CN107043757B

CN107043757B - Recombinant pichia pastoris for heterologous high-efficiency expression of rhizomucor miehei lipase and application thereof

Info

Publication number: CN107043757B
Application number: CN201710402790.XA
Authority: CN
Inventors: 黄金金; 王一洲; 孙梦雪; 郑维发; 赵艳霞
Original assignee: Jiangsu Normal University
Current assignee: Jiangsu Normal University
Priority date: 2017-06-01
Filing date: 2017-06-01
Publication date: 2020-07-07
Anticipated expiration: 2037-06-01
Also published as: CN107043757A

Abstract

The invention discloses a recombinant pichia pastoris for heterologous high-efficiency expression of lipase and application thereof. The recombinant pichia pastoris is obtained by transforming a plasmid SEC31-pPIC3.5K of an overexpression SEC31 gene into a recombinant pichia pastoris X-33 containing 4 copies of Pro-RML gene and capable of expressing Pro-RML. The invention effectively promotes the expression of the Rhizomucor miehei lipase and improves the secretion efficiency of the lipase, when the Rhizomucor miehei lipase is fermented in a shake flask for 144 hours, the enzyme activity reaches 996U/mL, the extracellular enzyme activity secretion efficiency of the strain reaches 38U/OD₆₀₀The secretion efficiency is higher than the extracellular enzyme activity secretion efficiency (26U/OD) of the Pichia pastoris recombinant strain with 2 copies of Rhizomucor miehei lipase related to the patent CN103361327A₆₀₀)。

Description

Recombinant pichia pastoris for heterologous high-efficiency expression of rhizomucor miehei lipase and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a recombinant pichia pastoris for heterologous high-efficiency expression of lipase and application thereof.

Background

Lipases (EC 3.1.1.3) are a class of enzymes that can hydrolyze triacylglycerols. A variety of chemical reactions can be catalyzed such as: hydrolysis, esterification, transesterification, ammonolysis, and the like. The reactions catalyzed by lipases have several advantages over chemical methods: the method has the advantages of mild reaction conditions, few byproducts, no pollution and the like, is widely applied to industries such as food, medicine, cosmetics, petroleum and the like, and is called as enzyme for the third industry.

At present, the production of lipase mainly adopts a strategy of heterologous protein expression. However, there are many factors affecting the expression of heterologous proteins, and they are mainly classified into two categories: external and internal causes. The external factors include: culture medium, culture conditions, and the like; the internal factors include the preference of gene codon, gene copy number, carrier performance, the bearing capacity of host protein synthesizing and secreting path, etc. Due to a plurality of limiting factors, the expression level of most enzymes still cannot meet the requirement of industrial production. How to improve the capability of a host to secrete heterologous lipase is a problem to be solved for industrial application of lipase.

The synthesis and secretion of heterologous proteins in host cells involve multiple steps, target genes are transcribed and translated into nascent peptides, the nascent peptides enter endoplasmic reticulum, enter Golgi apparatus through vesicles after folding modification in the endoplasmic reticulum, and are secreted out of cells through the vesicles after further folding modification in the Golgi apparatus. During expression of the heterologous protein, a step of vesicle trafficking is involved. Especially during overexpression of heterologous proteins, the number of vesicles may not be sufficient to allow the transport of so many nascent peptides. Thus, by overexpressing vesicle composition proteins in the host, such as SEC31, etc., it is possible to facilitate the timely transport of nascent peptides.

Rhizomucor miehei lipase is a1, 3 site specific lipase and can be used in various aspects of biodiesel preparation. The CN103361327A of the previous application of the applicant discloses a recombinant Pichia pastoris for heterologous efficient secretory expression of rhizomucor miehei lipase, which is obtained by introducing 2 copies of a coding rhizomucor miehei lipase gene (with self leader peptide) by adopting a molecular biology technology and constructing a vector capable of being expressed in Pichia pastoris. Although the recombinant pichia pastoris realizes the heterologous secretion of the rhizomucor miehei lipase, the enzyme activity of the secreted recombinase is higher, but the secretion quantity of the recombinant pichia pastoris is the soft rib which influences the popularization and application of the recombinant pichia pastoris all the time.

