CN110923260B

CN110923260B - Engineering strain for producing rhizomucor miehei lipase powder and application thereof

Info

Publication number: CN110923260B
Application number: CN201811092263.4A
Authority: CN
Inventors: 黄金金; 黄蓉; 马艳; 郑维发
Original assignee: Jiangsu Normal University
Current assignee: Jiangsu Normal University
Priority date: 2018-09-19
Filing date: 2018-09-19
Publication date: 2022-06-03
Anticipated expiration: 2038-09-19
Also published as: CN110923260A

Abstract

A method for constructing an engineering strain for producing Rhizomucor miehei lipase powder is characterized in that a lipase gene pro-rml containing a leader peptide is inserted into a Pichia pastoris expression vector pPICZ alpha + M alpha to construct an expression vector pPICZ alpha + M alpha-2 prorml containing 2 copies of a target gene. Transferring the expression vectors containing 2 copies of the target gene into Pichia pastoris respectively, and screening to obtain the genetically engineered bacteria m alpha-4 pRML-X33 which contain 4 copies of the target gene and can express Pro-RML. A method for preparing Rhizomucor miehei lipase powder adopts a Pichia pastoris strain of 4 copies of lipase gene of over-expression transcription regulatory factor HAC1 to ferment, and the enzyme activity reaches 1078U/mL. And preparing enzyme powder from the fermentation liquor generated by the strain by using acetone. When the pH of the fermentation liquor is adjusted to 4.0, the volume ratio of acetone to the fermentation liquor is 2:1, the weight of enzyme powder obtained from 40mL of the fermentation liquor is 1.0116g, the specific activity of the enzyme powder is 7936.5U/g, and the recovery rate of the enzyme powder is 37.935%. Provides a new way for the storage, transportation and use of the enzyme.

Description

Engineering strain for producing rhizomucor miehei lipase powder and application thereof

Technical Field

The invention relates to the fields of molecular biology and genetic engineering, in particular to an engineering strain for producing rhizomucor miehei lipase powder and application thereof.

Background

Lipases (E C3.1.1.3) are a class of enzymes that can hydrolyze triacylglycerols, catalyzing a variety of chemical reactions such as: hydrolysis, esterification, transesterification, ammonolysis, etc., and has the advantages of mild reaction conditions, strong specificity, no pollution, etc., and is widely applied to the industries of food, medicine, cosmetics, petroleum, etc., which is called as the third industrial enzyme. The enzyme powder is one of the commonly used forms for preserving the enzyme, and has the advantages of convenient preservation, transportation, good stability and the like. Rhizomucor miehei lipase is a1, 3 position specific lipase, and can be used for preparing milk flavor essence, producing biodiesel and other aspects.

Disclosure of Invention

The invention aims to provide an engineering strain for producing rhizomucor miehei lipase powder with high yield and stability and application thereof.

As a first aspect of the invention, a method for constructing an engineering strain for producing Rhizomucor miehei lipase powder is provided, which comprises the steps of,

a1: inserting a lipase gene pro-rml containing a leader peptide into a pichia pastoris expression vector pPICZ alpha + M alpha to construct an expression vector pPICZ alpha + M alpha-2 prorml containing 2 copies of a target gene;

a2: respectively transferring an expression vector pPICZ alpha + M alpha-2 prorml containing 2 copies of target genes into pichia pastoris;

a3: screening Pichia pastoris containing 4 copies of genes and capable of expressing Pro-RML to obtain engineering strains for producing Rhizomucor miehei lipase powder.

As a second aspect of the invention, the engineering strain for producing the Rhizomucor miehei lipase powder prepared by the construction method is provided.

As a third aspect of the present invention, there is provided a method for producing Rhizomucor miehei lipase enzyme powder, comprising the steps of,

b1: culturing the engineering strain;

b2: obtaining fermentation liquor containing rhizomucor miehei lipase through induced expression;

b3: and (3) separating the rhizomucor miehei lipase from the fermentation liquor, and drying to obtain rhizomucor miehei lipase powder.

