CN111154783A - Application of maize ZmAKIN β gamma 1 gene in breeding lead stress resistant maize - Google Patents
Application of maize ZmAKIN β gamma 1 gene in breeding lead stress resistant maize Download PDFInfo
- Publication number
- CN111154783A CN111154783A CN202010046197.8A CN202010046197A CN111154783A CN 111154783 A CN111154783 A CN 111154783A CN 202010046197 A CN202010046197 A CN 202010046197A CN 111154783 A CN111154783 A CN 111154783A
- Authority
- CN
- China
- Prior art keywords
- zmakin
- gene
- maize
- gamma
- corn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01037—Protein kinase (2.7.1.37)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of a corn ZmAKIN β gamma 1 gene in cultivating lead stress-resistant corn, determines the relation between the corn ZmAKIN β gamma 1 gene and the corn lead stress resistance, can up-regulate the expression of the corn ZmAKIN β gamma 1 gene by constructing an overexpression vector of the corn ZmAKIN β gamma 1 gene and transfecting corn embryos by using agrobacterium, thereby effectively improving the lead resistance of the corn, and has wide application prospect in the field of heavy metal pollution resistance of plants, particularly in the field of lead toxicity resistance of the corn, and has huge economic benefit potential.
Description
Technical Field
The invention relates to application of a corn ZmAKIN β gamma 1 gene in cultivating lead stress resistant corn, belonging to the field of molecular biology.
Background
The method is characterized in that a plurality of plant stress resistance genes are selected from the group consisting of maize, protein kinase.
Protein Kinases (PKs) are mainly involved in protein phosphorylation, which transfers the phosphate group on Adenosine Triphosphate (ATP) to the amino acid residues (typically serine, threonine, and tyrosine residues) of inactive protein molecules, making them biologically functional, reversible phosphorylation is an essential process in biological metabolism, including calcium-dependent protein kinase (CDPK), Receptor Protein Kinase (RPK), and transcriptional regulatory protein kinase, which all act as signal transmission after plants are stressed in the adverse environment, among which CDPK-like protein kinases are most extensively studied, which are mainly induced by external stimuli on cell membranes and change environmental signals into intracellular signals through membrane recognition, reception, and transformation, generally, protein kinases are induced to express abiotic stress in plants, for example, two calcium-dependent protein kinases, tcca 1 and tcca kinase, among others, snca kinase, which express resistance to intracellular signals in corn plants, snca kinase-dependent protein kinase, and expression of snca kinase, which is known to be able to restore the phenotype of corn plants under stress, maize 67 β, snca-dependent protein kinase, snca-like, and c α -protein kinase, which are known to be capable of restoring the phenotype of plant growth of plants under stress.
Disclosure of Invention
The invention overcomes the defects of the prior art, provides the application of the maize ZmAKIN β gamma 1 gene in the cultivation of lead stress-resistant maize, determines the relation between the maize ZmAKIN β gamma 1 gene and the maize lead stress resistance, and verifies the importance of the gene in the cultivation of lead stress-resistant plants.
Application of maize ZmAKIN β gamma 1 gene in breeding lead stress resistant maize.
Furthermore, the sequence of the maize ZmAKIN β gamma 1 gene in the application is shown as SEQ ID NO.1, and the amino acid sequence thereof is shown as SEQ ID NO. 2.
A method of breeding lead stress tolerant maize comprising up-regulating the expression of the maize ZmAKIN β γ 1 gene.
Further, the expression of the up-regulated corn ZmAKIN β gamma 1 gene in the method is that an over-expression vector of ZmAKIN β gamma 1 in corn is constructed, corn immature embryos are infected through an agrobacterium-mediated genetic transformation method, the corn ZmAKIN β gamma 1 gene is transformed into the corn immature embryos, and the corn immature embryos are selfed for three generations to obtain homozygous positive transformation plants, namely the lead-resistant corn plants.
Furthermore, the over-expression vector of ZmAKIN β gamma 1 in corn in the method is constructed by utilizing CUB vector skeleton, Ubi as promoter, NOS as terminator and bar as selection marker gene, selecting BamH I site and adopting homologous recombination method
Has the advantages that:
the relation between the corn ZmAKIN β gamma 1 gene and the lead stress resistance of the corn is clarified for the first time, the importance of the gene in the lead resistance application of the corn is verified, a theoretical basis and a utilization value are provided for improving the stress resistance by utilizing the application of the gene in the corn and other plants, the corn ZmAKIN β gamma 1 gene has wide application prospect in the field of heavy metal pollution resistance of the plants, particularly in the field of lead toxicity resistance of the corn, and the economic benefit potential is huge.