Disclosure of Invention

The first purpose of the invention is to provide a recombinant pichia pastoris strain of rhizomucor miehei lipase with high secretion efficiency.

The second object of the present invention is to provide a method for improving the secretion efficiency of the lipase.

The purpose of the invention can be realized by the following technical scheme:

the genetic engineering bacteria are obtained by converting a plasmid SEC31-pPIC3.5K of an overexpression SEC31 gene into a recombinant Pichia pastoris X-33 containing 4 copies of Pro-RML genes and capable of expressing Pro-RML.

The recombinant Pichia pastoris X-33 containing the Pro-RML gene with the copy number of 4 is obtained by inserting a lipase gene Pro-RML containing a leader peptide into a Pichia pastoris expression vector pPICZ α A to construct an expression vector pPICZ α A-2prorml containing the Pro-RML gene with the copy number of 2, and the plasmid construction process is shown in figure 2. the pPICZ α A-2prorml is transformed into the Pichia pastoris X-33 and screened by a qPCR method to obtain the recombinant Pichia pastoris X-33 containing the Pro-RML gene with the copy number of 4 and capable of expressing Pro-RML.

The invention clones 1, 3-position specific lipase (Pro-RML) gene Pro-RML containing leader peptide from Rhizomucor miehei strain, the nucleotide sequence is shown as SEQ ID No.1, the total length of the gene is (1017) bp, analysis shows that GC content is (48.9)%, and protein consisting of (339) amino acids is coded.

The invention finds that unfolded or misfolded protein is generated in a genetic engineering bacterium capable of expressing Pro-RML with 4 copies of genes and accumulated in an endoplasmic reticulum cavity, so that pressure is generated on the endoplasmic reticulum, and a vesicle-constituting protein gene SEC31 is connected to a pPIC3.5K vector (figure 5) and is transformed into m α -4pRML-X33, so that the genetic engineering strain m α -4pRML-X33S capable of expressing Pro-RML and over-expressing the 4 copies of Pro-RML genes of SEC31 is obtained.

The gene engineering bacteria of the invention are applied to heterologous secretion expression of Rhizomucor miehei lipase.

A method for efficiently carrying out heterologous secretion expression on Rhizomucor miehei lipase is characterized in that lipase Pro-RML is obtained by culturing the genetic engineering bacteria of 4 copy number Pro-RML gene of over-expression SEC31 and carrying out induced expression. The culture conditions were 28 ℃ and initial pH 7 at 200rpm for 144 hours. The induction condition is that inducer methanol is supplemented every 24 hours until the final concentration of methanol is 1.0% (v/v), the method is adopted, the flask is cultured for 144 hours, olive oil is taken as a substrate, and the enzyme activity is 996U/mL. The extracellular enzyme activity secretion efficiency of the strain is found to be obviously improved and reaches 38U/OD₆₀₀Higher than 2 copies of the strain involved in the patent CN103361327A (the active secretion efficiency of the extracellular enzyme is 26U/OD)₆₀₀)。

The beneficial technical effects are as follows:

the lipase is expressed in pichia pastoris, so that the lipase is superiorChanging the gene copy number of the strain to obtain a pichia pastoris recombinant strain containing 4 Mucor miehei lipase copy numbers, and fermenting for 144h with the extracellular enzyme activity of 704U/mL and the enzyme activity secretion efficiency of 29U/OD₆₀₀. It was also found that a UPR reaction was generated inside the strain and that a large amount of unfolded or misfolded proteins accumulated in the lumen of the endoplasmic reticulum. The experiment effectively promotes the secretion of the Rhizomucor miehei lipase by over-expressing the vesicle composition protein SEC31 in the strain, improves the extracellular enzyme activity secretion efficiency of the lipase, ensures that the enzyme activity reaches 996U/mL and the enzyme activity secretion efficiency of the strain reaches 38U/OD during the shake flask fermentation for 144h₆₀₀The secretion efficiency is higher than that of the Pichia pastoris recombinant strain with 2 copies of Rhizomucor miehei lipase related to the patent CN103361327A (the extracellular enzyme activity secretion efficiency is 26U/OD)₆₀₀)。