Preferably, the induction conditions in step B2 are such that the inducer methanol is supplied every 24 hours to a final methanol concentration of 1.0% (v/v).

Preferably, the step B3 specifically includes:

(1) centrifuging the fermentation liquor at 4 ℃ and 5000rpm for 10min, then taking 40 parts by volume of supernatant of the fermentation liquor, adjusting the pH to 4.0, then placing the fermentation liquor in a container, and placing the container in an environment at-20 ℃ until the liquid surface in the container is frozen;

(2) adding 8 parts by volume of acetone precooled at the temperature of-20 ℃ into a container, slowly stirring while adding, and then standing for 10min at the temperature of-20 ℃;

(3) slowly adding 72 parts by volume of acetone precooled at the temperature of-20 ℃ into the container while slowly stirring, and then standing for 2-3h at the temperature of-20 ℃;

(4) centrifuging the mixed solution in the container at 8000rpm and 4 deg.C for 10min, discarding the supernatant, and collecting the precipitate;

(5) adding pre-cooled acetone with the volume 2 times that of the precipitate into the precipitate, stirring and uniformly mixing, and centrifuging for 10min at the temperature of 4 ℃ and the speed of 8000 rpm;

(6) repeating the step (5) once;

(7) and (4) drying the precipitate obtained in the step (6) in the air to obtain rhizomucor miehei lipase powder.

As a fourth aspect of the present invention, there is provided a Rhizomucor miehei lipase enzyme powder produced by the aforementioned method for producing a Rhizomucor miehei lipase enzyme powder.

The invention has the beneficial effects that: the invention obtains a strain which can produce UPR reaction and heterologously expressed lipase by screening engineering strains with high copy number and constructing proper expression vector, and over-expresses HAC1 in the strain to obtain a strain with obviously improved lipase secretion efficiency, most of the expressed lipase is secreted outside cells, the extracellular enzyme activity can reach 1078U/ml and the extracellular secretion efficiency can reach 43U/OD under the condition of shake flask culture and methanol induced culture for 96h₆₀₀Is obviously superior to the prior engineering strain for heterogeneously expressing lipase.

Drawings

FIG. 1 is an electrophoresis diagram of the restriction recovery of target gene DNA, wherein lane 1 shows a standard molecular weight (kb) of DNA: 4.5, 3.0, 2.0, 1.2, 0.8, 0.5, 0.2; the arrow in lane 2 indicates the 1017bp segment recovered by the DNA enzyme digestion of the target gene;

FIG. 2 is a flow chart of the construction of a 2-copy expression plasmid;

FIG. 3 is a diagram of a double-restriction electrophoresis of 2-copy expression plasmid, wherein lane 1 shows a DNA standard molecular weight (kb): 15, 10, 7.5, 5, 2.5, 1, 0.25; lane 2: the result of double enzyme digestion of Bgl II and BamH I on 2 copies of expression plasmid pPICZ alpha + M alpha-2 prorml, the arrow points to the expression frame;

FIG. 4 is a standard curve for copy number determination;

FIG. 5 is a flow chart of the construction of the over-expression HAC1 vector;

FIG. 6 is a graph comparing shake flask fermentation results of strains overexpressing HAC 1.

The specific implementation mode is as follows:

the following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The percent in the present invention means mass percent unless otherwise specified; but the percentage of the solution, unless otherwise specified, means that 100ml of the solution contains several grams of solute; the percentage between the liquids refers to the ratio of the volumes at 20 ℃. The steps of conventional experimental operations such as enzyme digestion, ligation, recovery, transformation, PCR amplification and the like are described in molecular cloning (third edition). Primer synthesis and sequencing was done by english jun (Invitrogen) bio-inc.