Drawings
FIG. 1 shows the expression trend of ZmAKIN β gamma 1 gene after the corn is stressed by lead.
Figure 2 genome-wide association analysis significant sites.
FIG. 3 growth of Arabidopsis mutants versus Columbia wild-type under lead stress.
FIG. 4 Columbia wild type and mutant under normal conditions (control) and 0.15g/L Pb (NO) respectively3)2Root length comparison under stress.
FIG. 5 interference vector map of ZmAKIN β γ 1.
FIG. 6 is a graph showing the detection of ZmAKIN β. gamma.1 gene expression.
FIG. 7 shows the expression level of ZmAKIN β gamma 1 gene in ZmAKIN β gamma 1 transgenic over-expressed plants and ZmAKIN β gamma 1 gene RNA interference plants.
FIG. 8 phenotype of transgenic maize after lead stress.
Detailed Description
In order to make the technical solutions in the present application better understood, the present invention is further described below with reference to examples, which are only a part of examples of the present application, but not all examples, and the present invention is not limited by the following examples.
Example 1 analysis of expression Pattern of maize ZmAKIN β Gamma 1 Gene under lead stress
1-1, lead stress treatment of maize inbred line material
The seeds of the full corn backbone inbred line 178 were selected and sterilized with 75% ethanol for 1min with 10% H2O2Soaking the solution for 15min and continuously shaking the solution during disinfection, and then rinsing the solution for 3-5 times by using deionized water until residual H is removed2O2Rinsing, soaking in deionized water for 4 hr, and germinating at 28 deg.C in dark with filter paper. After about 2-3 days, the germinated corns are transferred to a floating plate, cultured by Hoagland nutrient solution under the conditions of light (16 h)/dark (8h) at the temperature of 28 ℃ for water culture, the culture solution is changed twice a week, and the stress treatment is carried out when the seedlings grow to the three-leaf stage.
1-2, lead stress treatment:
selecting 30 seedlings with consistent growth vigor, removing endosperm, and transferring into a plastic container filled with nutrient solution. The experiment set up 2 treatments: normal water supply group (i.e. complete nutrient solution, CK) and lead stress treatment group (i.e. complete nutrient solution +3mmol/L Pb (NO)3)2T), preparing 12 seedlings in each group, adjusting the pH of the nutrient solution to about 6.0 before use, treating the root tissues of the corn at 12h, 24h and 48h respectively at 0h in two groups, extracting RNA, sampling 3 plants each time, and detecting the concentration and quality of the RNA, wherein the two groups are used for gene digital expression profile analysis, as shown in figure 1, 0h represents the corn seedlings without being stressed by lead, and 12h, 24h and 48h respectively represent the treatment time.
1-3 extraction of corn total RNA
The samples taken in 2-3 were subjected to extraction of total RNA with reference to the Trizol kit (Invitrogen Co.) operating manual. The method comprises the following specific steps: (1) cooling the grinder with liquid nitrogen: quickly putting the weighed materials into a mortar and quickly grinding until the materials are ground into superfine powder; (2) adding Trizol into a mortar according to the dosage of 1ml per 0.1 g of material; (3) after 20 minutes, the mortar is disassembled and continuously ground until Trizol in the mortar is transparent, and the Trizol is subpackaged into 2ml centrifuge tubes; (4) adding 300 μ l of chloroform into the centrifuge tube, reversing for 1 minute, mixing thoroughly, standing for 5 minutes, centrifuging for 15min (4 ℃, 12000rpm), and carefully sucking the supernatant into another 2ml centrifuge tube; (5) repeating the step 4, adding chloroform and the subsequent steps, sucking the supernatant again and transferring the supernatant into another 1.5ml centrifuge tube; (6) after the supernatant was aspirated again, total RNA was extracted using Trizol partner of beijing tianenz gene technology ltd. (7) After the RNA precipitate is dried, adding a proper amount of DEPC treatment water to dissolve.
Example 2 Whole genome Association analysis identified candidate genes.
The results of genome-wide association analysis using 312 maize inbred lines, the processing method and the phenotypic identification are 1-2, and 56110 SNP genotype data are combined are shown in FIG. 2, wherein the position marked by the figure is the ZmAKIN β γ 1 gene.