Drawings

FIG. 1 shows the electrophoresis of the restriction and recovery of the target gene, lane 1 shows DNA standard molecular weights (kb) of 4.5,3.0,2.0,1.2,0.8 and 0.50.2; lane 2, the 1017bp fragment (indicated by the arrow) was recovered from the target gene by DNA digestion;

FIG. 22 is a flow chart of copy expression plasmid construction;

FIG. 32 is a diagram showing the double restriction electrophoresis of the copy expression plasmid, wherein lane 1 shows the results of double restriction of DNA standard molecular weight (kb):15,10,7.5,5,2.5,1,0.25, and lane 2: 2 shows the results of double restriction of expression plasmid pPICZ α + M α -2prorml with Bgl II and BamH I, and arrows indicate the expression frames.

FIG. 4 Standard Curve for copy number Strain determination

FIG. 5 construction procedure of over-expression SEC31 vector

FIG. 6 comparison of Shake flask fermentation results of strains overexpressing SEC31

A: the cell growth of each strain in the fermentation process; b: extracellular enzyme activity of each strain in the fermentation process; c: the enzyme activity secretion efficiency of each strain in the fermentation process;

the specific implementation mode is as follows:

the following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

The percent in the present invention means mass percent unless otherwise specified; but the percentage of the solution, unless otherwise specified, means that 100ml of the solution contains several grams of solute; the percentage between the liquids refers to the ratio of the volumes at 20 ℃. The steps of conventional experimental operations such as enzyme digestion, ligation, recovery, transformation, PCR amplification and the like are described in molecular cloning (third edition). Primer synthesis and sequencing was done by english jun (Invitrogen) bio-inc.

EXAMPLE 1 preparation of Mucor miehei cDNA

1.1 extraction of Total RNA from Mucor miehei

(1) Taking appropriate amount of Rhizomucor miehei mycelium, drying with filter paper, grinding with liquid nitrogen, adding 1ml Trizol reagent (Invitrogen), shaking with oscillator for 5min, and standing at room temperature for 1 min;

(2) adding 0.2ml chloroform, shaking for 15s, and standing for 2 min;

(3)4℃，12000rpm，15min；

(4) sucking supernatant, adding equal volume of isopropanol, and precipitating at-20 deg.C for 30 min;

(5)4℃，12000rpm，15min；

(6) the supernatant was decanted off and the precipitate was washed with 1ml of 75% ethanol at 7500rpm, 4 ℃ for 5 min;

(7) repeating the step (6) once;

(8) pouring off the supernatant, and drying for 10 min;

(9) adding a proper amount of DEPC water to dissolve to obtain total RNA;

1.2 preparation of the first Strand of the cDNA of Mucor miehei

The reverse transcription was specifically performed using reverse transcriptase (MMLV) manufactured by Promega corporation as follows:

a25. mu.l reaction was prepared by adding the following ingredients to a nuclease-free centrifuge tube:

heating at 95 deg.C for 5min to terminate reaction, and freezing for storage.

EXAMPLE 22 construction of the copy of pPICZ α A-2prorml plasmid

2.1 primer design

Based on the sequence of the rml gene in GenBank (GenBank accession No. A02536.1), the following pair of primers were designed and synthesized:

FW(P1)：5’—CGGAATTCGTGCCAATCAAGAG—3’(SEQ ID NO.2)

REV(P2)：5’—TAGTCTAGAGTACAGAGGCCTGTG—3’(SEQ ID NO.3)

the two ends of P1 and P2 are respectively designed with EcoR I and Not I restriction enzyme sites (see the italic underlined part in the sequence)

2.2 PCR amplification of Rhizomucor miehei Lipase pro-rml containing leader peptide

The PCR reaction system is characterized in that a P1 primer and a P2 primer are adopted, and Mucor miehei (Boel E, Huge-Jensen B, Christensen M, Thim L, Fiil N: Rhizomucor miehei trigyceride is synthesized as appropriate for Lipidss 1988,23(7):701 and 706.) (stored in a room) cDNA is taken as a template:

the reaction conditions are as follows: circulating 30 times at 95 deg.C for 5min, 5 deg.C for 40s, 60 deg.C for 40s, and 72 deg.C for 1min, at 72 deg.C for 10min, and at 4 deg.C for 2 min.