The invention clones 1, 3-position specific lipase (Pro-RML) gene Pro-RML containing leader peptide from Rhizomucor miehei strain, the nucleotide sequence is shown as SEQ ID No.1, the total length of the gene is (1017) bp, analysis shows that GC content is (48.9)%, and protein consisting of (339) amino acids is coded. The amino acid sequence of the Rhizomucor miehei lipase coded by the gene is shown in SEQ ID No. 2. The protein has the size of 45-66 kDa, the isoelectric point is predicted to be 4.89(http:// web. expasy. org/computer _ pi /), and the active center is Ser at position 214, His at position 257 and Asp at position 273. Experiments show that the lipase coded by the gene has higher enzyme activity. Through the determination of enzymology properties, the optimum reaction temperature of the enzyme is 35 ℃, the optimum reaction pH value is 6.0, and the enzyme is stable under the condition of pH 5-10. For convenience of description, this lipase was named Pro-RML.

EXAMPLE 1 preparation of Mucor miehei cDNA

1.1 extraction of Total RNA from Mucor miehei

(1) Taking appropriate amount of Rhizomucor miehei mycelium, drying with filter paper, grinding with liquid nitrogen, adding 1ml Trizol reagent (Invitrogen), shaking with oscillator for 5min, and standing at room temperature for 1 min;

(2) adding 0.2ml chloroform, shaking for 15s, and standing for 2 min;

(3)4℃，12000rpm，15min；

(4) sucking supernatant, adding equal volume of isopropanol, and precipitating at-20 deg.C for 30 min;

(5)4℃，12000rpm，15min；

(6) the supernatant was decanted off and the precipitate was washed with 1ml of 75% ethanol at 7500rpm, 4 ℃ for 5 min;

(7) repeating the step (6) once;

(8) pouring off the supernatant, and drying for 10 min;

(9) adding a proper amount of DEPC water to dissolve to obtain total RNA;

1.2 preparation of the first Strand of the cDNA of Mucor miehei

The reverse transcription was specifically performed using reverse transcriptase (MMLV) manufactured by Promega corporation as follows:

a25. mu.l reaction was prepared by adding the following ingredients to a nuclease-free centrifuge tube:

then, the mixture is subjected to warm bath at 42 ℃ for 60 min;

then, the reaction was terminated by heating at 95 ℃ for 5min, and the reaction mixture was stored under refrigeration.

Example 2 primer design of Rhizomucor miehei Lipase Gene pro-rml containing leader peptide

2.1 primer design

Based on the sequence of the rml gene in GenBank (GenBank accession No. A02536.1), the following pair of primers were designed and synthesized:

FW(P1)：5’—CGGAATTCGTGCCAATCAAGAG—3’(SEQ ID No.3)

REV(P2)：5’—TAGTCTAGAGTACAGAGGCCTGTG—3’(SEQ ID No.4)

wherein, EcoR I and Not I restriction sites (underlined parts) are designed at two ends of P1 and P2 respectively.

2.2 PCR amplification of Rhizomucor miehei Lipase pro-rml containing leader peptide

The PCR reaction system is carried out by taking P1 and P2 primers and Rhizomucor miehei (Boel E, Huge-Jensen B, Christensen M, Thim L, Finl N: Rhizomucor miehei trigyceeri lipase synthesized as a previous. lipids 1988, 23(7):701-706.) cDNA as a template:

the reaction conditions are as follows: circulating 30 times at 95 deg.C for 5min, 5 deg.C for 40s, 60 deg.C for 40s, and 72 deg.C for 1min, at 72 deg.C for 10min, and at 4 deg.C for 2 min.

2.3 recovery of the fragment of interest from the PCR reaction product

The target gene fragment is purified and recovered from the PCR product by a gel cutting and column passing method, the PCR reaction product is subjected to agarose gel electrophoresis, the target gene DNA is cut under the irradiation of an ultraviolet lamp, as shown in figure 1, the length of the target gene is 1017bp, and the target gene is recovered according to the method of a DNA recovery kit instruction book (purchased from Tiangen corporation, and the product number is DP 209-02).

2.4 cloning of TA

The PCR-recovered product was ligated to the vector pMD18-T-Simple (purchased from TaKaRa Co.), and the ligation reaction was performed according to the kit (Code No. D104A) provided by TaKaRa Co.