4 SNP sites (PUT-163a-60399874-3004, SYN7988, SYN7984 and PZE-101256211 which are respectively positioned on chromosome 1 298967209bp, 298967713bp, 298969383bp, 299548320bp and Maize B73 RefGen _ v3) are detected on chromosome 1 and are obviously related to root surface area, root dry weight, secondary root length, above-ground dry weight, biomass, total root length and the like, wherein, the result of the correlation analysis is shown in Table 1, ZmAKIN β gamma 1(299461477-299469668bp) gene falls in LD (500kb) segments of the four SNPs, and the importance of the gene in the corn lead stress process is further verified.
Table 1 genome-wide association analysis of SNP sites and associated traits associated with ZmAKIN β γ 1
Example 3. analysis of lead resistance of Arabidopsis thaliana homologous Gene mutant plants
Arabidopsis thaliana homologous gene SALK _074210 was ordered in the TAIR Arabidopsis thaliana mutant pool, where in FIGS. 3 and 4 it is denoted as mutant, which is a T-DNA insertion mutant, in which ZmAKIN β. gamma.1 is functionally disabled in Arabidopsis thaliana.firstly the mutant and Columbia wild type seeds were disinfected with 75% absolute ethanol for 1min, then 1% NaClO for 15min, finally washed 3-5 times with sterile water and seeded on 1/2MS medium for 7 days, then the wild type seeds were cultured on 1/2MS medium, and thenTransplanting the type plant and the mutant plant to 0g/L and 0.15g/L Pb (NO), respectively3)2The plant growth was observed 10 days after the continuous culture in 1/2MS medium, and the results are shown in FIGS. 3 and 4, in which the right panels in FIG. 3 show the growth vigor of Columbia wild type and Arabidopsis mutant under normal conditions, respectively (Arabidopsis on the left of the right panels shows the mutant, Arabidopsis on the right of the right panels shows the wild type), and in FIG. 3, the left panels show the growth vigor of Columbia wild type and Arabidopsis mutant under normal conditions, respectively, at 0.15g/L Pb (NO: 0 g/L) of Columbia wild type and Arabidopsis mutant, respectively (NO: 0.15g3)2Growth under stress (left arabidopsis on the left of the left panel is mutant and right arabidopsis is wild type). Under normal conditions, the growth of mutant plants is not much different from that of wild plants, and under the lead stress condition, the lead stress obviously inhibits the growth of plant roots, but the growth of mutants is more obviously inhibited. The average root length of wild plants after being stressed by lead is reduced by 32.5%, while the average root length of mutant plants is reduced by 60%.
Experiments show that the root length of the Columbia wild type under lead stress is obviously higher than that of a mutant plant, and the growth vigor of the overground part is also obviously better than that of the mutant plant, so that the ZmAKIN β gamma 1 gene is proved to be closely related to the lead stress resistance of the plant.
Example 4. overexpression and RNAi lead tolerance analysis of maize plants.
4-1, Gene amplification
The ZmAKIN β gamma 1 gene is amplified by PCR, the nucleotide sequence of the ZmAKIN β gamma 1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.
Wherein the reaction system is shown in Table 2:
TABLE 2PCR amplification System
The reaction procedure is as follows: 30s at 95 ℃; 10s at 98 ℃, 30s at Tm (optimal annealing temperature of primer), 1min at 68 ℃ for 10s, 40 cycles; storing at 68 deg.C for 10min and 4 deg.C. The sequences of the gene PCR primers used are shown in the following table:
TABLE 3PCR primers
4-2, transforming corn RNAi vector, over-expression vector construction and agrobacterium-mediated genetic transformation
The method comprises the steps of utilizing a CUB vector framework, utilizing Ubi as a promoter, utilizing NOS as a terminator and utilizing bar as a selective Marker gene, selecting a BamH I site, and utilizing a homologous recombination method to construct an overexpression vector of ZmAKIN β gamma 1 in corn, and utilizing the CUB vector framework, utilizing BamH I and Smal I double enzyme digestion to construct an interference vector of ZmAKIN β gamma 1, wherein a vector map is shown in figure 5, wherein Target gene in figure 5 is the position of a Target gene and an RNAi fragment, an RNAi sequence fragment is GGATCCGCGACCTAATGCATCACTTAGTTCAAGAGACTAAGTGATGCATTAGGTCGCTTTTTCCCGGG (SEQ ID NO.5), the constructed overexpression and interference vector are respectively transformed into an A105 agrobacterium competent cell, a corn C01 immature embryo is infected by utilizing an agrobacterium-mediated genetic transformation method, and is cultured to obtain T0 generation ZmAKIN β gamma 1, the corn is selfed for three generations, a homozygous positive transformed plant is obtained, wherein a positive detection picture is shown in figure 6, wherein M in figure 6 represents 2000bp of Marker negative bands, and bar represents a left control band and a left control band represents a control band for detection.
The positive detection reaction system comprises the following components:
TABLE 4PCR amplification System
The reaction procedure is as follows: 30s at 95 ℃; 95 ℃ for 15s, Tm (optimal annealing temperature for primers) for 30s, 60 ℃ for 40s, 38 cycles; preserving at 72 deg.C for 10min and 4 deg.C. The sequences of the gene PCR primers used are shown in the following table:
TABLE 5PCR primers
4-3 analysis of lead resistance
The expression level of ZmAKIN β gamma 1 gene is obviously lower than that of wild type in normal conditions, no matter the leaf or root system of RNAi corn plant is, the expression level of ZmAKIN β gamma 1 gene is obviously lower than that of wild type, the over-expressed plant is, no matter the leaf or root system is, the expression level of ZmAKIN β gamma 1 gene is obviously higher than that of wild type, the phenotype identification result is shown in figure 8, the left to the left in figure 8 are respectively untransformed corn seedlings under control conditions, the corn seedlings over-expressing ZmAKIN β gamma 1 gene and the RNA interference of ZKIN β gamma 1 gene to the growth condition of the corn seedlings, the right to the right are respectively untransformed corn seedlings under lead stress conditions, the over-expressing ZmAKIN β gamma 1 gene and the growth inhibition of wild type leaf gene to the growth of wild type, the leaf is more closely interfered by ZmAKIN gene, the leaf expression of ZmAKIN 861 gene is more closely inhibited after the leaf development of wild type.
While the invention has been described in detail in the foregoing by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that certain modifications and improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
SEQUENCE LISTING
<110> Sichuan university of agriculture
Application of <120> corn ZmAKIN β gamma 1 gene in cultivation of lead stress resistant corn
<130>2020
<160>9
<170>PatentIn version 3.3
<210>1
<211>1494
<212>DNA
<213> sequence
<400>1
atgttctcgc acggcgctga ttccgcccac gacgccggga ccgttggcgt cagcagcggc 60
gtcggggcca ccgtccccgc ccgcttcgtc tggccctacg gtgggaagag ggtcttcgtc 120
tcaggctcct tcaccaggtg gtcggaacat ttgccgatgt ctcctgtcga aggctgcccc 180
actgtatttc aggctatttg cagcctgtct ccagggattc atgagtacaa gttctatgtg 240
gacggggagt ggcgtcatga tgagcgccaa cctactatat ctggggagtt cggcatagtt 300
aacacactat acttgacaag ggaatttaat caaataaacg ccttattaaa tccaagcaca 360
cctggaagca ggatgaacat ggatgtggat aatgaaaatt ttcaacatac ggttacattg 420
tcggatggta ccattccaga aggtactgtg agagtttcag aggctgcaat acaaatctca 480
aggtgccgcg tttctgagta tctcaatttg catacatgct atgatttact cccggattcg 540
ggcaaggtta ttgctctgga cattaattta cctgtgaagc aatcttttca tattctgcat 600
gaacagggga ttcctgtagc tcctctctgg gactcattca gaggtcaatt tgtcggcctt 660
ctgagcccat tggatttcat acttatattg cgggagctag aaactcatgg ctcgaacttg 720
acagaagatc agcttgaaac acacactata tctgcatgga aagaggctaa gcggcaaact 780
tgtggaagaa atgatggtca gtggcgagca catcagcatc tagtgcatgc caccccttat 840
gagtccttga gggacattgc agtaaagctt ttgcaaaatg acatttctac agtgccagtt 900
atttattcat catcatcaga tggatcattc cctcagttat tgcaccttgc atccctttct 960
ggaattttga aatgtatttt taggtatttt aaaaactcaa ctggtaattt gcctattctg 1020
aaccaaccgg tgtgctccat tccgctgggt tcctgggttc cgaaaatcgg tgatccaaac 1080
agtcgtccat tggctatgtt gcgacctaat gcatcactta gctctgccct taacatgttg 1140
gttcaagctg gagtgagctc aataccaatt gtggatgaaa acgactccct gcttgacact 1200
tactctagaa gtgacatcac agccctagct aaagacaagg tctacacaca tgttcgcctg 1260