2.3 recovery of the fragment of interest from the PCR reaction product

The target gene fragment is purified and recovered from the PCR product by a gel cutting and column passing method, the PCR reaction product is subjected to agarose gel electrophoresis, the target gene DNA is cut under the irradiation of an ultraviolet lamp, the length of the target gene is 1017bp (figure 1), and the target gene is recovered according to the method of a DNA recovery kit instruction (purchased from Tiangen company, product number is DP 209-02).

2.4 cloning of TA

The PCR-recovered product was ligated to the vector pMD18-T-Simple (purchased from TaKaRa Co.), and the ligation was performed according to the kit (Code No. D104A) provided by TaKaRa Co.

2.5 the gene of interest was ligated into the Pichia pastoris expression vector pPICZ α A.

2.5.12 copy expression plasmid construction

The method comprises the steps of carrying out double digestion on pMD18-T-prorml and pPICZ α A by using restriction enzymes EcoR I and Not I respectively, then recovering target fragments, connecting the target fragments by using T4 ligase, transforming a connecting product into escherichia coli DH5 α (purchased from Shanghai Biotechnology Limited), obtaining a single-copy expression plasmid pPICZ α A-prorml, carrying out double digestion on BamH I and BglII on the single-copy pPICZ α A-prorml to obtain an expression frame containing a pro-rml fragment, carrying out BamH I single digestion on the pZ α A-prorml to obtain a PICpZ α A vector fragment containing a single-copy pro-rml, connecting the expression frame and the vector fragment to obtain a 2-copy pZ α A-2prorml vector, transferring the PICZ α A-2 rml into escherichia coli DH5 α for amplification and PCR detection, and sending a sequence detection scheme 3 to a person with a picture of the drawing.

EXAMPLE 34 Pichia recombinant Strain Screen with copies of the pro-rml Gene

3.1 preparation of Pichia pastoris X-33 (purchased from Invitrogen) electrotransformation competent cells and electroporation thereof

(1) Picking fresh single colony in 5ml YPD liquid culture medium, culturing at 30 deg.c and 250rpm for 12-14 hr;

(2) inoculating into 2L Erlenmeyer flask containing 500ml YPD medium at 0.1%, culturing at 30 deg.C and 250rpm for 12-14 hr to make OD₆₀₀＝1.3-1.5；

(3) Centrifuging at 1500rpm at 4 deg.C for 5min, and collecting cells;

(4) cells were washed twice with 500-;

(5) the cells were washed once with 20ml of ice-pre-chilled 1M sorbitol solution;

(6) resuspending the cells with 1ml of ice-precooled 1M sorbitol solution to a final volume of about 1.5ml, and packaging in 80. mu.l small centrifuge tubes;

3.2 electroporation transformation of Pichia pastoris cells

(1) About 10. mu.l of the prepared non-linearized 2-copy expression plasmid of about 100. mu.g/. mu.l is mixed with 80. mu.l of yeast competent cells, and the mixture is left on ice for about 5 minutes;

(2) transferring the DNA-mixed competent cells into an ice-precooled 0.2cm electric rotor;

converting at a voltage of 1.5 kilovolts;

(3) then 1ml of ice-pre-cooled 1M sorbitol solution was immediately added to the transformed cells, the cells were mixed well and transferred to a 1.5ml small centrifuge tube and allowed to stand at 30 ℃ for 1-2 h.

(4) 50-200ul of the suspension was spread on YPDS plates (yeast extract 1%, peptone 2%, dextrase 2%, Sorbitol 1M, agar 2%,) containing 100ug/ml, and cultured at 30 ℃ for 2 to 3 days to observe the results.

3.3. Screening of recombinant strains containing 4 copies of the pro-rml Gene

3.3.1 identification of correctly integrated transformants by colony PCR

Positive colonies were selected on the plates and further verified to give correctly integrated transformants by the yeast colony PCR method using 5 'AOX 1, 3' AOX1 as primers.