2.5 the target gene is ligated to the Pichia pastoris expression vector pPICZ α + M α.

2.5.12 copy expression plasmid construction

pMD18-T-prorml and pPICZ α + M α were double-digested with restriction enzymes EcoR I and Not I, respectively, and then the fragments of interest were recovered, ligated with T4 ligase, and the ligation product was transformed into E.coli DH5 α (purchased from Shanghai Bioengineering Co., Ltd.). Obtaining the single copy expression plasmid pPICZ alpha + M alpha-prorml. Carrying out double enzyme digestion on BamH I and BglII on the single copy pPICZ alpha + M alpha-prorml to obtain an expression frame containing a prorml fragment; carrying out BamH I single enzyme digestion on pPICZ alpha + M alpha-prorml to obtain a pPICZ alpha + M alpha vector fragment containing single copy prorml; and connecting the expression frame with the vector fragment to obtain a pPICZ alpha + M alpha-2 prorml vector with 2 copies. The expression plasmid pPICZ alpha + M alpha-2 prorml is transferred into Escherichia coli DH5 alpha for amplification and PCR detection, and sent to invitrogen company for sequencing. The construction flow chart is shown in figure 2, and the double-enzyme digestion detection chart is shown in figure 3.

EXAMPLE 32 secretory expression of pPICZ α + M α -2prorml vector from copies electrotransformation into P.pastoris X-33

3.1 preparation of Pichia pastoris X-33 (purchased from Invitrogen) electrotransformation competent cells and electroporation thereof

(1) Picking fresh single colony in 5ml YPD liquid culture medium, culturing at 30 deg.c and 250rpm for 12-14 hr;

(2) inoculating into 2L Erlenmeyer flask containing 500ml YPD medium at 0.1%, and culturing at 30 deg.C and 250rpm for 12-14 hr to make OD₆₀₀＝1.3-1.5；

(3) Centrifuging at 1500rpm at 4 deg.C for 5min, and collecting cells;

(4) the cells were washed twice with 500-250ml of ice-cold sterile water;

(5) wash cells once with 20ml of ice-cold 1M sorbitol solution;

(6) the cells were resuspended in 1ml of ice-chilled 1M sorbitol solution to a final volume of about 1.5ml and dispensed in 80. mu.l portions into small centrifuge tubes.

3.2 electroporation transformation of Pichia pastoris cells

(1) About 10. mu.l of the prepared non-linearized 2-copy expression plasmid of about 100. mu.g/. mu.l is mixed with 80. mu.l of yeast competent cells, and the mixture is left on ice for about 5 minutes;

(2) transferring the DNA-mixed competent cells into ice-precooled 0.2cm electric rotor;

converting at a voltage of 1.5 kilovolts;

(3) then 1ml of ice-pre-cooled 1M sorbitol solution was immediately added to the transformed cells, the cells were mixed well and transferred to a 1.5ml small centrifuge tube and allowed to stand at 30 ℃ for 1-2 h.

(4) 50-200ul of the resulting suspension was spread on YPDS plates (yeast extract 1%, peptone 2%, dextrase 2%, Sorbitol 1M, agar 2%,) containing 100ug/ml, and cultured at 30 ℃ for 2 to 3 days to observe the results.

3.3 selection of recombinant strains containing 4 copies of the pro-rml Gene

3.3.1 identification of correctly integrated transformants by colony PCR

Positive colonies were selected on the plates and further verified to give correctly integrated transformants by the yeast colony PCR method using 5 'AOX 1, 3' AOX1 as primers.

The primer sequence is as follows:

5’AOX1：5′-GACTGGTTCCAATTGACAAGC-3′(SEQ ID No.5)

3’AOX1：5′-GCAAATGGCATTCTGACATCC-3′(SEQ ID No.6)

the template processing method comprises the following steps:

(1) a small amount of colonies were picked up with a sterile pipette tip and dissolved in 50. mu.l of D2-Buffer (1L: guanidinium isothiocyanate 472.64g, 1 mol/L50 ml of pH8.0Tris-HCl Buffer, 7ml of. beta. -mercaptoethanol) and mixed well;

(2) placing the mixed solution in 100 deg.C boiling water bath for 5 min;

(3) centrifuging at 12000rpm for 30s, and discarding the supernatant;

(4) washing the precipitate with sterile water for 2 times;

(5) the precipitate was dissolved in 20. mu.l of ddH₂O, acting at 95 ℃ for 5 min;

(6) and centrifuging to obtain supernatant as the template.

