizosphere; then cutting the plants into root systems, leaf sheaths and leaves, respectively placing the root systems, leaf sheaths and leaves in an oven, and drying the plants at 70 ℃ until the weight is constant. Weighing the sample, cutting, transferring to digestion tube, adding 2mL of concentrated HNO ₃ Electroheat digestion was performed using a constant temperature metal bath (DTU-2 CN, TAITEC, japan). The digestion solution was sized to 20mL with deionized water and diluted 10-fold, followed by ICP-MS (Inductively coupled Plasma Mass Spectrometry,agilent 7900) to determine endogenous Cd content in different tissues of each strain.

As shown in FIG. 8A, the Cd concentration in the root system of the HvChit34 over-expressed plant is significantly lower than that of the wild type, and the Cd concentration in the two strains is reduced by 19.1 percent (HvChit 34-OX 11) and 27.3 percent (HvChit 34-OX 12) respectively relative to the GP, but the cadmium concentration in the upper tissues of each strain is not significantly different.

To further explore the effect of HvChit34 gene on barley Cd accumulation, wild GP, hvChit34 overexpressing strain T ₁ The seeds are subjected to a soil culture cadmium treatment test, and are set as a control, 5mg Kg ^-1 、15mg Kg ^-1 Groups, each strain was treated differently to set at least 3 pot replicates. All materials are cultivated in a net room of a Hongkong district of Zhejiang university to a mature period, the whole plant is harvested, the root system is cleaned and dried, and the Cd content in the root, leaf sheath, leaf, spike and seed grains under different treatments of each plant system is respectively measured.

The results are shown in FIGS. 8B-F, at 5mg Kg ^-1 Under cadmium treatment, only the Cd content in the seed grains of the over-expression strain is obviously lower than that of the wild type, and the Cd content in other tissues has no obvious difference with GP; while at 15mg Kg ^-1 Under cadmium treatment, the content of Cd in leaf sheaths of the over-expression plants is not obviously different from that of the wild plants, but the content of Cd in roots, leaves, cobs and seeds is respectively reduced by 37.7%, 54.9%, 45.2% and 34.2% on average compared with GP. These results indicate that the cadmium content of plants can be significantly reduced after the HvChit34 gene is overexpressed, especially under high concentration Cd stress.

In conclusion, through cloning and analysis of the barley HvChit34 and functional verification of the gene on the barley GP by combining an overexpression technology, the cadmium resistance of the HvChit34 overexpressed plant is obviously enhanced, and the cadmium content in the plant body of the HvChit34-OX overexpressed plant is obviously reduced. The invention provides theoretical basis and related genes for barley cadmium stress resistance and low cadmium accumulation breeding and production.

Finally, it should also be noted that the above list is merely a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.

Sequence listing

<110> university of Zhejiang

<120> barley HvChit34 gene and use thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 972

<212> DNA

<213> barley (Hordeum vulgare L.)

<400> 1

atgtccgcgc tgagagcacc ttgtgcgacg gccatcctgg tcgccgtcct ggcggcggcc 60

gcggtggagc tggccatggc gcagcagtgc ggctcgcagg ccggcggcgc caagtgcgcc 120

gactgcatgt gctgcagcca gttcgggttc tgcggcagca cctccgccta ctgcggcggc 180

ggctgccaga gccagtgcag cggctgcggc ggcgccggcg gcggggtggc gtccatcgtt 240

tcccgcgacc tcttcgagcg gttcctcctc catcgcaacg acgcggcgtg cctggcccgc 300

gggttctaca cctacgacgc cttcttggcc gccgccagcg cgttcccggc cttcggtacc 360

acgggggact tggacacccg gaagcgggag gtggccgcct tcttcggcca gacttcccac 420

gagaccaccg gcggctggcc taccgcgccc gacggcccct tctcgtgggg ctactgcttc 480

aagcaggagc ggggctcgcc gccgagctac tgcgaccaga gcgccgactg gccgtgcgcg 540

cccggcaagc agtactatgg ccgcggcccc atccagctca cccacaacta caactacgga 600

ccggcggggc gggcgatcgg ggtggacctg ctgaacaacc cggacctggt ggcgtcggac 660

ccgacggtgg cgttcaagac ggcgatttgg ttctggatga cgacgcagtc caacaagccg 720

tcgtgccacg acgtgatcac ggggttgtgg aggccgacgg ccagggacag cgcggccgga 780

cgggtacccg gatacggcgt gatcaccaac gtcatcaatg gcgggatcga atgcggcaag 840

gggcagaacg acaaggtggc cgaccggatc gggttctaca agcgctactg tgacatcttc 900

ggcatcggct acgggaataa cctcgactgc tacaaccaat tgtcgttcaa catcgggctc 960

gcggtgcagt ga 972

<210> 2

<211> 323

<212> PRT

<213> barley (Hordeum vulgare L.)

<400> 2

Met Ser Ala Leu Arg Ala Pro Cys Ala Thr Ala Ile Leu Val Ala Val

1 5 10 15

Leu Ala Ala Ala Ala Val Glu Leu Ala Met Ala Gln Gln Cys Gly Ser

20 25 30

Gln Ala Gly Gly Ala Lys Cys Ala Asn Cys Met Cys Cys Ser Gln Phe

35 40 45

Gly Phe Cys Gly Ser Thr Ser Ala Tyr Cys Gly Gly Gly Cys Gln Ser

50 55 60

Gln Cys Ser Gly Cys Gly Gly Ala Gly Gly Gly Val Ala Ser Ile Val

65 70 75 80

Ser Arg Asp Leu Phe Glu Arg Phe Leu Leu His Arg Asn Asp Ala Ala

85 90 95

Cys Leu Ala Arg Gly Phe Tyr Thr Tyr Asp Ala Phe Leu Ala Ala Ala

100 105 110

Gly Ala Phe Pro Ala Phe Gly Thr Thr Gly Asp Leu Asp Thr Arg Lys

115 120 125

Arg Glu Val Ala Ala Phe Phe Gly Gln Thr Ser His Glu Thr Thr Gly

130 135 140

Gly Trp Pro Thr Ala Pro Asp Gly Pro Phe Ser Trp Gly Tyr Cys Phe

145 150 155 160

Lys Gln Glu Arg Gly Ser Pro Pro Ser Tyr Cys Asp Gln Ser Ala Asp

165 170 175

Trp Pro Cys Ala Pro Gly Lys Gln Tyr Tyr Gly Arg Gly Pro Ile Gln

180 185 190

Leu Thr His Asn Tyr Asn Tyr Gly Pro Ala Gly Arg Ala Ile Gly Val

195 200 205

Asp Leu Leu Xaa Asn Pro Asp Leu Val Ala Ser Asp Pro Thr Val Ala

210 215 220

Phe Lys Thr Ala Ile Trp Phe Trp Met Thr Thr Gln Ser Asn Lys Pro

225 230 235 240

Ser Cys His Asp Val Ile Thr Gly Leu Trp Arg Pro Thr Ala Arg Asp

245 250 255

Ser Ala Ala Gly Arg Val Pro Gly Tyr Gly Val Ile Thr Asn Val Ile

260 265 270

Asn Gly Gly Ile Glu Cys Gly Lys Gly Gln Asn Asp Lys Val Ala Asp

275 280 285

Arg Ile Gly Phe Tyr Lys Arg Tyr Cys Asp Ile Phe Gly Ile Gly Tyr

290 295 300

Gly Asn Asn Leu Asp Cys Tyr Asn Gln Leu Ser Phe Asn Ile Gly Leu

305 310 315 320

Ala Val Gln

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgtccgcgc tgagagcacc ttg 23

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ctgcaccgcg agcccgatg 19

<210> 5

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggggacaagt ttgtacaaaa aagcaggcta tgtccgcgct gagagcac 48

<210> 6

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ggggaccact ttgtacaaga aagctgggtt cactgcaccg cgagcc 46

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gcatatgcag cagctatatg tg 22

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ccaaaagcca acagagagaa 20

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gctgacacca tcaccagag 19

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

aagcatgaag atacagggag tgtg 24

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

aaatttattc tcggaagagg ttgtaca 27

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

catccagctc acccacaaat 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

atccagaacc aaatcgccgt 20

Claims

1. The application of the barley HvChit34 gene in regulating and controlling the cadmium stress tolerance of barley is characterized in that the overexpression of the barley HvChit34 gene enhances the cadmium tolerance of plants and reduces the cadmium absorption of the plants, and the nucleotide sequence of a CDS region of the barley HvChit34 gene is shown as SEQ ID NO. 1.

2. The application of claim 1, wherein the application comprises: inserting the barley HvChit34 gene into an over-expression vector to construct a recombinant plasmid, then introducing a target gene fragment into a receptor barley by using an agrobacterium-mediated technology, and screening to obtain a transgenic plant obtained functionally.

3. The use according to claim 2, wherein the overexpression vector is pBract214.

4. The use according to claim 2, wherein the agrobacterium-mediated genetic transformation material is barley young embryo.

5. The use according to claim 2, wherein the recipient barley is of the golden type.