The primer sequence is as follows: 5' AOX 1: 5'-GACTGGTTCCAATTGACAAGC-3' (SEQ ID NO.4)

3' AOX 1: 5'-GCAAATGGCATTCTGACATCC-3' (SEQ ID NO.5) template processing method:

(1) a small amount of colonies were picked up with a sterile pipette tip and dissolved in 50. mu.l of D2-Buffer (1L: guanidinium isothiocyanate 472.64g,1 mol/L50 ml of pH8.0Tris-HCl Buffer, β -mercaptoethanol 7ml) and mixed well;

(2) placing the mixed solution in 100 deg.C boiling water bath for 5 min;

(3) centrifuging at 12000rpm for 30s, and discarding the supernatant;

(4) washing the precipitate with sterile water for 2 times;

(5) the precipitate was dissolved in 20. mu.l of ddH₂O, acting at 95 ℃ for 5 min;

(6) and centrifuging to obtain supernatant as the template.

And (3) PCR reaction system:

reaction conditions are as follows: 5min at 95 ℃; 30cycles at 95 ℃ for 40s, 60 ℃ for 40s, 72 ℃ for 1min for 30 s; 10min at 72 ℃.

3.3.2 determination of 4 copies of the Strain by qPCR

Extracting the genome of the screened pichia pastoris recombinant by using a TIANGEN Yeast genome DNA extraction Kit (TIANAmp Yeast DNA Kit, cat number: DP307-02), selecting glyceraldehyde-3-phosphate dehydrogenase gene (gap) as an internal reference gene by using the genome of the recombinant containing only one copy of pro-rml as a template, diluting the template at different concentrations, detecting by Q-PCR (Q-PCR), respectively obtaining a standard curve (figure 4) between the log value and the Ct value of the template amount of the target gene pro-rml and the internal reference gene gap, wherein the standard curve is shown in a qPCR data of a positive strain in a table 1, substituting the Ct (pro-rml) and the Ct (gap) of the internal reference gene of an unknown sample into a formula to obtain template amounts of the target gene and the internal reference gene, namely pro-rml (copy quality) and gap (copy quality), and calculating a strain 85m-33 ML 83-33 according to the following copy number formula:

the results are shown in Table 1:

TABLE 1 determination of copy number of recombinant strains

Example 4 overexpression of the SEC31 Gene in 4 copies of the above-described bacteria

4.1 acquisition of SEC31 Gene fragment

With P_SEC31-F(CGGGATCCACCATGGTGGTACCCCTAAGTCAGTT (SEQ ID NO.6)) and P_SEC31-R(ATAAGAATGCGGCCGCCTAGTTGATGATGTAATTCAGACTGC (SEQ ID NO.7)) as a primer, the genome of Pichia pastoris X-33 as a template (extracted by a TIANGEN Yeast genomic DNA Kit (Cat: DP 307-02)), and a fragment of SEC31 gene was obtained by the following PCR system and amplification conditions。

And (3) PCR reaction system:

reaction conditions are as follows: 5min at 95 ℃; 30cycles at 95 ℃ for 40s, 60 ℃ for 40s and 72 ℃ for 2 min; 10min at 72 ℃.

4.2 construction of the overexpression plasmid SEC31-pPIC3.5K

The PCR recovery product of SEC31 gene is connected to carrier pMD18-T-Simple (purchased from TaKaRa company), the connection reaction is operated according to the instruction of kit (Code No. D104A) provided by TaKaRa company, the correct SEC31-pMD18T plasmid is obtained by sequencing, the SEC31 fragment and pPIC3.5K are recovered by cutting glue respectively by using restriction endonucleases BamH I and Not I, the ligation product is connected by using T4 ligase, the ligation product is transformed into Escherichia coli DH5 α, and the over-expression plasmid SEC31-pPIC3.5K is obtained by plasmid extraction, PCR, BamHI and Not I double digestion verification screening, and the construction process is shown in figure 5.

4.3 overexpression vector SEC31-pPIC3.5K is electrically transformed into pichia pastoris containing 4 copies of lipase gene and screening of positive strains.

The SEC31-pPIC3.5K extraction, linearization and electrotransformation method is the same as 3.2, the screening process of the positive strain is the same as 3.3, the primers used for screening are D-SEC31-F (CGTGTTCCTCAATCAGCCA (SEQ ID NO.8)) and D-SEC31-R (GCAAATGGCATTCTGACATCC (SEQ ID NO. 9)). the PCR reaction system and the amplification conditions are the same as 3.3, and the strain m α -4pRML-X33S of over-expression SEC31 is obtained.

4.4 expression of the Lipase of interest in Pichia pastoris

Determination of lipase activity by NaOH titration

(1) Preparation of 0.05M NaOH: first use without CO₂Preparing 5M NaOH stock solution by using water; accurately diluting by 50 times, weighing 0.38g of potassium hydrogen phthalate, drying at 100 deg.C to constant weight, and dissolving in 80ml of solution without CO₂In water, the accurate concentration is calibrated and then estimatedCalculating the concentration of the stock solution; 0.05M NaOH solution to free of CO₂Preparing water in situ after using a stock solution;

(2) preparing a PVA-olive oil emulsion substrate: mixing 100ml of olive oil and 300ml of 2% PVA1750 (polyvinyl alcohol), heating for dissolving, emulsifying by ultrasonic waves with the power of 300W, the ultrasonic waves for 3s, the intermittence for 4s, the circulation for 99 times and the like;

(3) adding 5ml of emulsion substrate and 4ml of 0.1M disodium hydrogen phosphate-citric acid buffer solution with pH of 6.0 into a 150ml triangular flask, placing in a constant temperature water bath shaker at 35 ℃, and incubating for 5min at 150 rpm;

(4) adding 1ml of properly diluted enzyme solution into the substrate and the buffer solution, reacting at 35 ℃ and 150rpm for 10min, and adding 15ml of absolute ethyl alcohol to terminate the reaction;

(5) dripping 4 drops of phenolphthalein as an indicator, and titrating the fatty acid generated by enzymolysis by using 0.05M NaOH until the reaction solution turns pink;

the blank operation is identical to that described above except that the fermentation broth is mixed with absolute ethanol for 10min and added to the substrate and buffer.

The enzyme activity is defined as the amount of enzyme that releases 1. mu. mol of fatty acid in 1min under the measurement conditions as one unit of enzyme activity.

Single colonies of 4 copies of pro-rml gene strain overexpressing SEC31 (m α -4pRML-X33S), 4 copies of pro-rml gene strain not overexpressing SEC31 (m α -4pRML-X33) and 2 copies of pro-rml gene strain involved in patent CN103361327A (m α -2pRML-X33) were picked, inoculated in 25ml of BMGY medium (1% yeast powder, 2% peptone, 1% glycerol), and shake-cultured at OD 28 ℃ and 200rpm until the OD reaches 28 ℃₆₀₀About 4.0-8.0, transferring into 500ml triangular flask containing 50ml BMMY culture medium (1% yeast powder, 2% peptone, 1.0% methanol, 100mmol/l phosphate buffer solution, pH 7.0), continuing culturing under the same culture condition, supplementing 100% methanol to the culture medium every 24 hours until the final concentration is 1.0% (v/v), and inducing and expressing for 6 days. Sampling at regular intervals, and measuring the cell density (OD)₆₀₀) And the enzyme activity of the extracellular Rhizomucor miehei lipase, and calculating the secretion efficiency of the extracellular enzyme activity, wherein the detection result is shown in figure 6.

From the cell growth of each strain (FIG. 6A), the flask was fermented for 144h, m α -2pRML-X33 (OD)₆₀₀39) was superior to m α -4pRML-X33S (OD)₆₀₀25.9) and m α -4pRML-X33 (OD)₆₀₀24.25). The growth condition of the recombinant Pichia pastoris cell over-expressing the 4 copies of the pro-rml gene of SEC31 is slightly lower than that of the recombinant Pichia pastoris cell with 2 copies of the pro-rml gene, but the cell growth condition is not changed greatly compared with that of the recombinant Pichia pastoris cell with 4 copies of the pro-rml gene.

The extracellular enzyme activity secretion of each strain is shown in figure 6B, when the fermentation time is 144h, the enzyme activities of m α -4pRML-X33S and m α -2pRML-X33 are similar, the highest enzyme activities are 996U/ml and 1023U/ml respectively, and are both higher than 704U/ml of m α -4pRML-X33, compared with the recombinant Pichia pastoris of 4 copies of pro-rml gene without over-expressing SEC31, the over-expression SEC31 can promote the secretion of Mucor miehei lipase.

The secretion efficiency of the recombinant strain is calculated according to the enzyme activity and the cell growth condition, and the result is shown in figure 6 C.m α -4pRML-X33S, the secretion efficiency of the extracellular enzyme activity is higher than that of m α -2pRML-X33 and m α -4pRML-X33, and when the recombinant strain is fermented for 144h, the secretion efficiency of the extracellular enzyme activity of m α -4pRML-X33H, m α -2pRML-X33 and m α -4pRML-X33 are respectively 38U/OD₆₀₀、26U/OD₆₀₀And 29U/OD₆₀₀. The results show that overexpression of SEC31 improves the extracellular enzyme activity secretion efficiency of recombinant Pichia pastoris with 4 copies of pro-rml gene.

With the results of FIG. 6 taken together, the extracellular enzyme activity of the Pichia pastoris recombinant containing 4 copies of pro-rml gene overexpressing SEC31 reached the maximum of 996U/ml and the extracellular enzyme activity secretion efficiency reached 38U/OD under the condition of shake flask culture of BMMY medium (initial pH 7, culture temperature 28 ℃) for 144 hours₆₀₀Higher than 26U/OD of 2 copies strain related to patent CN103361327A₆₀₀。

<110> university of Jiangsu profession

<120> recombinant pichia pastoris for heterologous high-efficiency expression of lipase and application thereof

<160>9

<210>1

<211>1017

<212>

<213> Mucor miehei Rice (Rhizomucor miehei)

<220>

<223> pro-rml Gene

<400>1

gtgccaatca agagacaatc aaacagcacg gtggatagtc tgccacccct catcccctct 60

cgaacctcgg caccttcatc atcaccaagc acaaccgacc ctgaagctcc agccatgagt 120

cgcaatggac cgctgccctc ggatgtagag actaaatatg gcatggcttt gaatgctact 180

tcctatccgg attctgtggt ccaagcaatg agcattgatg gtggtatccg cgctgcgacc 240

tcgcaagaaa tcaatgaatt gacttattac actacactat ctgccaactc gtactgccgc 300

actgtcattc ctggagctac ctgggactgt atccactgtg atgcaacgga ggatctcaag 360

attatcaaga cttggagcac gctcatctat gatacaaatg caatggttgc acgtggtgac 420

agcgaaaaaa ctatctatat cgttttccga ggttcgagct ctatccgcaa ctggattgct 480

gatctcacct ttgtgccagt ttcatatcct ccggtcagtg gtacaaaagt acacaaggga 540

ttcctggaca gttacgggga agttcaaaac gagcttgttg ctactgttct tgatcaattc 600

aagcaatatc caagctacaa ggttgctgtt acaggtcact cactcggtgg tgctactgcg 660

ttgctttgcg ccctgggtct ctatcaacga gaagaaggac tctcatccag caacttgttc 720

ctttacactc aaggtcaacc acgggtaggc gaccctgcct ttgccaacta cgttgttagc 780

accggcattc cttacaggcg cacggtcaat gaacgagata tcgttcctca tcttccacct 840

gctgcttttg gttttctcca cgctggcgag gagtattgga ttactgacaa tagcccagag 900

actgttcagg tctgcacaag cgatctggaa acctctgatt gctctaacag cattgttccc 960

ttcacaagtg ttcttgacca tctctcgtac tttggtatca acacaggcct ctgtact 1017

<210>2

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> primer P1

<400>2

cggaattcgt gccaatcaag ag 22

<210>3

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> primer P2

<400>3

tagtctagag tacagaggcc tgtg 24

<210>4

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> primer 5' AOX1

<400>4

gactggttcc aattgacaag c 21

<210>5

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> primer 3' AOX1

<400>5

gcaaatggca ttctgacatc c 21

<210>6

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> primer PSEC31-F

<400>6

cgggatccac catggtggta cccctaagtc agtt 34

<210>7

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> primer PSEC31-R

<400>7

ataagaatgc ggccgcctag ttgatgatgt aattcagact gc 42

<210>8

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> primer D-SEC31-F

<400>8

cgtgttcctc aatcagcca 19

<210>9

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> primer D-SEC31-R

<400>9

gcaaatggca ttctgacatc c 21

<210>10

<211>1116

<212>DNA

<213> Pichia pastoris X-33

<220>

<223> SEC31 Gene

<400>10

atggtggtac ccctaagtca gttcccttcg ccgcccaact caagtggcga cggctgcgag 60

aactcaagta cagtcttttc caaggactgt gtcaagagga ctgcatcgcc attagaccct 120

caatctcaat ttagagtctc cccaaactcg tacactacat ccacaaacta ttctaccccg 180

gtttcttccc acgaaacttt gtcctcctca acatccggga tctcagtgac aggcgttctg 240

ctaccatcaa tagattcatt agcacgctca atctcctata caggacgaga cgctgttcct 300

ttcaacttgt ccacttggac tgacaagtca acacctgtta ctaattcttt tgtcatctct 360

cagtatgaag acacgcgtgt tcctcaatca gccaccagtt ctacacatcc aaacatacct 420

aaacacgcca aagagtatcc gttagcaaat gggccacctg ggtggtgttg gaattcccat 480

tccagtatgt cgacagacca accaatatat ccaggacacc aatatccacc accgcttcag 540

cagcactacc actttgcttc acccaggcaa ctatcaaact ctagctctgg gacgtcatcc 600

gttcctttcc aaccaccccc tgctggtcaa ttacaaccac aaggtaattc tatgttcata 660

cacatgccat tttcgctaaa tggcccacca gctgctggac agcaattgat accaccccaa 720

ggactagcct caatacctgt cggccccggc aacaacagtt ccctattggt tagccaaggt 780

gcacctggcg gctattcttt agcttcacca gcgttgtcac cggtagatgc gaccttcgaa 840

gatcccgtca agagactgcc caaaaagcgg acaaaaactg gatgtctcac ttgccgtaag 900

agacgaatca aatgtgacga acgcaagccg ttctgtttca actgtgaaaa aagcaaaaag 960

gtgtgtactg gttttacgca tctattcaaa gatcccccta gcaaatccta ccctcccagt 1020

tcagatggtg cctcccctgt tgccaatgac caccctgtcc ccccaaggca aaactttggt 1080

gaattgaggg gcagtctgaa ttacatcatc aactag 1116

Claims

1. A genetic engineering bacterium for efficient heterologous secretion expression of Mucor miehei lipase is characterized in that the genetic engineering bacterium is obtained by converting a plasmid SEC31-pPIC3.5K of an over-expression SEC31 gene into a recombinant Pichia pastoris X-33 containing 4 copy numbers of Pro-RML genes and capable of expressing Pro-RML, the recombinant Pichia pastoris X-33 containing 4 copy numbers of Pro-RML genes is constructed by inserting the lipase gene Pro-RML containing a leader peptide into a Pichia pastoris expression vector pPICZ α A to obtain an expression vector pPICZ α A-2prorml containing 2 copy numbers of Pro-RML genes, the PICpZ α A-2prorml is converted into the Pichia pastoris X-33 and the recombinant Pichia pastoris X-33 containing 4 copy numbers of Pro-RML genes and capable of expressing Pro-RML is obtained by means of qPCR screening, wherein the nucleotide sequence of the recombinant Pichia pastoris X-33 is shown in SEQ ID No. 1.

2. The genetically engineered bacterium of claim 1, wherein the over-expression plasmid SEC31-pPIC3.5K is obtained by inserting SEC31 gene between BamH I and Not I cleavage sites of pPIC3.5K vector.

3. Use of the genetically engineered bacterium of any one of claims 1-2 for heterologous secretory expression of Rhizomucor miehei lipase.

4. A method for high-efficiency heterologous secretory expression of Rhizomucor miehei lipase is characterized in that lipase Pro-RML is obtained by culturing the genetic engineering bacteria of any one of claims 1-2 and performing induced expression.

5. The method according to claim 4, wherein the culturing is carried out under conditions of 28 ℃ and an initial pH of 7 at 200rpm for 144 hours.

6. The method according to claim 4, characterized in that the induction conditions are such that the inducer methanol is fed every 24 hours to a final methanol concentration of 1.0% (v/v).