And (3) PCR reaction system:

reaction conditions are as follows: 5min at 95 ℃; 30cycles at 95 ℃ for 40s, 60 ℃ for 40s, 72 ℃ for 1min for 30 s; 10min at 72 ℃.

3.3.2 determination of 4 copies of the Strain by qPCR

The genome of the screened pichia pastoris recombinant is extracted by using a TIANGEN Yeast genome DNA Kit (Cat: DP307-02), the genome of the recombinant containing only one copy of pro-rml is used as a template, glyceraldehyde-3-phosphate dehydrogenase gene (gap) is selected as an internal reference gene, the template is diluted at different concentrations, and Q-PCR detection is carried out, so that standard curves between the log value and the Ct value of the template amount of the target gene pro-rml and the internal reference gene gap are respectively obtained as shown in figure 4. The detection parameters of the unknown sample ma-4pRML-X33 are shown in Table 1, and Ct (pro-rml) and internal reference gene Ct (gap) of the target gene of the unknown sample are substituted into a formula to obtain template amounts of pro-rml (copy quality) and gap (copy quality) of the target gene and the internal reference gene to obtain 4 copies of strains.

TABLE 1 determination of copy number of recombinant strains

The copy number calculation formula is:

3.4 overexpression of the HAC1 Gene in 4 copies of the above-mentioned bacteria

(1) Obtaining of fragment of HAC1 Gene

With P_HAC1-F (CGGGATCCACATGCCCTGCAGGATTCTTCCATAAG) (SEQ ID No.7) and P_HAC1-R (ATAAGAATGCGGCCGCTCACCTGATCGCTATGCATGGATG) (SEQ ID No.8) is a primer, the genome of Pichia pastoris X-33 is a template (TIANGEN Yeast genomic DNA Kit (Cat: DP307-02) extraction), and a fragment of the HAC1 gene is obtained by the following PCR system and amplification conditions.

And (3) PCR reaction system:

reaction conditions are as follows: 5min at 95 ℃; 30cycles at 95 ℃ for 40s, 60 ℃ for 40s and 72 ℃ for 2 min; 10min at 72 ℃.

(2) Construction of overexpression plasmid HAC1-pPIC3.5K

The PCR-recovered product of the HAC1 gene was ligated to the vector pMD18-T-Simple (purchased from TaKaRa Co.), and the ligation was performed according to the kit (Code No. D104A) provided by TaKaRa Co. The correct HAC1-pMD18T plasmid was obtained by sequencing. HAC1-pMD18T and pPIC3.5K are double-digested by using restriction enzymes BamH I and Not I, and the HAC1 fragment and the pPIC3.5K vector are respectively recovered by tapping. They were ligated with T4 ligase and the ligation product was transformed into E.coli DH5 α. The over-expression plasmid HAC1-pPIC3.5K is obtained by plasmid extraction, PCR, BamHI and Not I double enzyme digestion verification screening. The construction process is shown in FIG. 5.

(3) Electrically transforming an overexpression vector HAC1-pPIC3.5K into pichia pastoris containing 4 copies of lipase genes and screening positive strains.

HAC1-pPIC3.5K extraction, linearization and electrotransformation methods are the same as 3.2, the screening process of positive strains is the same as 3.3., and the primers used are D-HAC1-F (ATGCCCGTAGATTCTTCTCATAAGACAGCTAGCCCACTTCCACCT) (SEQ ID No.9) and D-HAC1-R (GCAAATGGCATTCGACATCC) (SEQ ID No. 10). The PCR reaction system and amplification conditions were the same as 3.3.

3.5. Expression of a lipase of interest in Pichia pastoris

Determination of lipase activity by NaOH titration

(1) Preparation of 0.05M NaOH: first use without CO₂Preparing 5M NaOH stock solution by using water; accurately diluting by 50 times, weighing 0.38g of potassium hydrogen phthalate, drying at 100 deg.C to constant weight, and dissolving in 80ml of solution without CO₂In water, calibrating the accurate concentration of the stock solution, and then calculating the concentration of the stock solution; 0.05M NaOH solution to free of CO₂Preparing water in situ after using a stock solution;

(2) preparation of PVA-olive oil emulsion substrate: mixing 100ml of olive oil and 300ml of 2% PVA1750 (polyvinyl alcohol), heating for dissolving, emulsifying by ultrasonic waves with the power of 300W, the ultrasonic waves for 3s, the intermittence for 4s, the circulation for 99 times and the like;

(3) adding 5ml of emulsion substrate and 4ml of 0.1M disodium hydrogen phosphate-citric acid buffer solution with pH of 6.0 into a 150ml triangular flask, placing in a constant temperature water bath shaker at 35 ℃, and incubating for 5min at 150 rpm;

(4) adding 1ml of properly diluted enzyme solution into the substrate and the buffer solution, reacting at 35 ℃ and 150rpm for 10min, and adding 15ml of absolute ethyl alcohol to terminate the reaction;

(5) dripping 4 drops of phenolphthalein as an indicator, and titrating the fatty acid generated by enzymolysis by using 0.05M NaOH until the reaction solution turns pink;

the blank operation is identical to that described above except that the fermentation broth is mixed with absolute ethanol for 10min and added to the substrate and buffer.

The enzyme activity is defined as the amount of enzyme that releases 1. mu. mol of fatty acid in 1min under the measurement conditions as one unit of enzyme activity.

Selecting single colony of 4 copies of strain over-expressing HAC1 and 2 copies of strain related to Chinese invention patent 201710402790X, inoculating to 25ml BMGY medium (1% yeast powder, 2% peptone, 1% glycerol), shake culturing at 28 deg.C and 200rpm to OD₆₀₀About 4.0-8.0, transferring into 500ml triangular flask containing 50ml BMMY culture medium (1% yeast powder, 2% peptone, 1.0% methanol, 100mmol/l phosphate buffer solution, pH 7.0), continuing culturing under the same culture condition, supplementing 100% methanol to the culture medium every 24 hours until the final concentration is 1.0%, and inducing expression for 6 days. Sampling at regular intervals, and measuring the cell density (OD)₆₀₀) And the enzymatic activity of extracellular Rhizomucor miehei lipase.

As shown in FIG. 6, for example, in the case of 96 hours of shaking culture in BMMY medium (initial pH 7, culture temperature 28 ℃), the enzyme activity of the enzyme containing m alpha-4 pRML-X33H reaches the maximum 1078U/ml, and the extracellular secretion efficiency reaches 43U/OD₆₀₀26U/OD of strain exceeding 2 copies₆₀₀。

3.6 preparation of enzyme powder

(1) Collecting fermentation liquor: centrifuging the fermentation liquor at 4 deg.C and 5000rpm for 10min, collecting supernatant 40mL, adjusting pH to 4.0, and placing in-20 deg.C environment until the surface is frozen.

(2) Adding 8mL of acetone (precooled at-20 ℃ in advance) into the fermentation liquor obtained in the step (1), slowly stirring while adding, and standing for 10min at-20 ℃;

(3) slowly adding 72mL of acetone (precooled at-20 ℃) into the mixture obtained in the step (2), slowly stirring the mixture while adding the acetone, and standing the mixture for 2 to 3 hours at-20 ℃;

(4) centrifuging the mixed solution in the step (3) at 8000rpm and 4 ℃ for 10min, removing supernatant, and collecting precipitate;

(5) adding precooled acetone with the volume 2 times that of the precipitate into the precipitate in the step (4), uniformly stirring, and centrifuging at the temperature of 4 ℃ and the rpm of 8000 for 10 min;

(6) repeating the step (5) once;

(7) the precipitate was air-dried in a fume hood, and enzyme powder was obtained.