gatgagatga ccattcatca ggctttacag cttggacaag atgccaatac gccttttggt 1320
ttttttaacg gtcagagatg ccagatgtgc ctccggtctg atcctttgct gaaggtgatg 1380
gagcgactgg ctaatccggg ggtgcggcgg gtgttcatag tagaagctgg gagcaaacgt 1440
gtggagggta ttatatcact gagtgatatt ttcaagttct tgctgagctt gtga 1494
<210>2
<211>497
<212>PRT
<213> sequence
<400>2
Met Phe Ser His Gly Ala Asp Ser Ala His Asp Ala Gly Thr Val Gly
1 5 10 15
Val Ser Ser Gly Val Gly Ala Thr Val Pro Ala Arg Phe Val Trp Pro
20 25 30
Tyr Gly Gly Lys Arg Val Phe Val Ser Gly Ser Phe Thr Arg Trp Ser
35 40 45
Glu His Leu Pro Met Ser Pro Val Glu Gly Cys Pro Thr Val Phe Gln
50 55 60
Ala Ile Cys Ser Leu Ser Pro Gly Ile His Glu Tyr Lys Phe Tyr Val
65 70 75 80
Asp Gly Glu Trp Arg His Asp Glu Arg Gln Pro Thr Ile Ser Gly Glu
85 90 95
Phe Gly Ile Val Asn Thr Leu Tyr Leu Thr Arg Glu Phe Asn Gln Ile
100 105 110
Asn Ala Leu Leu Asn Pro Ser Thr Pro Gly Ser Arg Met Asn Met Asp
115 120 125
Val Asp Asn Glu Asn Phe Gln His Thr Val Thr Leu Ser Asp Gly Thr
130 135 140
Ile Pro Glu Gly Thr Val Arg Val Ser Glu Ala Ala Ile Gln Ile Ser
145 150 155 160
Arg Cys Arg Val Ser Glu Tyr Leu Asn Leu His Thr Cys Tyr Asp Leu
165 170 175
Leu Pro Asp Ser Gly Lys Val Ile Ala Leu Asp Ile Asn Leu Pro Val
180 185 190
Lys Gln Ser Phe His Ile Leu His Glu Gln Gly Ile Pro Val Ala Pro
195 200 205
Leu Trp Asp Ser Phe Arg Gly Gln Phe Val Gly Leu Leu Ser Pro Leu
210 215 220
Asp Phe Ile Leu Ile Leu Arg Glu Leu Glu Thr His Gly Ser Asn Leu
225 230 235 240
Thr Glu Asp Gln Leu Glu Thr His Thr Ile Ser Ala Trp Lys Glu Ala
245 250 255
Lys Arg Gln Thr Cys Gly Arg Asn Asp Gly Gln Trp Arg Ala His Gln
260 265 270
His Leu Val His Ala Thr Pro Tyr Glu Ser Leu Arg Asp Ile Ala Val
275 280 285
Lys Leu Leu Gln Asn Asp Ile Ser Thr Val Pro Val Ile Tyr Ser Ser
290 295 300
Ser Ser Asp Gly Ser Phe Pro Gln Leu Leu His Leu Ala Ser Leu Ser
305 310 315 320
Gly Ile Leu Lys Cys Ile Phe Arg Tyr Phe Lys Asn Ser Thr Gly Asn
325 330 335
Leu Pro Ile Leu Asn Gln Pro Val Cys Ser Ile Pro Leu Gly Ser Trp
340 345 350
Val Pro Lys Ile Gly Asp Pro Asn Ser Arg Pro Leu Ala Met Leu Arg
355 360 365
Pro Asn Ala Ser Leu Ser Ser Ala Leu Asn Met Leu Val Gln Ala Gly
370 375 380
Val Ser Ser Ile Pro Ile Val Asp Glu Asn Asp Ser Leu Leu Asp Thr
385 390 395 400
Tyr Ser Arg Ser Asp Ile Thr Ala Leu Ala Lys Asp Lys Val Tyr Thr
405 410 415
His Val Arg Leu Asp Glu Met Thr Ile His Gln Ala Leu Gln Leu Gly
420 425 430
Gln Asp Ala Asn Thr Pro Phe Gly Phe Phe Asn Gly Gln Arg Cys Gln
435 440 445
Met Cys Leu Arg Ser Asp Pro Leu Leu Lys Val Met Glu Arg Leu Ala
450 455 460
Asn Pro Gly Val Arg Arg Val Phe Ile Val Glu Ala Gly Ser Lys Arg
465 470 475 480
Val Glu Gly Ile Ile Ser Leu Ser Asp Ile Phe Lys Phe Leu Leu Ser
485 490 495
Leu
<210>3
<211>21
<212>DNA
<213> Artificial sequence
<400>3
atgttctcgc acggcgctga t 21
<210>4
<211>19
<212>DNA
<213> Artificial sequence
<400>4
tcacaagctc agcaagaac 19
<210>5
<211>68
<212>DNA
<213> Artificial sequence
<400>5
ggatccgcga cctaatgcat cacttagttc aagagactaa gtgatgcatt aggtcgcttt 60
ttcccggg 68
<210>6
<211>18
<212>DNA
<213> Artificial sequence
<400>6
gccctgcctt catacgct 18
<210>7
<211>18
<212>DNA
<213> Artificial sequence
<400>7
gcaaatgttc cgaccacc 18
<210>8
<211>22
<212>DNA
<213> Artificial sequence
<400>8
ggctttacac tttatgcttc cg 22
<210>9
<211>24
<212>DNA
<213> Artificial sequence
<400>9
gccttcatac gctatttatt tgct 24
Claims (6)
1. Application of maize ZmAKIN β gamma 1 gene in breeding lead stress resistant maize.
2. The use of claim 1, wherein the maize ZmAKIN β γ 1 gene has the sequence shown in SEQ id No. 1.
3. The use of claim 1, wherein the amino acid sequence of the maize ZmAKIN β γ 1 gene is set forth in SEQ ID No. 2.
4. A method for cultivating lead stress-resistant corn is characterized in that the expression of ZmAKIN β gamma 1 gene of the corn is up-regulated.
5. The method as claimed in claim 4, wherein the expression of the up-regulated maize ZmAKIN β gamma 1 gene is that an over-expression vector of ZmAKIN β gamma 1 in maize is constructed, the constructed over-expression vector is infected to maize immature embryos through agrobacterium-competent cells, the maize ZmAKIN β gamma 1 gene is transformed to maize immature embryos and selfed for three generations to obtain homozygous positive transformed plants, namely lead-resistant maize plants.
6. The method of claim 5, wherein the ZmAKIN β γ 1 overexpression vector in maize is constructed by homologous recombination using CUB vector backbone, Ubi as promoter, NOS as terminator and bar as selectable marker genes, selecting a BamHI site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010046197.8A CN111154783B (en) | 2020-01-16 | 2020-01-16 | Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010046197.8A CN111154783B (en) | 2020-01-16 | 2020-01-16 | Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111154783A true CN111154783A (en) | 2020-05-15 |
| CN111154783B CN111154783B (en) | 2021-06-04 |
Family
ID=70563341
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010046197.8A Active CN111154783B (en) | 2020-01-16 | 2020-01-16 | Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111154783B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2540831A2 (en) * | 2006-08-17 | 2013-01-02 | Monsanto Technology, LLC | Transgenic plants with enhanced agronomic traits |
| CN107130019A (en) * | 2017-04-25 | 2017-09-05 | 南京农业大学 | The molecular labeling primer of the thin spike of rice pest resistant gene of Local Rice Race and its application |
| CN107488666A (en) * | 2017-08-15 | 2017-12-19 | 四川农业大学 | Application of the corn ZmbZIP54 genes in the plant for cultivating resistance to Lead sweet |
| CN107488667A (en) * | 2017-08-15 | 2017-12-19 | 四川农业大学 | Application of the corn ZmbZIP107 genes in the plant for cultivating resistance to Lead sweet |
| KR101941645B1 (en) * | 2016-06-23 | 2019-04-11 | 재단법인 임실치즈앤식품연구소 | Lactic acid bacteria strains derived from human body with excellent resistance to environmental stress and Method for producing yogurt using it |
-
2020
- 2020-01-16 CN CN202010046197.8A patent/CN111154783B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2540831A2 (en) * | 2006-08-17 | 2013-01-02 | Monsanto Technology, LLC | Transgenic plants with enhanced agronomic traits |
| KR101941645B1 (en) * | 2016-06-23 | 2019-04-11 | 재단법인 임실치즈앤식품연구소 | Lactic acid bacteria strains derived from human body with excellent resistance to environmental stress and Method for producing yogurt using it |
| CN107130019A (en) * | 2017-04-25 | 2017-09-05 | 南京农业大学 | The molecular labeling primer of the thin spike of rice pest resistant gene of Local Rice Race and its application |
| CN107488666A (en) * | 2017-08-15 | 2017-12-19 | 四川农业大学 | Application of the corn ZmbZIP54 genes in the plant for cultivating resistance to Lead sweet |
| CN107488667A (en) * | 2017-08-15 | 2017-12-19 | 四川农业大学 | Application of the corn ZmbZIP107 genes in the plant for cultivating resistance to Lead sweet |
Non-Patent Citations (5)
| Title |
|---|
| LUMBRERAS V 等: "Zea mays AKINbetagamma-1 protein kinase (akin1), mRNA", 《GENBANK DATABASE》 * |
| XIAO-FANG LI 等: "AKINβ1 is Involved in the Regulation of Nitrogen Metabolism and Sugar Signaling in Arabidopsis", 《JOURNAL OF INTEGRATIVE P LANT BIOLOGY》 * |
| YAOU SHEN 等: "Genome expression profile analysis reveals important transcripts in maize roots responding to the stress of heavy metal Pb", 《PHYSIOLOGIA PLANTARUM》 * |
| 张严玲 等: "玉米重金属Pb胁迫响应相关基因表达载体的构建及转化拟南芥功能验证", 《第一届全国玉米生物学学术研讨会论文汇编》 * |
| 赵雄伟 等: "玉米籽粒重金属铅(Pb2+)含量的QTL位", 《遗传》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111154783B (en) | 2021-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113150097B (en) | Plant stress tolerance related protein OsERF096 and encoding gene and application thereof | |
| CN114480431B (en) | Application of corn ZmBES1/BZR1-10 gene in improving drought tolerance and yield of plants | |
| CN113105534B (en) | Application of WRKY55 transcription factor in plant salt resistance | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN109232725B (en) | Soybean C2H2 type single zinc finger protein transcription factor, coding gene and application | |
| CN112125966B (en) | Application of stress-resistance-related protein bHLH85 in regulation and control of plant stress resistance | |
| CN108997487B (en) | Application of stress resistance-related protein Z76 in regulation and control of plant stress resistance | |
| CN110713994B (en) | Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof | |
| CN104628839A (en) | Protein related to development of rice endosperm amyloplast and encoding gene and application of protein | |
| CN104480120A (en) | Plant salt-tolerant related gene PpSIG2 as well as encoding protein and application thereof | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| CN107488666A (en) | Application of the corn ZmbZIP54 genes in the plant for cultivating resistance to Lead sweet | |
| CN112048010A (en) | Application of rice RIP2 protein in regulation and control of plant leaf included angle | |
| CN114773444B (en) | Application of thionin protein gene OsThi9 in plant breeding regulation and control | |
| CN111154783B (en) | Application of maize ZmAKIN beta gamma 1 gene in cultivating lead stress-resistant maize | |
| CN108690127B (en) | Stress-resistance-associated protein TaMYB85 and coding gene and application thereof | |
| CN106432449B (en) | Drought tolerance in plants GAP-associated protein GAP VPS23A and its encoding gene and application | |
| CN113136398B (en) | GsHA24 protein and application of related biological material thereof in regulation and control of stress tolerance of plants | |
| CN104561036A (en) | Plant salt-tolerance related gene PpSIG1 as well as encoding protein and application of gene | |
| CN107488667A (en) | Application of the corn ZmbZIP107 genes in the plant for cultivating resistance to Lead sweet | |
| CN114014922A (en) | Protein for regulating and controlling plant salt tolerance, coding gene and application thereof | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| CN112501181A (en) | Rice stress resistance related gene OsTZF7 and encoding protein and application thereof | |
| CN111718942A (en) | Rice salt tolerance related gene GT3 and application thereof | |
| CN112521467B (en) | Plant stress resistance related gene AGL103, and coding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |