CN110960618A - Preparation method of composition for joint protection - Google Patents

Preparation method of composition for joint protection Download PDF

Info

Publication number
CN110960618A
CN110960618A CN201811160133.XA CN201811160133A CN110960618A CN 110960618 A CN110960618 A CN 110960618A CN 201811160133 A CN201811160133 A CN 201811160133A CN 110960618 A CN110960618 A CN 110960618A
Authority
CN
China
Prior art keywords
composition
radix
water
extracting
volatile oil
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811160133.XA
Other languages
Chinese (zh)
Other versions
CN110960618B (en
Inventor
郑继宇
杨玉
苑鹏翀
李国栋
汪巍
赵立新
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Liaoning Shangyuan Science And Technology Development Co ltd
Original Assignee
Liaoning Shangyuan Science And Technology Development Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Liaoning Shangyuan Science And Technology Development Co ltd filed Critical Liaoning Shangyuan Science And Technology Development Co ltd
Priority to CN201811160133.XA priority Critical patent/CN110960618B/en
Publication of CN110960618A publication Critical patent/CN110960618A/en
Application granted granted Critical
Publication of CN110960618B publication Critical patent/CN110960618B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/71—Ranunculaceae (Buttercup family), e.g. larkspur, hepatica, hydrastis, columbine or goldenseal
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/32—Bones; Osteocytes; Osteoblasts; Tendons; Tenocytes; Teeth; Odontoblasts; Cartilage; Chondrocytes; Synovial membrane
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/11—Pteridophyta or Filicophyta (ferns)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/11—Pteridophyta or Filicophyta (ferns)
    • A61K36/12—Filicopsida or Pteridopsida
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/11—Pteridophyta or Filicophyta (ferns)
    • A61K36/12—Filicopsida or Pteridopsida
    • A61K36/126—Drynaria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/23—Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A61K36/232—Angelica
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/23—Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A61K36/238—Saposhnikovia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/28—Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • A61K36/286—Carthamus (distaff thistle)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/29—Berberidaceae (Barberry family), e.g. barberry, cohosh or mayapple
    • A61K36/296—Epimedium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • A61K36/483—Gleditsia (locust)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/54—Lauraceae (Laurel family), e.g. cinnamon or sassafras
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/65—Paeoniaceae (Peony family), e.g. Chinese peony
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/71—Ranunculaceae (Buttercup family), e.g. larkspur, hepatica, hydrastis, columbine or goldenseal
    • A61K36/714—Aconitum (monkshood)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/71—Ranunculaceae (Buttercup family), e.g. larkspur, hepatica, hydrastis, columbine or goldenseal
    • A61K36/716—Clematis (leather flower)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/80—Scrophulariaceae (Figwort family)
    • A61K36/804—Rehmannia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/896—Liliaceae (Lily family), e.g. daylily, plantain lily, Hyacinth or narcissus
    • A61K36/8964—Anemarrhena
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6949—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes
    • A61K47/6951—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes using cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1629—Organic macromolecular compounds
    • A61K9/1652—Polysaccharides, e.g. alginate, cellulose derivatives; Cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A61K2236/331—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using water, e.g. cold water, infusion, tea, steam distillation or decoction
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/39—Complex extraction schemes, e.g. fractionation or repeated extraction steps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/50—Methods involving additional extraction steps
    • A61K2236/53—Liquid-solid separation, e.g. centrifugation, sedimentation or crystallization

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Pain & Pain Management (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides a preparation method and application of a composition for joint protection, which consists of 5 parts: (1) the composition comprises (1) a composition prepared by micronizing radix paeoniae alba and rhizoma anemarrhenae, (2) a water extraction composition prepared from rehmannia glutinosa, radix rehmanniae preparata, rhizoma drynariae and rhizoma cibotii, (3) a nanoemulsion composition prepared from radix angelicae pubescentis and cassia twig volatile oil, and (4) a clathrate compound of a sheep bone extract, and (5) a water extraction and alcohol precipitation composition prepared from radix paeoniae alba, rhizoma anemarrhenae, radix aconiti lateralis preparata, radix dipsaci, herba epimedii, radix sileris, radix clemati. And homogenizing the sheep bone extract and the water extraction and alcohol precipitation composition by using a high-pressure micro-jet homogenization technology. The water extract component and the superfine powder composition are made into granules, and the other 4 components are fat-soluble and volatile components, and are made into pellets for better uniform dispersion. Finally, granulating the granules and the pellets and tabletting. The test result shows that the composition can not only inhibit the inflammatory symptom of the rat adjuvant arthritis, but also improve the destruction process of joint bones.