As shown in Table 2, the pH of 40mL of the fermentation broth was adjusted to 4.0, the volume ratio of acetone to the fermentation broth was 2:1, the weight of the obtained enzyme powder was 1.0116g, the specific activity of the enzyme powder was 7936.5U/g, and the recovery rate of the enzyme powder was 37.935%.

TABLE 240 mL Properties of enzyme powder obtained at pH4.0 of the fermentation broth

Sequence listing

<110> university of Jiangsu profession

<120> engineering strain for producing rhizomucor miehei lipase powder and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1017

<212> DNA

<213> Mucor miehei Rice (Rhizomucor miehei)

<400> 1

gtgccaatca agagacaatc aaacagcacg gtggatagtc tgccacccct catcccctct 60

cgaacctcgg caccttcatc atcaccaagc acaaccgacc ctgaagctcc agccatgagt 120

cgcaatggac cgctgccctc ggatgtagag actaaatatg gcatggcttt gaatgctact 180

tcctatccgg attctgtggt ccaagcaatg agcattgatg gtggtatccg cgctgcgacc 240

tcgcaagaaa tcaatgaatt gacttattac actacactat ctgccaactc gtactgccgc 300

actgtcattc ctggagctac ctgggactgt atccactgtg atgcaacgga ggatctcaag 360

attatcaaga cttggagcac gctcatctat gatacaaatg caatggttgc acgtggtgac 420

agcgaaaaaa ctatctatat cgttttccga ggttcgagct ctatccgcaa ctggattgct 480

gatctcacct ttgtgccagt ttcatatcct ccggtcagtg gtacaaaagt acacaaggga 540

ttcctggaca gttacgggga agttcaaaac gagcttgttg ctactgttct tgatcaattc 600

aagcaatatc caagctacaa ggttgctgtt acaggtcact cactcggtgg tgctactgcg 660

ttgctttgcg ccctgggtct ctatcaacga gaagaaggac tctcatccag caacttgttc 720

ctttacactc aaggtcaacc acgggtaggc gaccctgcct ttgccaacta cgttgttagc 780

accggcattc cttacaggcg cacggtcaat gaacgagata tcgttcctca tcttccacct 840

gctgcttttg gttttctcca cgctggcgag gagtattgga ttactgacaa tagcccagag 900

actgttcagg tctgcacaag cgatctggaa acctctgatt gctctaacag cattgttccc 960

ttcacaagtg ttcttgacca tctctcgtac tttggtatca acacaggcct ctgtact 1017

<210> 2

<211> 339

<212> PRT

<213> Mucor miehei Rice (Rhizomucor miehei)

<400> 2

Val Pro Ile Lys Arg Gln Ser Asn Ser Thr Val Asp Ser Leu Pro Pro

1 5 10 15

Leu Ile Pro Ser Arg Thr Ser Ala Pro Ser Ser Ser Pro Ser Thr Thr

20 25 30

Asp Pro Glu Ala Pro Ala Met Ser Arg Asn Gly Pro Leu Pro Ser Asp

35 40 45

Val Glu Thr Lys Tyr Gly Met Ala Leu Asn Ala Thr Ser Tyr Pro Asp

50 55 60

Ser Val Val Gln Ala Met Ser Ile Asp Gly Gly Ile Arg Ala Ala Thr

65 70 75 80

Ser Gln Glu Ile Asn Glu Leu Thr Tyr Tyr Thr Thr Leu Ser Ala Asn

85 90 95

Ser Tyr Cys Arg Thr Val Ile Pro Gly Ala Thr Trp Asp Cys Ile His

100 105 110

Cys Asp Ala Thr Glu Asp Leu Lys Ile Ile Lys Thr Trp Ser Thr Leu

115 120 125

Ile Tyr Asp Thr Asn Ala Met Val Ala Arg Gly Asp Ser Glu Lys Thr

130 135 140

Ile Tyr Ile Val Phe Arg Gly Ser Ser Ser Ile Arg Asn Trp Ile Ala

145 150 155 160

Asp Leu Thr Phe Val Pro Val Ser Tyr Pro Pro Val Ser Gly Thr Lys

165 170 175

Val His Lys Gly Phe Leu Asp Ser Tyr Gly Glu Val Gln Asn Glu Leu

180 185 190

Val Ala Thr Val Leu Asp Gln Phe Lys Gln Tyr Pro Ser Tyr Lys Val

195 200 205

Ala Val Thr Gly His Ser Leu Gly Gly Ala Thr Ala Leu Leu Cys Ala

210 215 220

Leu Gly Leu Tyr Gln Arg Glu Glu Gly Leu Ser Ser Ser Asn Leu Phe

225 230 235 240

Leu Tyr Thr Gln Gly Gln Pro Arg Val Gly Asp Pro Ala Phe Ala Asn

245 250 255

Tyr Val Val Ser Thr Gly Ile Pro Tyr Arg Arg Thr Val Asn Glu Arg

260 265 270

Asp Ile Val Pro His Leu Pro Pro Ala Ala Phe Gly Phe Leu His Ala

275 280 285

Gly Glu Glu Tyr Trp Ile Thr Asp Asn Ser Pro Glu Thr Val Gln Val

290 295 300

Cys Thr Ser Asp Leu Glu Thr Ser Asp Cys Ser Asn Ser Ile Val Pro

305 310 315 320

Phe Thr Ser Val Leu Asp His Leu Ser Tyr Phe Gly Ile Asn Thr Gly

325 330 335

Leu Cys Thr

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggaattcgt gccaatcaag ag 22

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tagtctagag tacagaggcc tgtg 24

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gactggttcc aattgacaag c 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcaaatggca ttctgacatc c 21

<210> 7

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgggatccac catgcccgta gattcttctc ataag 35

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ataagaatgc ggccgctcac ctgatcgcta tgcatg 36

<210> 9

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgcccgtag attcttctca taagacagct agcccacttc cacct 45

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcaaatggca ttctgacatc c 21

Claims

1. A method for producing Rhizomucor miehei lipase powder is characterized by comprising the following steps,

b1: culturing an engineering strain for producing Rhizomucor miehei lipase powder; the construction method of the engineering strain comprises the following steps: a1: inserting a lipase gene pro-rml containing a leader peptide into a pichia pastoris expression vector pPICZalpha + Malpha to construct an expression vector pPICZalpha + Malpha-2 prorml containing 2 copies of a target gene; the nucleotide sequence of the gene pro-rml is shown as SEQ ID NO.1, and the SEQ ID NO.1 is positioned between two restriction endonucleases EcoRI and Not I in pPICZ alpha + M alpha;

a2: respectively transferring the expression vector pPICZ alpha + M alpha-2 prorml containing 2 copies of target genes into pichia pastoris;

a3: screening pichia pastoris containing 4 copies of genes and capable of expressing Pro-RML to obtain an engineering strain for producing rhizomucor miehei lipase powder;

b3: (1) centrifuging the fermentation liquor at 4 ℃ and 5000rpm for 10min, then taking 40 parts by volume of supernatant of the fermentation liquor, adjusting the pH to 4.0, then placing the fermentation liquor in a container, and placing the container in an environment at-20 ℃ until the surface of the liquid in the container is frozen;

(4) centrifuging the mixed solution in the container at 8000rpm and 4 deg.C for 10min, removing supernatant, and collecting precipitate;

(6) repeating the step (5) once;

(7) air-drying the precipitate obtained in the step (6) to obtain rhizomucor miehei lipase powder;

the induction conditions in step B2 were such that the inducer methanol was supplied every 24 hours to a final methanol concentration of 1.0% (v/v).

2. A Rhizomucor miehei lipase powder produced by the method of claim 1 for producing the Rhizomucor miehei lipase powder.