Description

Preparation method of composition for joint protection
Technical Field
The invention belongs to the field of preparation of rheumatoid arthritis tablets, and particularly relates to preparation and application of a composition for joint protection.
Background
The sheep bone is bone of goat (Capra hircus L.) or sheep (Ovisaries L.) of cattle, and has effects of warming nature, taste, liver, invigorating kidney, strengthening bone, warming middle-jiao, and relieving diarrhea. Has effects in invigorating kidney and strengthening muscle. Bone contains a large amount of inorganic substances, more than half of which are calcium phosphates. In addition, it contains small amount of calcium carbonate, magnesium phosphate and trace amount of fluorine, chlorine, sodium, potassium, iron, aluminum, etc. The organic substances of bone include collagen, bone-like mucin, elastin-like substance, amino acids and other nutrients. In order to fully exert the kidney tonifying and bone strengthening effects of the sheep bones and fully extract the nutrient substances of the sheep bones, the sheep bones can be extracted by adopting a high-temperature and high-pressure mode, and the fat ingredients of the sheep bones are ground, included and dispersed uniformly.
Both the pubescent angelica root and the cassia twig have the functions of resisting inflammation and easing pain, and one of the effective components is volatile oil. In order to make the volatile oil fully exert the function, the volatile oil can be extracted and then subjected to grinding inclusion treatment, and the volatile oil can be further dispersed into small molecular substances by adopting a high-pressure homogenization technology.
Rhizoma Cibotii and rhizoma Drynariae have effects of nourishing liver and kidney, strengthening tendons and bones, resisting osteoporosis, and resisting inflammation, and experimental study of rhizoma Cibotii for treating kidney-yang deficiency adjuvant arthritis by Wangzhonghai research shows that rhizoma Cibotii water extract has effect of treating arthritis, and research of constructing bone repair material with excellent activity by rhizoma Drynariae for Wangzhai tablet research shows that water extract component of rhizoma Drynariae has effect of repairing bone joint; the water extract of rehmanniae radix and radix rehmanniae Preparata has effects of invigorating kidney, resisting osteoporosis, and resisting inflammation; the four traditional Chinese medicines can be prepared by a water extraction process.
The white peony root and the rhizoma anemarrhenae have the functions of easing pain and resisting inflammation, one half of the prescription dosage is taken by being ground into powder traditionally, and the other half of the prescription dosage is treated by adopting a water extraction and alcohol precipitation process, so that the effects of the white peony root and the rhizoma anemarrhenae are fully exerted.
The aconite root, radix Aconiti lateralis, belonging to the group of interior-warming herbs, can strengthen heart yang to promote blood circulation, warm spleen yang to strengthen the circulation, and tonify kidney yang to tonify fire, is called the first herb of restoring yang from collapse, and has the actions of dispelling wind, eliminating dampness and relieving pain. The main component is mainly alkaloid. The main color component of the radix sileris, namely the chromone component, has the functions of relieving fever, easing pain and resisting inflammation, and literature researches show that the radix sileris extract chromone can obviously inhibit the swelling of mouse ears in an experiment of inflammation caused by ear application of croton oil, and reduce the arthritis integral and incidence rate of rats. Herba Epimedii has effects of nourishing liver and kidney, strengthening tendons and bones, and dispelling pathogenic wind and dampness. In recent years, the icariin, icariside, epimedium total flavone, epimedium polysaccharide and some microelements in the epimedium have the effect of promoting the proliferation and differentiation of bone cells, and the safflower has various physiological activities of resisting inflammation, easing pain, resisting fatigue and the like. The safflower yellow has certain analgesic activity to mouse hot plate method and acetic acid writhing experiment; has obvious inhibiting effect on formaldehyde foot swelling and on the permeation quantity increase of rat skin capillary caused by histamine.
Dipsacus asperoides has effects of nourishing liver and kidney, reuniting bones and muscles, and regulating blood vessels. One of the main effective components is saponin, and has pharmacological effects of enhancing immunity, resisting aging, resisting osteoporosis, etc. Radix Clematidis has effects of dispelling pathogenic wind and removing dampness, dredging channels and collaterals, and relieving pain. The effective components include anemonin, anemonolactone, sterol, etc. According to modern researches, the spina gleditsiae is mainly composed of triterpenoids, saponins, flavones, phenolic acids, echinocystic acid glucoside, coumarins and other chemical components, has the effects of inhibiting bacteria, resisting viruses, improving immunity, resisting oxidation, tumors and blood coagulation, inhibiting thrombosis, inhibiting proliferation of vein endothelial cells and the like, and also has effects on heart and cerebral vessels. Herba Lycopodii has effects of dispelling pathogenic wind, removing dampness, relieving rigidity of muscles and activating collaterals. Mainly contains alkaloid and triterpenes, and is commonly used for treating diseases such as flexion and extension difficulty, rheumatism, traumatic injury and the like, and modern researches show that the traditional Chinese medicine composition has the effects of resisting inflammation, relieving pain, treating rheumatoid arthritis and the like. The effective components of the medicinal materials are all fat-soluble components, and can be extracted by water extraction and alcohol precipitation.
Pharmacological and pharmacodynamic studies prove that the composition inhibits the degradation of IkB protein, reduces the generation of p-IkK α/β, p-p65 and p-STAT3, inhibits the over-activation of an NF-kB signal channel and a JAK-STAT3 signal channel of an adjuvant arthritis rat, further inhibits the expression levels of serum factors TNF- α and synovial membrane IL-1 β and proinflammatory IL-6, plays the roles of easing pain, resisting inflammation and relieving joint swelling, and inhibits the synovial membrane hyperplasia of joints, thereby playing the roles of protecting bone joints and preventing and treating arthritis (pharmacological mechanism)
TCM believes that the kidneys govern bones and produce marrow and advocate to tonify the body. The composition contains Os Caprae Seu Ovis containing ossein, bone-like mucin, elastin, neutral fat, phospholipid and small amount of glycogen; and contains a large amount of inorganic substances, more than half of which are calcium phosphate, small amounts of calcium carbonate and magnesium phosphate, and trace amounts of fluorine, chlorine, sodium, potassium, iron, aluminum, and the like. The contents of calcium and phosphorus are far higher than those of other foods, and the nutrient components are easier to digest and absorb by human bodies. Has the functions of tonifying kidney, strengthening bones and muscles, treating spasm and pain of bones and muscles and protecting joints. (effect of decoction)
The Sheep Bone Collagen Peptide (SBCP) can reduce osteoclast activity, reduce collagen decomposition, inhibit bone absorption, stimulate the up-regulation of osteoblast activity, accelerate bone regeneration, and promote bone growth. The physiological activity of SBCP is similar to that of osteogenic growth peptide, is a matrix cell mitogen, can stimulate bone formation and hematopoiesis in vivo, can stimulate the proliferation of bone forming cells and up-regulate the activity of alkaline phosphatase (ALP) in vitro, and can obviously accelerate bone formation and increase the volume of bone trabeculae by exogenously administering the active peptide. (enzymatic hydrolysis).
Disclosure of Invention
The invention provides a preparation method and application of a composition for joint protection, aiming at better exerting the effects of all medicinal materials in a prescription and fully extracting pharmacodynamic components. Consists of 5 parts which are respectively:
(1) the white paeony root and the rhizoma anemarrhenae have certain viscosity, the composition which is subjected to superfine grinding can fully retain the active ingredients and can replace excipients, and the superfine grinding can fully ensure the dissolution of the active ingredients;
(2) the active ingredients of the rehmannia root, the prepared rehmannia root, the rhizoma drynariae and the rhizoma cibotii are water-soluble ingredients, so that the water extraction is adopted;
(3) the pubescent angelica root and the cassia twig contain a large amount of volatile oil effective components, and loss in the preparation process can be reduced by extracting volatile oil inclusion;
(4) the sheep bone extract contains oil-type active ingredients and has certain taste, so the cyclodextrin inclusion process is adopted to play roles in helping dissolution and masking taste;
(5) radix Paeoniae alba, rhizoma anemarrhenae, radix Aconiti lateralis Preparata, radix Dipsaci, herba Epimedii, radix Saposhnikoviae, radix Clematidis, spina Gleditsiae, herba Lycopodii and Carthami flos by water extraction and ethanol precipitation.
The high-pressure microjet homogenization technology is applied to homogenize the sheep bone extract and the water extraction and alcohol precipitation composition, so that the components can be fully dispersed and dissolved. The water extraction component and the superfine powder composition are granulated into granules by one step, and the rest 4 components are fat-soluble and volatile components, so that the components are well and uniformly dispersed and are prepared into pellets. Finally, granulating the granules and the pellets and tabletting. Thus, the composition for joint protection is prepared.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method of preparing a composition for joint protection comprising:
micronizing radix Paeoniae alba and rhizoma anemarrhenae, mixing, and marking as superfine powder composition;
extracting rehmanniae radix, radix rehmanniae Preparata, rhizoma Drynariae and rhizoma Cibotii with water respectively, and mixing the obtained water extracts uniformly to obtain composition I;
respectively extracting volatile oil of radix Angelicae Pubescentis and ramulus Cinnamomi, clathrating, and making into nanoemulsion, and recording as composition II;
crushing sheep bones into small sections, extracting at high temperature and high pressure, filtering, centrifuging, concentrating, and preparing into nanoemulsion which is marked as a composition III;
extracting radix Paeoniae alba, rhizoma anemarrhenae, radix Aconiti lateralis Preparata, radix Dipsaci, herba Epimedii, radix Saposhnikoviae, radix Clematidis, spina Gleditsiae, herba Lycopodii and Carthami flos with water, precipitating with ethanol, mixing, and making into nanoemulsion as composition IV;
mixing the composition I and the superfine powder composition, granulating and preparing into granules;
making the compositions II, III and IV into micro-pills;
and finally, granulating the granules and the pellets and tabletting to obtain the pellet tablet.
Preferably, the ultrafine grinding is carried out by adopting a vibrating ultrafine grinder for grinding for 0.5-1.5 h.
Preferably, the specific method for extracting the volatile oil of the radix angelicae pubescentis and the cassia twig comprises the following steps: extracting radix Angelicae Pubescentis and ramulus Cinnamomi with 6 times of water for 4-6 hr, collecting volatile oil, filtering the rest medicinal liquid, and concentrating.
Preferably, the inclusion method comprises the steps of taking purified water, β -cyclodextrin (β -cyclodextrin: volatile oil 10:1), uniformly stirring in a container, pouring into a colloid mill, adding the volatile oil in a grinding state, allowing inclusion for 30-60 minutes, collecting condensed water, controlling inclusion temperature to be 30-40 ℃, and keeping the inclusion compound for later use.
Preferably, the sheep bone extraction conditions are 0.10MPa of pressure, 2 hours of time and 2 times of water, and the extraction temperature is 110 ℃.
Preferably, the conditions for decocting the rehmannia root, the prepared rehmannia root, the rhizoma drynariae and the rhizoma cibotii in water are as follows: decocting for 2 times, 6-8 times and 1-2 hours.
Preferably, the specific conditions of water extraction and alcohol precipitation are as follows: extracting the medicinal materials with water, and concentrating into water decoction: adjusting pH to 5, homogenizing for 4 times at 600bar in a high-pressure homogenizer, adding 3 times of ethanol, stirring, standing overnight, collecting supernatant, recovering ethanol, and concentrating to obtain extract.
It is a further object of the present invention to provide a composition prepared by any of the above methods.
The invention also provides a Wangbi tablet which is prepared by tabletting the composition.
The invention also provides a Wangbi capsule which is prepared by adding 1 part of dextrin and 1 part of starch into the composition, uniformly mixing, granulating, drying and subpackaging into capsules.
The invention has the advantages of
(1) The composition of the application can not only inhibit inflammatory symptoms of rat adjuvant arthritis, but also improve the destruction process of joint bones.
(2) The preparation method is simple, high in extraction efficiency, strong in practicability and easy to popularize.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the application and, together with the description, serve to explain the application and are not intended to limit the application.
Figure 1 articular inflammation score of rats of the dosing group;
FIG. 2 paw volume score of rat hind paw;
FIG. 3 is a cytographic representation of synovial tissue and lining layer of rat joints.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
Example 1
First, the source of the raw materials
The traditional Chinese medicines are all commercial products, and meet the quality standards of the traditional Chinese medicines specified by the state.
Secondly, pretreatment of raw materials
Preparation of the ultrafine powder composition: taking half amount of radix Paeoniae alba and radix Angelicae sinensis in the prescription, pulverizing into coarse powder with a pulverizer, and pulverizing the coarse powder with a vibration type ultramicro pulverizer to obtain ultramicro powder. The superfine pulverized medicinal materials can improve the absorptivity of the medicinal materials, so that the medicinal materials of the white paeony root and the Chinese angelica can fully play a role.
Preparing a volatile oil inclusion nanoemulsion component:
1) extracting volatile oil: is prepared from pubescent angelica root and cinnamon twig through extracting in steam for 4-6 hr, collecting volatile oil and collecting the rest liquid medicine.
2) The volatile oil inclusion nanometer component is prepared by grinding volatile oil, purified water and appropriate amount of β -cyclodextrin with colloid mill for inclusion, and processing the volatile oil inclusion compound with a disperser and a high-pressure microfluidizer to obtain the volatile oil inclusion nanometer emulsion composition.
Preparation of sheep bone extraction:
crushing Os Caprae Seu Ovis into small segments, extracting at high temperature under high pressure, filtering, centrifuging, and concentrating. The method can sufficiently extract sheep ossein, and the sheep ossein has high protein content and is rich in various amino acids, calcium and other nutrients.
Water extraction composition:
decocting rehmanniae radix, radix rehmanniae Preparata, rhizoma Drynariae, and rhizoma Cibotii in water, filtering, and concentrating to obtain water extract concentrate. Mixing the concentrated water extract with the rest medicinal liquid to obtain the final product.
Water extraction and alcohol precipitation composition:
extracting the rest radix Paeoniae alba, the rest rhizoma anemarrhenae, radix Dipsaci, radix Aconiti lateralis Preparata, herba Epimedii, radix Clematidis, spina Gleditsiae, herba Lycopodii, and Carthami flos with water to obtain concentrated solution, and precipitating with ethanol. The main effective components of the medicinal materials are fat-soluble components, and the extraction rate of the components can be improved by carrying out alcohol precipitation.
Third, the mixing method of the composition
The preparation of the composition: the composition is a nano dispersion composition, and the nano emulsion dispersion composition with a certain curative effect on rheumatoid osteoarthritis is prepared by uniformly mixing the compositions according to a certain proportion and treating the mixture by using a dispersion machine and a high-pressure micro-jet homogenizer.
Fourthly, preparation technology of the composition
4.1 preparation of the micronized composition:
the method comprises the following steps of firstly, crushing white paeony root and common anemarrhena rhizome by a crusher to obtain common traditional Chinese medicine powder; and secondly, dividing the common powder into 3 parts, crushing the common powder for 0.5h, 1h and 1.5h by using a vibration type ultrafine crusher, measuring the particle size distribution of the common powder by using a Mastersizer 2000 laser diffraction method particle size analyzer, repeatedly measuring the particle size distribution for 3 times, and counting the average values of D50 (median particle size) and D90 (90% particle size value) of the ultrafine powder obtained in different crushing time. The results are shown in Table 1.
TABLE 1
Grinding time/h D50 D90
0.5 28.554 130.113
1 22.006 100.223
1.5 7.221 21.015
As can be seen from Table 1, D in the case of ultrafine pulverization of 0.5, 150，D90The mean value is not changed greatly, the powder belongs to the category of fine powder, when the powder is subjected to superfine grinding for 1.5h, the particle size is obviously reduced, and the powder meets the particle size requirement of superfine powder. Thus preparingThe method comprises the following steps: pulverizing radix Paeoniae alba and rhizoma anemarrhenae with a pulverizer, and pulverizing with a vibration type ultramicro pulverizer for 1.5 hr.
4.2 preparation of volatile oil inclusion nanoemulsion composition
4.2.1 preparation of essential oils
Extracting radix Angelicae Pubescentis and ramulus Cinnamomi with 6 times of water for 4-6 hr, collecting volatile oil, filtering the rest medicinal liquid, and concentrating.
4.2.2 preparation of inclusion of volatile oils
Mixing purified water and β -cyclodextrin (β cyclodextrin: volatile oil 10:1) in a container, stirring, grinding in a colloid mill, adding volatile oil under grinding for 30-60 min, adding condensed water, controlling inclusion temperature at 30-40 deg.C, and making into clathrate.
4.2.3 preparation of volatile oil inclusion nanoemulsion
Processing the volatile oil inclusion compound by a dispersing machine to prepare primary emulsion; homogenizing the primary emulsion with a high-pressure microfluidizer to obtain the volatile oil inclusion nanoemulsion.
4.3 preparation of sheep bone extract:
crushing sheep bone into small segments, extracting at high temperature under high pressure with 2 times of water under 0.10MPa for 2 hr, filtering, centrifuging, and concentrating to obtain concentrated sheep bone extract. The concentrated sheep bone extract liquid has a grease layer and cannot be uniformly distributed with an aqueous solution, so a high-pressure micro-jet homogenizer is adopted for homogenization treatment.
Investigation of high-pressure microjet homogeneity conditions
The pressure and the number of homogenization times are considered, and the particle size is considered as an index, and the optimum conditions are preferred. The results are given in the table below.
Figure BDA0001819839620000071
And (4) conclusion: the particle size is used as an index, the differences of experiments 5, 6 and 7 are small, the preparation method is considered to be capable of carrying out one-step high-pressure homogenization treatment when final mixing is carried out, and the production cost and the particle size are considered, the experiment 5 is selected, namely, after the high-pressure microjet homogenizer is started, feeding is carried out, the pressure is set to be 800bar, and homogenization is carried out for 4 times to obtain the product.
4.4 preparation of an aqueous extract composition
Decocting rehmanniae radix, radix rehmanniae Preparata, rhizoma Drynariae and rhizoma Cibotii in water for 2 times, 8 times, 2 hr, 6 times and 1 hr
Filtering, mixing filtrates, and concentrating to obtain water extract concentrate. Mixing the water extract concentrate with the rest concentrated solution of the above volatile oil to obtain water extract composition.
4.5 preparation of Water extraction alcohol precipitation composition
Decocting the rest radix Paeoniae alba, the rest rhizoma anemarrhenae, radix Dipsaci, radix Aconiti lateralis Preparata, herba Epimedii, radix Saposhnikoviae, radix Clematidis, spina Gleditsiae, herba Lycopodii, and Carthami flos with water twice (8 times and 6 times respectively) for 1.5 hr each time (Carthami flos is added before the second extraction), mixing filtrates after two extractions, concentrating to obtain medicinal material, and performing alcohol precipitation. In order to fully extract fat-soluble components in the water solution, the water extract is subjected to homogenization treatment before alcohol precipitation so as to ensure that the water extract solution is uniformly distributed, and the components are fully extracted after alcohol precipitation
The research finds that the benzoylmesaconine, benzoylaconine, benzoylhypaconitine, icariin, paeoniflorin, cimicifugaside and 5-o-methylvisammioside in the composition have the effects of protecting bone joints, resisting inflammation and promoting proliferation and differentiation of bone cells. Adopting an orthogonal test, taking the contents of benzoylmesaconine, benzoylaconitine, benzoylhypaconitine, icariin, paeoniflorin, cimicifugaside and 5-o-methylvisammol as indexes to investigate 3 factors of the pH value of a water extract, the high-pressure homogenization pressure of a water extract and the homogenization times, determining the process conditions of extracting a concentrated solution by water before alcohol precipitation, continuously adding 3 ethanol for stirring in each parallel experiment, standing overnight, recovering the ethanol to obtain a concentrated solution, and determining the index content.
Factor level meter
Figure BDA0001819839620000072
Figure BDA0001819839620000081
TABLE 2 results of orthogonal experiments
Figure BDA0001819839620000082
Note: the total yield (mg/g) of the components is equal to the total mg of each component in the alcohol precipitation concentrated solution/the crude drug amount g of the water extraction medicine of the composition
TABLE 3 ANOVA TABLE
Sources of variance Sum of squared deviations Degree of freedom Mean square F value Significance of
A 0.349 2 38.778 19.000 *
B 0.037 2 4.111 19.000
C 0.158 2 17.556 19.000
Error of the measurement 0.01 2
Note: f0.05＝19.000,*P<0.05
The experimental results, see tables 2 and 3, show that the difference analysis results of the formula show that the factor A (pH value) has significant difference (P <0.05), the influence sequence of the factor is A > C > B, and in consideration of the experimental results, energy conservation and the requirement of convenient actual production, the pH value is selected to be 5, the homogenization pressure is 600bar, the homogenization is carried out for 4 times, so the optimal extraction process is as follows: A2B2C2, aqueous extract concentrate, pH 5, homogenization pressure 600bar, and homogenization times 4.
Optimized water extraction and alcohol precipitation process for composition
Extracting the medicinal materials with water, and concentrating into water decoction: adjusting pH to 5, homogenizing for 4 times at 600bar in a high-pressure homogenizer, adding 3 times of ethanol, stirring, standing overnight, collecting supernatant, recovering ethanol, and concentrating to obtain extract. Fifth, application
5.1 tablets
Taking the water extract composition and the superfine powder component as base powder, granulating with a one-step granulator, drying the other components, making into pellet, granulating, tabletting, and coating.
Detailed examples (to be supplemented)
5.2 capsules
Taking the composition, adding 1 part of dextrin and 1 part of starch, uniformly mixing, granulating, drying, and subpackaging in capsules to obtain the capsule.
Sixthly, research on pharmacological and pharmacodynamic effects
The composition has effect in inhibiting adjuvant arthritis of rat
Rheumatoid arthritis generally occurs in middle-aged and elderly people, and has the following main characteristics clinically: the inflammatory response is systemic, antibody hyperactivation, high frequency onset of synovitis, and bone destruction in the joints. In RA patients the network of proinflammatory factors and anti-inflammatory factors is out of balance and excessive proinflammatory factor increase is a direct factor leading to the disease. The key cellular pathways capable of regulating cytokine secretion among many signaling pathways are the NF- κ B signaling pathway and the JAK-STAT3 signaling pathway, while overexpression and production of pro-inflammatory cytokines trigger a series of signal transduction, including the production of matrix metalloproteinases, degrading connective tissue surrounding the joint, ultimately causing damage to tissue surrounding the large and small joints and joint destruction.
In the experiment, Raw264.7 macrophages and AA rat models are utilized to respectively compare and research the anti-RA effect and the molecular action mechanism of the composition. The experimental result shows that the composition can inhibit the inflammatory symptom of rat adjuvant arthritis and improve the destruction process of joint bones.
6.1 Experimental methods
6.1.1 method for formulating drugs
The preparation method of the composition comprises the following steps: mixing the superfine pulverized component, volatile oil inclusion nanoemulsion component, water extraction component and water extraction and alcohol precipitation component, uniformly mixing the crude drug components of each part in a ratio of 1:3:5:8, dispersing the mixture by a disperser to prepare colostrum, then homogenizing the colostrum for 6 times at 600bar by a high-pressure microfluidizer to obtain the final product.
6.1.2 adjuvant arthritis
A high-quality 0.1mg/ml suspension of Mycobacterium tuberculosis is freshly prepared, an appropriate amount of BD Difco inactivated Mycobacterium tuberculosis M.tuboculos H37Ra (231141) and an appropriate volume of Mineral oil (Sigma M8410) are weighed into a sterile glass mortar and ground in the same direction until a water-in-oil paste is formed. 0.1ml of a suspension of Mycobacterium tuberculosis containing 62.5. mu.g of Mycobacterium tuberculosis was injected subcutaneously into the root of the tail. On the day of molding, 0.5% CMC-Na solvent (Mod, n-7) was administered by intragastric administration, the composition was administered in clinically equivalent dose (0.56g/kg/d, WBL, n-7), positive Control medicament rheumatoid arthritis tablets (0.56g/kg/d, WB, n-7), blank Control group (Control, n-8) was provided, and administration was continued for 30 days.
6.1.3. Severity evaluation index of arthritis
6.1.3.1 arthritic score
The rats are scored for arthritis once every 3 days by recording symptoms from the day of disease attack of the rats, no obvious symptom is observed to be 0 point, only one part of inflammation on each of the front paw and the rear paw is 1 point, 2 or more parts of inflammation on the paw are 2 points, moderate inflammation on the whole paw is 3 points, inflammation on the whole rear paw and even joint deformity stiffness cause dyskinesia are 4 points, and the highest inflammation index score is 16 points. The volume below the hind limb ankle joint was measured using a capacitance meter.
6.1.3.2 examination by imaging
Rat paw was evaluated imagewise using a small animal CT imaging system on the double-blind principle according to metatarsophalangeal joint, phalangeal joint bone destruction: 0min, no radiological change; 1 point, soft tissue swelling, mild bone loss and narrow joint space; 2 points, early overt pathological changes occurred, including: severe soft tissue swelling, bone erosion, with or without joint space narrowing; 3 points, moderate bone and joint destruction; 4 points, severe bone and joint destruction, significant bone loss, with or without periosteal hyperplasia; in 5 minutes, several serious injuries can be seen, the joints are seriously damaged, and meanwhile, the obvious periosteum hyperplasia is accompanied.
6.1.3.3H & E staining
On the day of experiment completion, all rats were anesthetized with 10% chloral hydrate. The left hind paw of all rats was soaked in 4% formalin. The joint used for H & E staining was the second metatarsophalangeal joint of the third toe. After the necessary pretreatment for decalcification, the specimen was sliced into 6 to 7. mu.M sections by a microtome and then subjected to H & E staining. The semi-quantitative analysis of the degree of joint inflammation and bone destruction was performed under the double-blind guiding principle from several aspects: (1) infiltration of inflammatory cells: score 0 indicates insignificant, score 1 indicates minimal to mild (not included), score 2 indicates mild to moderate (not included) inflammatory cell infiltration, score 3 indicates moderate to severe (not included) inflammatory cell infiltration, score 4 indicates very severe; (2) synovial hyperplasia: score 0 indicates no significant synovial hyperplasia, score 1 indicates minimal to minimal (exclusive) synovial hyperplasia, score 2 indicates mild to moderate (exclusive) synovial hyperplasia, score 3 indicates moderate to severe (exclusive) synovial hyperplasia, and score 4 indicates very severe synovial hyperplasia; (3) degree of cartilage destruction: score 0 indicates no significant cartilage destruction, score 1 indicates little to mild (exclusive) cartilage destruction, score 2 indicates mild to moderate (exclusive) cartilage destruction, score 3 indicates moderate to severe (exclusive) bone erosion, and score 4 indicates very severe bone erosion; the degree of joint inflammation and bone destruction scored up to 16 points for each rat.
6.1.4 Fluorescent quantitative polymerase chain reaction (qPCR)
In the case of rat paw, after sacrifice, the right hind paw of all rats was cut into two parts A and B and stored at-80 ℃. On the day of the experiment, the rat paw A was placed in a clean glass mortar and put in liquid nitrogen and ground to rapidly extract total RNA, using a reverse transcription kit from Takara corporation, cDNA was rapidly synthesized to maintain stability, and then RT-PCR was performed according to the instructions.
6.1.4.1 extraction of RNA
(1) Rat paw tissue was used as an example, and the rat paw tissue was ground thoroughly and appropriate amount of TRIzol solution was added.
(2) 200 μ L of chloroform was added.
(3) After centrifugation, the transparent aqueous phase in the upper layer of the original EP tube was aspirated into a new EP tube using a 200. mu.L pipette, which was almost 400. mu.L-500. mu.L.
(4) Add 500. mu.L of isopropanol and precipitate.
(5) Centrifuging and removing supernatant. Mixing with 75% ethanol, and washing the precipitate.
(6) And slightly absorbing 75% ethanol on the upper layer by using a 200 mu L pipette gun, standing at room temperature, and air-drying for 5-10 minutes, wherein the water can not be obviously seen by naked eyes.
(7) Adding appropriate amount of DEPC water, beating with finger to help dissolve completely
(8) 2 mu of LRNA sample is read at 260nm and 280nm to detect the RNA concentration, and the RNA concentration is optimally 200-500 ng/ml.
6.1.4.2 reverse transcription of cDNA
The reverse transcription kit produced by Takara corporation and the gene reaction in which reverse transcription was carried out in a 20. mu.L reaction system using a PCR instrument were used in the experiment. Reaction conditions are as follows: 15min at 37 ℃; 5 seconds at 85 ℃; at 4 deg.C and infinity
Figure BDA0001819839620000111
Figure BDA0001819839620000121
6.1.4.3 Real-Time PCR
(1) Primers were designed using Pubmed Primer Blast and synthesized by huajin biotechnology limited, shanghai.
Primer sequences (5 '-3') Primer name
ATGGGCTCCCTCTCATCAGT (Rat)TNF-α(F)
GCTTGGTGGTTTGCTACGAC (Rat)TNF-α(R)
ATGAACAGCGATGATGCACT (Rat)IL-6(F)
ACAAACTCCAGGTAGAAACGG (Rat)IL-6(R)
GAGCTTCAGGAAGGCAGTGT (Rat)IL-1β(F)
TCACACACTAGCAGGTCGTC (Rat)IL-1β(R)
ATCTATGAGGGTTACGCGCTCC (Rat)β-actin(F)
CAGCTGTGGTGGTGAAGCTG (Rat)β-actin(R)
(2) Reaction systems were prepared according to the ratios used in the following table with reference to the instructions of Thermo Scientific SYBR Green qPCR, and the reactions were performed in 96-well plates. The conditions set for the reaction were: step 1: at 95 ℃ for 10 min; step 2: 95 ℃ for 15 s; 60 ℃ for 60 s; 40 cycles are repeated.
2×SYBR Green qPCR 5μL
Forward Primer10nM 0.5μL
Reverse Primer10nM 0.5μL
cDNA 1μL
ddH2O 3μL
(3) Result processing and analysis
As the reaction is extended, the DNA product in the later stage increases exponentially and the fluorescence level rises, so that the initial cDNA template can be quantitatively analyzed at a certain point in the exponential stage of the DNA. Specifically, a fluorescence threshold value of the exponential phase of DNA is first defined, and the number of cycles that the reaction has undergone at that time point after the threshold value is exceeded is defined as the Ct value. Therefore, by detecting the ratio of the target gene to the reference gene, the content of the target gene in the sample can be relatively quantified.
—△△Ct＝△CtExperimental group—△CtControl group
Wherein △ Ct ═ CtTarget gene-CtInternal reference gene
Calculation 2-△△CtThat is, the expression ratio of the target gene in the experimental group to the target gene in the control group.
6.1.5 Western blot analysis
(1) Homogenizing: after sacrifice, the right hind paw of all rats was cut into two parts A and B and stored at-80 ℃. On the day of the experiment, rat paw A was placed in a clean glass mortar and a sufficient amount of tissue protein lysate was added rapidly to perform rapid trituration (50mM Tris-HCl, pH 7.4,0.1M NaCl, 0.1% Triton X-100,1tablet/10mL complete EDTA-free protease inhibitor cocktail) and samples were vortexed once every 5 minutes during the whole lysis process to ensure that tissue protein was in full contact with the lysate and lysed on ice for 30 min.
(2) Centrifuging at 12000g for 2min at 4 ℃;
(3) taking a small amount of supernatant for quantification: protein quantification by BCA method and preparation of sample 5XSDS PAGE
Blank group: 5 μ L lysis solution +200 μ L working solution +20 μ L
Experimental groups: 5 μ L of sample +200 μ L of working solution +20 μ L
(4) The protein samples were adjusted to the desired Volume and Concentration using 5 × LB (loading buffer), vortexed and the proteins were boiled in boiling water for 5 min.
(5) During loading, loading electrophoresis channels on two sides of a sample by using 3 mu L of 5 XLB, and then adding 3 mu L of marker for molecular weight marking;
(6) the voltage intensity when the concentrated gel needs to use 90V in the process of running the gel on the sample is that constant voltage electrophoresis is carried out for 30min, the voltage of the separated gel is increased to 110V for electrophoresis, and the time is subject to the condition required by the separation of the actual sample.
(7) And when the target protein is electrophoresed to the lower edge of the colloid more than 1cm, closing the switch of the electrophoresis machine.
(8) Film transfer: the length of the NC film is the length of the sampling hole plus the length of marker, and a notch is cut at the upper left corner to be used as a mark;
(9) the conventional electrotransformation liquid formula comprises: tris 6.0g, Gly 28.8g, M-OH 400ml, add deionized water to 2000 ml;
(10) pressing the white surface with a green electrophoresis clamp, and placing a sponge pad and a piece of filter paper on the black surface at one time; holding two wide edges of the glass plate by the left hand, inserting the green rubber cutting plate between the short glass plate and the rubber, slowly and gently separating the short glass plate from the rubber, and sticking the rubber and the long plate together; adjusting to keep the molecular weight range of 30-200KD, cutting the corner at the upper left, adding the membrane-rotating liquid for wetting, placing on filter paper, and placing the cut membrane on the gel to remove the air bubbles. Film transfer: firstly, washing an electric rotary tank with distilled water for several times, then adding 1000ml of prepared rotary membrane liquid, putting crushed ice around the electrophoresis tank, and keeping constant current at 250mA for 70 min;
(12) sealing with 5% skimmed milk powder sealing solution, rinsing with TBST solution for 5 min/three times, slowly shaking NC membrane, and sealing for one hour;
(13) incubating the primary antibody: selecting corresponding primary antibody reagent according to the protein to be detected, taking out the membrane in the sealing solution when the traditional Chinese medicine is sealed and the air bubbles do not exist, washing the membrane with TBST for four times in total, and incubating the primary antibody overnight.
(14) Washing the membrane: incubate primary antibody, rinse membrane with TBST, 5 min/three times
(15) And (3) secondary antibody incubation: selecting a secondary antibody corresponding to the primary antibody, diluting according to the proportion written by an instruction, putting the strip into the secondary antibody, and incubating for 1h at 25-35 ℃;
(16) washing the membrane: incubate the secondary antibody, rinse the membrane with TBST, 5 min/three times
(17) And (3) developing: the membrane was soaked in 2ml of a developing solution for a suitable time and developed by ECL method using a Las4000Imager (GE healthcare).
6.1.6 data analysis
All data for this experiment are presented as Mean (Mean) ± Standard Error (SEM). T-test analysis was performed between the two sets of data and comparison of the sets of data was performed using one-way anova, where p <0.05 indicates statistical differences.
6.2 test results
6.2.1. Adjuvant arthritis
As shown in fig. 1 and 2, SD rats injected with complete freund's adjuvant tail root developed different degrees of morbidity around day 12, manifested by red swelling or erythema of the paw, with a 100% morbidity. The joint inflammation of the rats given the composition and the rheumatoid arthritis tablets was significantly reduced, as shown in that the joint inflammation score (shown in figure 1) of the rats in the administration group and the paw volume score (shown in figure 2) of the hind paws of the rats were both significantly lower than those in the model group, and the composition group was superior to the rheumatoid arthritis tablet group.
6.2.2 AA rat metatarsophalangeal Joint pathology
The synovial tissue in the joint is composed of the lining layer near the joint cavity and the cells at the lower layer, wherein the synovial tissue around the joint is very orderly arranged under the normal health condition, pannus is not generated, inflammatory cells are not infiltrated, and the whole joint surface is smooth and complete. After the onset of AA in rats, not only synovial tissue and lining layer cells of joints are obviously thickened but also are not regularly arranged, a plurality of small blood vessels are formed at the bottom of the synovial tissue and finally pannus is generated, and the erosion of cartilage by the synovial tissue can be observed by slicing. Compared with the model group and the positive control drug group, the pathological injury of the rats given with the composition is obviously improved, and compared with the model group, the scores of the rats in the aspects of synovial tissue hyperplasia, inflammatory cell infiltration and bone destruction are statistically different, so that the composition can improve the pathological change of AA joints. (as shown in FIG. 3)
6.2.3 AA rat Small animal CT imaging examination
Rats were sacrificed 30 days after administration using anesthetic 10% chloral hydrate and were CT examined for the left hind paw, and model group rats exhibited severe bone resorption and joint destruction in the paw. The bone loss and joint injury of two groups of rats of the composition are obviously improved, and the CT score of the administration group is obviously reduced compared with that of the model group.
6.2.4 AA mouse paw inflammatory cytokines
After 30 days of administration, the rats were sacrificed, all the right hind paws of the rats were cut into two parts A and B, and total ribonucleic acid of part A was extracted, and this experiment was performed by RT-PCR using the procedure of the manual of TAKARA kit, and as a result, mRNA expression levels of inflammatory factors TNF- α, IL-1 β and IL-6 were significantly increased in the tissues of model group rat paw, and mRNA expression levels of these proinflammatory cytokines were significantly decreased in the tissues of rat paw of the composition group.
6.2.5 the effect of the composition on activation of paw inflammation signal pathway in AA rat
In order to further research the molecular pharmacological mechanism of the composition for treating the rat AA model, the total protein of the rat right hind paw B part is extracted, and the expression level of key proteins in NF-kB and JAK-STAT3 signal pathways is detected by adopting an immune protein imprinting method. The results showed that the administration groups inhibited the overactivation of NF-. kappa.B signaling pathway and JAK-STAT3 signaling pathway to different degrees.
The test result shows that the composition can not only inhibit the inflammatory symptoms of the adjuvant arthritis of rats, but also improve the destruction process of joint bones, and has obvious difference compared with a positive control drug group.
The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims (10)

1. A method of preparing a composition for joint protection, comprising:
micronizing radix Paeoniae alba and rhizoma anemarrhenae, mixing, and marking as superfine powder composition;
extracting rehmanniae radix, radix rehmanniae Preparata, rhizoma Drynariae and rhizoma Cibotii with water respectively, and mixing the obtained water extracts uniformly to obtain composition I;
respectively extracting volatile oil of radix Angelicae Pubescentis and ramulus Cinnamomi, clathrating, and making into nanoemulsion, and recording as composition II;
crushing sheep bones into small sections, extracting at high temperature and high pressure, filtering, centrifuging, concentrating, and preparing into nanoemulsion which is marked as a composition III;
extracting radix Paeoniae alba, rhizoma anemarrhenae, radix Aconiti lateralis Preparata, radix Dipsaci, herba Epimedii, radix Saposhnikoviae, radix Clematidis, spina Gleditsiae, herba Lycopodii and Carthami flos with water, precipitating with ethanol, mixing, and making into nanoemulsion as composition IV;
mixing the composition I and the superfine powder composition, granulating and preparing into granules;
making the compositions II, III and IV into micro-pills;
and finally, granulating the granules and the pellets and tabletting to obtain the pellet tablet.
2. The method according to claim 1, wherein the micronization is carried out by a vibratory micronizer for a time of 0.5 to 1.5 hours.
3. The method of claim 1, wherein the specific method for extracting the volatile oil of the radix angelicae pubescentis and the cassia twig comprises the following steps: extracting radix Angelicae Pubescentis and ramulus Cinnamomi with 6 times of water for 4-6 hr, collecting volatile oil, filtering the rest medicinal liquid, and concentrating.
4. The method of claim 1, wherein the inclusion is carried out by mixing purified water and β -cyclodextrin (β cyclodextrin: volatile oil 10:1) in a container, stirring, pouring into a colloid mill, adding volatile oil under grinding for 30-60 min, collecting condensate, controlling inclusion temperature at 30-40 deg.C, and keeping the inclusion at rest.
5. The method of claim 1, wherein the sheep bone extraction conditions are a pressure of 0.10MPa, a time of 2 hours, 2 times water, and an extraction temperature of 110 ℃.
6. The method of claim 1, wherein the rehmannia glutinosa, drynaria rhizome and rhizoma cibotii are decocted in water under the conditions: decocting for 2 times, 6-8 times and 1-2 hours.
7. The method of claim 1, wherein the specific conditions of the water extraction and alcohol precipitation are as follows: extracting the medicinal materials with water, and concentrating into water decoction: adjusting pH to 5, homogenizing for 4 times at 600bar in a high-pressure homogenizer, adding 3 times of ethanol, stirring, standing overnight, collecting supernatant, recovering ethanol, and concentrating to obtain extract.
8. A composition prepared by the method of any one of claims 1-7.
9. A rheumatoid arthritis tablet prepared by compressing the composition of claim 8.
10. A Wanbi capsule, characterized in that Wanbi capsule is prepared by adding 1 part of dextrin and 1 part of starch into the composition of claim 8, mixing, granulating, drying, and subpackaging in capsules.
CN201811160133.XA 2018-09-30 2018-09-30 Preparation method of composition for joint protection Active CN110960618B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811160133.XA CN110960618B (en) 2018-09-30 2018-09-30 Preparation method of composition for joint protection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811160133.XA CN110960618B (en) 2018-09-30 2018-09-30 Preparation method of composition for joint protection

Publications (2)

Publication Number Publication Date
CN110960618A true CN110960618A (en) 2020-04-07
CN110960618B CN110960618B (en) 2021-11-16

Family

ID=70028996

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811160133.XA Active CN110960618B (en) 2018-09-30 2018-09-30 Preparation method of composition for joint protection

Country Status (1)

Country Link
CN (1) CN110960618B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1686206A (en) * 2005-04-19 2005-10-26 河北万岁药业有限公司 Painful impediment capsule and its preparation method
CN1970030A (en) * 2005-05-19 2007-05-30 辽宁华源本溪三药有限公司 Chinese medicine for treating rheumatoid arthritis, preparation method and application thereof
CN101033481A (en) * 2007-04-05 2007-09-12 庞小战 Preparing process of extracting bone collagen from pig, cattle and sheep bone

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1686206A (en) * 2005-04-19 2005-10-26 河北万岁药业有限公司 Painful impediment capsule and its preparation method
CN1970030A (en) * 2005-05-19 2007-05-30 辽宁华源本溪三药有限公司 Chinese medicine for treating rheumatoid arthritis, preparation method and application thereof
CN101033481A (en) * 2007-04-05 2007-09-12 庞小战 Preparing process of extracting bone collagen from pig, cattle and sheep bone

Also Published As

Publication number Publication date
CN110960618B (en) 2021-11-16

Similar Documents

Publication Publication Date Title
CN101429254B (en) Bletilla striata polysaccharide, preparation method and new uses thereof
WO2009097512A1 (en) Herbal pharmaceutical compositions to treat inflammation and inflammation associated conditions and diseases
WO2018058261A1 (en) Traditional chinese medicine composition for treating psoriasis and preparation method thereof
CN102058673B (en) Chinese medicine composition for expelling wind and removing dampness and preparation method thereof
CN115337356A (en) Pharmaceutical composition for treating rheumatoid arthritis and preparation method thereof
WO2014201637A1 (en) Compound preparation for treating cervical spondylosis with radiculopathy and preparation method therefor
CN112656877A (en) Pharmaceutical composition for treating cervical disc herniation and preparation method and application thereof
CN110960618B (en) Preparation method of composition for joint protection
KR101193540B1 (en) Composition comprising the extract of Astragalus membranaceus BGE.,Cinnamomum cassia and Phellodendron amurensis for preventing and treating of osteoporesis and bone disease
CN104524247B (en) One treats migrainous medical composition and its use
CN108159204B (en) Tibetan medicine composition with detoxifying and liver protecting effects
CN102048841A (en) Lactogenic traditional Chinese medicine composition and preparation method thereof
CN106237181A (en) A kind of Chinese medicine composition treating rheumatoid arthritis and capsule thereof and preparation method
CN103800736B (en) A kind of pharmaceutical composition treating hypertensive nephropathy and application thereof
CN113144020A (en) Traditional Chinese medicine composition for treating arthralgia, preparation method thereof and traditional Chinese medicine preparation
CN105012507A (en) Traditional Chinese medicine composition for treating osteoporosis and preparation method of traditional Chinese medicine composition
CN1927309B (en) Traditional Chinese medicine composition detection method
CN104147274B (en) Treat the psoriasic Chinese medicine composition of stagnated heat of liver channel type
CN103720943B (en) A kind of Chinese medicine for the treatment of gynecological bleeding and preparation method thereof
CN102961708A (en) Pure traditional Chinese medicine compound preparation for treating nephritic syndrome and capsule preparation method thereof
CN106729215A (en) It is a kind of to treat Chinese medicine preparation of osteoarthritis and preparation method thereof
WO2022104712A1 (en) Compound composition having effect of promoting bone health, preparation method therefor and application thereof
CN108310206B (en) Traditional Chinese medicine composition for preventing or treating osteoporosis and preparation method and application thereof
CN105381004A (en) Health product with blood fat reducing effect, and preparation method and use thereof
CN114306496A (en) Pharmaceutical composition and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant