CN112852655A

CN112852655A - Saccharomyces cerevisiae engineering bacterium for displaying acid protease on cell surface as well as construction method and application thereof

Info

Publication number: CN112852655A
Application number: CN202110394158.1A
Authority: CN
Inventors: 宋育阳; 黄蓉; 秦义; 刘延琳
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2021-04-13
Filing date: 2021-04-13
Publication date: 2021-05-28

Abstract

The invention provides a saccharomyces cerevisiae engineering bacterium for displaying acid protease on the cell surface, a construction method and application thereof, belonging to the technical field of genetic engineering. A construction method of a saccharomyces cerevisiae engineering bacterium for displaying acid protease on a cell surface comprises the steps of inserting an acid protease coding gene subjected to codon optimization into a saccharomyces cerevisiae surface display expression vector PUC-GAP-alpha-factor-SED 1, and transforming a recombinant vector into a host strain saccharomyces cerevisiae to obtain the saccharomyces cerevisiae engineering bacterium for displaying the acid protease on the cell surface. The saccharomyces cerevisiae engineering bacteria prepared by the invention can realize immobilization of the acid protease during production, and heterologous expression can not cause the spatial structure of the acid protease to be damaged by other physical or chemical factors, so that the activity and the yield of the prepared immobilized enzyme are ideal, and the immobilized enzyme can be used as a whole-cell catalyst to be applied to catalytic proteolysis.

Description

Saccharomyces cerevisiae engineering bacterium for displaying acid protease on cell surface as well as construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a saccharomyces cerevisiae engineering bacterium for displaying acid protease on the cell surface, and a construction method and application thereof.

Background

The acid protease is aspartic protease in protease, contains one or more carboxyl at active site center of enzyme, and is widely distributed in plants, fungi and mammals. Acidic proteases are able to efficiently hydrolyze proteins in acidic media (pH < 5.0). The reaction substrate is hydrolyzed into amino acid and small peptide chain completely, usually depending on the hydrolysis of protease, i.e. the endo-and exo-action, and simultaneously the enzyme has extremely strong acid resistance, can not be putrefactive and deteriorated due to the breeding and propagation of microorganisms in the process of protein hydrolysis, and is generally applied to various industries such as food, brewing, medicine, light industry and the like. In view of the difference in the origin of the microorganism producing the acid protease, the acid protease can be roughly classified into three major groups. Strains secreting acid proteases in industrial production are mainly aspergillus niger and aspergillus oryzae, one strain normally secreting one or more acid proteases, and two different acid proteases which can be produced by mutants of aspergillus niger, i.e. acid protease a and acid protease B. The active sites of the two proteases are different in composition, the active site of acid protease B has an aspartic acid residue, and the active site of acid protease A does not have an aspartic acid residue. The acid protease secreted by fungi has a greater potential than other types of acid proteases, in terms of abundance and complexity of acid proteases. The catalytic hydrolysis of proteins to produce polypeptides and amino acids is dependent on the action of proteases. Proteases can be generally classified into four types, depending on the difference in functional groups on the active site: proteases containing the sulphur-containing amino acid Cys, proteases rich in the hydroxyl-containing amino acid Ser, proteases rich in the acidic amino acid Asp and metalloproteinases. Aspartic acid (Asp) protease has an isoelectric point of about 3.0 to about 5.0, a molecular weight of about 30 to about 40 kilodaltons, and the greatest enzymatic activity in acidic media, and is therefore called acid protease, a compound with very rich chemical and physical properties.

The enzyme immobilization is to immobilize free enzyme on a special carrier by physical or chemical methods, which not only enhances the stability of the enzyme, but also separates the enzyme from an action substrate, thereby achieving the purposes of recycling and reducing the cost. However, in conventional physical or chemical immobilization methods, increased enzyme immobilization results in loss of enzyme activity and recovery; in addition, the immobilization requires a special carrier material, and the requirements for immobilization technology are high, so that the cost for carrier preparation and immobilization operation is increased, and the production cost is also increased by the separation and purification of the immobilized enzyme.

The cell surface display technology developed in recent years provides a brand new biological method based on gene recombination technology for enzyme immobilization. Saccharomyces cerevisiae has been recognized as a safe model organism (GRAS) and is widely used in the food and pharmaceutical industries, as well as a host cell for yeast surface display that is common today. The enzyme with high catalytic activity is displayed and expressed on the cell surface of the saccharomyces cerevisiae by utilizing a cell surface display technology to form a whole-cell catalyst, different from the traditional intracellular enzyme and exocrine enzyme, the enzyme displayed on the surface is fixed on the cell outer surface in a covalent or non-covalent mode, and the unique spatial positioning ensures that the enzyme has a plurality of excellent characteristics relative to free enzyme, such as temperature, organic solvent stability, repeated utilization and the like. However, the over-expression of heterologous proteins can cause the growth stress to cause the unfolded protein effect (UPR), so that the yield of the acid protease cannot be further improved, and the industrial production of the acid protease is limited to a certain extent.

Disclosure of Invention

In view of the above, the present invention aims to provide a saccharomyces cerevisiae engineering bacterium displaying an acid protease on a cell surface, and a construction method and an application thereof, so that the acid protease is immobilized on the cell surface while a spatial structure of the acid protease is not damaged, and high activity and yield of the immobilized enzyme are ensured.

The invention provides a construction method of saccharomyces cerevisiae engineering bacteria for displaying acid protease on the cell surface, which comprises the following steps:

1) inserting the codon-optimized acid protease coding gene into a saccharomyces cerevisiae surface display expression vector PUC-GAP-alpha-factor-SED 1 to obtain a recombinant vector;

2) and transforming the recombinant vector into a host strain saccharomyces cerevisiae to obtain the saccharomyces cerevisiae engineering bacteria with the cell surface displaying the acid protease.

Preferably, the nucleotide sequence of the codon-optimized acid protease encoding gene is shown as SEQ ID NO: 1 is shown.

Preferably, the primer for amplifying the acid protease coding gene is pepA-F/pepA-R;

the nucleotide sequence of pepA-F is shown as SEQ ID NO: 2 is shown in the specification;

the nucleotide sequence of pepA-R is shown as SEQ ID NO: 3, respectively.

Preferably, the method for constructing the PUC-GAP-alpha-factor-SED 1 comprises the following steps:

A. taking the genome of saccharomyces cerevisiae as a template, and carrying out PCR amplification by adopting a primer pair GS linker-Sed1-F/Sed1-R to obtain a DNA fragment of Sed1-GS linker, wherein the PCR reaction condition is pre-denaturation at 94 ℃ for 3 min; 30s at 98 ℃, 30s at 55 ℃ and 40s at 72 ℃ for 32 cycles; 7min at 72 ℃; stopping at 4 ℃, and concretely reacting the following: 2 x Phanta Turbe Buffer 50. mu.L, GS linker-Sed 1-F2. mu. L, Sed 1-R2. mu.L, yeast genome template 150ng, Phanta Turbe Super-Fidelity DNA Polymerase 2. mu.L, DNTP Mix 2. mu. L, ddH₂O make up to 100. mu.L. The nucleotide sequence of the GS linker-Sed1-F is shown as SEQ ID NO: 5 is shown in the specification; the nucleotide sequence of the Sed1-R is shown as SEQ ID NO: 4 is shown in the specification;

B. the plasmid pYES 2/CT/alpha-Factor was linearized with EcoRI and XbaI enzymes, and the DNA fragment of the Sed1-GS linker and the resulting linearized pYES 2/CT/alpha-Factor were ligated to obtain the ligation product as vector PUC-GAP-alpha-Factor-SED 1.

Preferably, the insertion multiple cloning site of the saccharomyces cerevisiae surface display expression vector is Sph I/Cla I.

Preferably, the host strain saccharomyces cerevisiae comprises saccharomyces cerevisiae BY4741 strain.

The invention provides the saccharomyces cerevisiae engineering bacteria of which the cell surfaces display the acid protease, which are constructed by the construction method, wherein the cell surfaces of the saccharomyces cerevisiae engineering bacteria stably express the acid protease.

Preferably, the enzyme activity of the acid protease of the saccharomyces cerevisiae engineering bacteria is 4.01-5.80U/mL.

The invention provides application of the saccharomyces cerevisiae engineering bacteria in catalytic proteolysis.

The invention provides a whole-cell catalyst for catalyzing proteolysis, which comprises the saccharomyces cerevisiae engineering bacteria.

The invention provides a construction method of a saccharomyces cerevisiae engineering bacterium for displaying acid protease on the cell surface, which uses GAP as a promoter to improve the expression quantity of an acid protease gene (pepA), connects GS-linker to the 3' end of the acid protease gene (pepA) to ensure that the acid protease is over-expressed, ensures that the spatial structure of the acid protease is not damaged and the enzyme activity, simultaneously uses SED1 of saccharomyces cerevisiae as an anchoring protein, inserts the encoding genes of the anchoring protein and the acid protease into a carrier simultaneously, obtains a fusion protein through recombinant expression, and leads the acid protease to reach the cell surface of the saccharomyces cerevisiae under the action of the anchoring protein so as to display the acid protease on the cell surface. The result of enzyme activity determination of the recombinant pepA acid protease saccharomyces cerevisiae shows that the saccharomyces cerevisiae engineering bacteria constructed by the invention has the characteristic of high acid protease secretion performance and has high enzyme activity.

The invention constructs a saccharomyces cerevisiae engineering bacterium for displaying the acid protease on the cell surface by a gene recombination method, the recombinant saccharomyces cerevisiae converts a specific acid protease gene segment into saccharomyces cerevisiae for stable expression, and a host strain can synthesize a bacterium liquid for displaying the acid protease on the surface, thereby realizing the immobilized production of the acid protease by one step. The engineering bacteria have the following advantages: (1) the specific acid protease gene is displayed on the cell surface of the saccharomyces cerevisiae, so that the acid protease can be immobilized while being produced, the genetic operation is convenient, the expressed exogenous protein can be subjected to post-translational modification such as folding, glycosylation and the like, and the loss of enzyme amount and enzyme activity by a physical or chemical carrier is avoided. (2) The high cell density is achieved by culturing in a cheap culture medium, and the operations of preparing a carrier and separating, purifying and immobilizing the acid protease are avoided. (3) The acidic protease displayed on the surface of the saccharomyces cerevisiae is connected to the outside of the carrier, and can be contacted with the substrate sufficiently and effectively, so that the substrate is catalyzed to the maximum extent. (4) The application provides a brand-new biological method based on gene recombination technology for the immobilization of the acid protease, which is different from the traditional physical or chemical immobilization method. Meanwhile, the saccharomyces cerevisiae displaying the acid protease can be obtained by large-scale fermentation, so that the possibility of commercial application of the acid protease is greatly improved.

Drawings

FIG. 1 is a flow chart of a yeast surface display technique;

FIG. 2 is a map of recombinant plasmid PUC-GAP-alpha-factor-pepA-SED 1;

FIG. 3 is an electrophoretogram of a target fragment pepA; pepA is the target fragment (1182bp) obtained by PCR; maker is DNA staining Maker10 kb;

FIG. 4 is a double-restriction enzyme digestion check electrophoresis chart of the vector plasmid PUC-GAP-alpha-factor-HQM-SED 1; m is DNA staining marker 10 kb;

FIG. 5 shows a process for constructing plasmid PUC-GAP-alpha-factor-pepA-SED 1;

FIG. 6 is a PCR amplification electropherogram of positive clones; 1 and 2 are target fragments (3162bp) obtained BY BY4741-i PCR; m is DNA staining marker 10 kb;

FIG. 7 is a tyrosine standard curve;

FIG. 8 is a graph showing the effect of the incubation time at 30 ℃ on the enzymatic activity of the positive clone BY 4741-i.

Detailed Description

The invention inserts the coding gene of the acid protease after codon optimization into a saccharomyces cerevisiae surface display expression vector PUC-GAP-alpha-factor-SED 1 to obtain a recombinant vector.

In the present invention, it is preferable to obtain the gene of mature acid protease from NCBI website and perform codon optimization. The mature acid protease gene is selected from Aspergillus usamii (Aspergillus usamii) acid protease gene (pepA). The codon optimization is optimized according to the codon preference of saccharomyces cerevisiae. The nucleotide sequence of the codon-optimized acid protease coding gene (pepA) is preferably shown as SEQ ID NO: shown at 1 (ATGGTCGTCTTCAGCAAAACCGCTGCCCTCGTTCTGGGTCTGTCCACCGCCGTCTCTGCGGCACCGGCTCCCACTCGCAAGGGCTTCACCATCAACCAGATTGCCCGGCCTGCCAACAAGACCCGCACCGTCAACTTGCCGGGTTTGTATGCCCGTTCCCTGGCCAAGTTTGGCGGTACGGTGCCCCAGAGCGTGAAGGAGGCTGCCAGCAAGGGTAGTGCCGTGACCACGCCCCAGAACAATGACGAGGAGTACCTGACTCCCGTCACTGTCGGAAAGTCCACCCTTCATCTGGACTTTGACACCGGATCTGCAGATCTCTGGGTCTTCTCAGACGAGCTCCCTTCCTCGGAGCAGACCGGTCACGATCTGTACACGCCTAGCTCCAGCGCGACCAAGTTGAGCGGCTACTCTTGGGACATCTCTTACGGTGACGGCAGCTCGGCCAGCGGAGACGTCTACCGGGATACTGTCACTGTTGGCGGTGTCACCACCAACAAGCAGGCCGTTGAAGCTGCCAGCAAGATCAGCTCCGAGTTCGTTCAGGACACGGCCAATGATGGTCTTCTGGGTCTGGCCTTCAGCTCCATCAACACTGTCCAGCCCAAGGCACAGACCACCTTCTTCGACACCGTCAAGTCTCAGCTGGACTCTCCTCTTTTCGCCGTGCAGTTGAAGCACGACGCCCCTGGTGTCTACGACTTTGGCTACATCGATGACTCCAAGTACACCGGTTCCATCACCTACACGGATGCCGATAGCTCCCAGGGCTACTGGGGCTTCAGCACCGACGGCTACAGCATCGGCGACGGCAGCTCCAGCTCCAGCGGCTTCAGCGCCATTGCTGACACCGGTACCACCCTCATCCTCCTCGACGATGAGATCGTTTCCGCCTACTACGAGCAGGTTTCCGGCGCCCAGGAGAGCTATGAAGCTGGTGGCTACGTTTTCTCTTGCTCTACTGACCTTCCTGACTTCACCGTCGTGATCGGCGACTACAAGGCCGTCGTTCCTGGCAAGTACATCAACTACGCTCCCGTTTCGACCGGCAGCTCCACCTGCTACGGCGGTATCCAGAGCAACAGCGGTCTCGGACTGTCCATCCTGGGTGATGTGTTCTTGAAGAGCCAGTACGTGGTCTTCAACTCTGA GGGACCTAAGCTGGGCTTTGCTGCTCAGGCT). After the pepA gene with optimized codon is obtained, the pepA gene is preferably artificially synthesized into an escherichia coli plasmid, the pepA gene is cloned by using a PCR amplification primer, and then PCR purification and recovery are carried out. The primer for amplifying the acid protease encoding gene is preferably pepA-F/pepA-R. The nucleotide sequence of pepA-F is shown as SEQ ID NO: 2 (AGAGAGGCTGAAGCTATCGATATGGTCGTCTTCAGCAAAACCGCT); the nucleotide sequence of pepA-R is shown as SEQ ID NO: 3 (CAGAACCACCACCACCGCATGCAGCCTGAGCAGCAAAGCCCAGCTT). The source of the primer is not particularly limited in the present invention, and a primer known in the art may be used. The extension of the PCR to the reaction procedure is preferably as follows: 95 ℃ for 3min, (98 ℃ 10sec, 55 ℃ 15sec, 72 ℃ 30 sec). times.30 cycles, 72 ℃ for 5 min. And introducing the purified pepA gene segment into escherichia coli, and verifying by adopting Taq enzyme PCR, wherein primers used for the Taq enzyme PCR verification are Cexu-GAP-F and pepA-R.

In the present invention, the method for constructing PUC-GAP- α -factor-SED1 preferably comprises the following steps: A. taking a genome of saccharomyces cerevisiae as a template, and carrying out PCR amplification by adopting a GS linker-Sed1-F/Sed1-R primer pair to obtain a DNA fragment of Sed1-GS linker; the nucleotide sequence of the GS linker-Sed1-F is shown as SEQ ID NO: 5 (GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAAATTATCAACTGTCCTATTATCT); the nucleotide sequence of the Sed1-R is shown as SEQ ID NO: 4 (GGTGTTGCTATGTTATTCTTATAATCTAGAGGGCCCTTCGAAGGT);

In the present invention, the strain of Saccharomyces cerevisiae is preferably Saccharomyces cerevisiae BY 4741. The invention has no limit on the method for extracting the genome of the saccharomyces cerevisiaeExtraction protocols well known in the art may be employed. Sed1 is the dockerin, GS linker is the linker peptide sequence. The reaction program of the PCR amplification is preferably pre-denaturation at 98 ℃ for 2 min; 30s at 98 ℃, 30s at 55 ℃ and 40s at 72 ℃ for 25 cycles; 7min at 72 ℃; keeping at 4 ℃. The specific reaction system is preferably: 2 x Phanta Turbe Buffer 50. mu.L, GS linker-Sed 1-F2. mu. L, Sed 1-R2. mu.L, yeast genome DNA template 150ng, Phanta Turbe Super-Fidelity DNApolymerase 2. mu.L, DNTP Mix 2. mu. L, ddH₂O make up to 100. mu.L. After PCR amplification, PCR product purification is preferably performed. The purification method is not particularly limited in the present invention, and can be accomplished by a purification method known in the art, for example, a method of recovering cut gel. The purified DNA fragment of Sed1-GS linker was used as the gene sequence encoding the anchoring protein of Saccharomyces cerevisiae.

The plasmid pYES 2/CT/alpha-Factor can be obtained by any commercially available method known in the art, without any particular limitation as to the source of the plasmid. The linearization treatment is enzyme digestion treatment by EcoRI and Xba I enzymes; the condition of the enzyme digestion treatment is that the treatment is carried out for 3 hours at 37 ℃. The DNA fragment of Sed1-GS linker and the resulting linearized pYES2/CT/α -Factor are preferably ligated by the In-Fusion technique. The obtained ligation product is preferably transformed into escherichia coli, cultured and verified by tests such as colony PCR, gene sequencing and subsequent enzyme digestion. The colony PCR detection primer is preferably a GS linker-Sed1-F/Sed1-R primer pair. When the enzyme cutting result obtains a DNA fragment of 6123bp, the PUC-GAP-alpha-factor-SED 1 is successfully obtained.

In the present invention, the construction method preferably further comprises inserting an HQM (β -glucosidase) gene. The HQM gene is expressed in saccharomyces cerevisiae as a target protein. In the construction process, the method for inserting HQM (beta-glycosidase) gene preferably adopts HQM-F/HQM-R as primer for PCR amplification. The nucleotide sequence of HQM-F is shown as SEQ ID NO: 6 (GCTGAAGCTTACGTAGAATTCATGGTGAGCAAGGGCGAGGAGCTG); the nucleotide sequence of HQM-R is shown as SEQ ID NO: 7 (AGAACCACCACCACCGCATGCCTTGTACAGCTCGTCCATGCCGAG). Reaction system reference for PCR amplification

Instructions for use of Super-Fidelity DNApolymerase. The reaction program of the PCR amplification is pre-denaturation at 98 ℃ for 2 min; 30s at 98 ℃, 30s at 58 ℃ and 40s at 72 ℃ for 25 cycles; 7min at 72 ℃; keeping at 4 ℃. After PCR amplification, PCR product purification is preferably performed. The purification method is not particularly limited in the present invention, and can be accomplished by a purification method known in the art, for example, a method of recovering cut gel.

In the invention, the insertion multiple cloning site of the saccharomyces cerevisiae surface display expression vector is preferably Sph I/Cla I. The conditions for enzyme digestion of Sph I/Cla I are preferably as follows: 10 Xqc buffer (colorless) 10. mu.L, Sph I2. mu. L, Cla I2. mu.L, vector plasmid (PUC-GAP-alpha-factor-HQM-SED 1)5000ng, ddH₂O make up to 100. mu.L.

After insertion, the ligation product is preferably verified. Preferably, the ligation product is transformed into escherichia coli, the escherichia coli is cultured, a Taq enzyme system PCR verification is adopted, an upstream primer for verification is preferably His-f, a downstream primer is preferably pepA-R, a positive transformant obtained through verification is sequenced, sequencing results are compared, and the result shows that the recombinant plasmid containing the pepA gene is successfully constructed when the sequencing results are consistent with a pepA gene fragment. The nucleotide sequence of the His-f is shown as SEQ ID NO: shown in fig. 8. The reaction program of colony PCR is preferably pre-denaturation at 94 ℃ for 3 min; 30s at 98 ℃, 30s at 55 ℃ and 40s at 72 ℃ for 32 cycles; 2min at 72 ℃; stopping at 4 ℃.

After the recombinant vector containing the pepA gene is obtained, the recombinant vector is transformed and transferred into a host strain saccharomyces cerevisiae to obtain the saccharomyces cerevisiae engineering bacteria of which the cell surface displays the acid protease.

In the present invention, the method of transformation is preferably an electrical transformation method. The conditions of the electrical conversion process are preferably as follows: a. yeast competence preparation (ice-based aseptic procedure) procedure:

(1) selecting a Trichosporon BY4741, inoculating into 5mLYEPD culture medium, and culturing at 30 deg.C and 150rpm overnight;

(2) inoculating 1mL of the suspension into 50mLYEPD, and culturing at 30 ℃ and 150rpm for 4.5-5 h;

(3) sub-packaging 1mL of bacterial liquid into an EP tube, centrifuging at 4 ℃ and 12000rpm for 30s, discarding the supernatant, and repeating for 7-9 times;

(4) after the thalli are collected, the thalli are washed twice by precooled sterile water, mixed evenly by a short-time tissue disruptor, and centrifuged for 30s at 4 ℃ and 12000rpm (the centrifuge is cooled to 4 ℃ in advance);

(5) adding 10 μ L DTT into 1mL of the obtained solution, mixing with a short-time tissue disruptor, and standing in an incubator at 30 deg.C for 30 min;

(6) centrifuging, discarding the supernatant, adding 1mL of 1mol/L precooled sorbitol, mixing the mixture by a tissue disruptor for a short time, discarding the supernatant, and repeating the steps once;

(7) finally, 1mol/L precooled sorbitol is used for dissolving the thalli until the final volume is 80 mu L, a vortex instrument is used for uniformly mixing, and the thalli is stored in a refrigerator at the temperature of minus 80 ℃ or placed on ice for immediate electric conversion;

b. yeast electrotransformation operation (ice sterilization):

(1) adding about 1500-2000 ng of DNA into 80 mu L of yeast competence, uniformly mixing by blowing and sucking with a gun, transferring into a precooled electric rotor cup, and standing for 5 min;

(2) wiping electric rotating cup, electric shock parameters: 2KV, 25 muF, 200 ohm;

(3) immediately adding 1mL of precooled sorbitol, slowly blowing and beating, transferring to an EP tube, and standing for 1h at 30 ℃;

(4) centrifuging, removing supernatant, adding 1mLYPD, mixing with tissue disruptor, and culturing at 30 deg.C and 150rpm for 2 hr;

(5) centrifuging to obtain thallus, sucking 500 μ L of supernatant, and coating onto SD-Ura plate at a rate of 150 μ L/plate;

the host strain saccharomyces cerevisiae is preferably SD-Ura defective saccharomyces cerevisiae haploid BY 4741. For example, in host strain saccharomyces cerevisiae, a target enzyme fragment is subjected to homologous recombination with a yeast genome by virtue of a His3 histidine homology arm, so that the acidic protease gene pepA is integrated into the saccharomyces cerevisiae genome, and stable expression is realized.

In the invention, the enzyme activity of the acid protease of the saccharomyces cerevisiae engineering bacteria is preferably 4.01-5.80U/mL.

In the present invention, the preparation method of the whole-cell catalyst preferably comprises the following steps: and mixing the saccharomyces cerevisiae engineering bacteria and auxiliary materials to obtain the whole-cell catalyst. The use of the whole-cell catalyst in catalyzing the hydrolysis of proteins.

The invention provides an application of the saccharomyces cerevisiae engineering bacteria in catalyzing protein hydrolysis based on the efficient expression of acid protease on the cell surface of the saccharomyces cerevisiae engineering bacteria.

In the invention, the saccharomyces cerevisiae engineering bacteria are used as a carrier to preferentially decompose unstable proteins in the wine, provide an absorbable carbon source for the growth of saccharomyces cerevisiae, promote the rate of alcohol fermentation and improve the storage potential of the white wine.

The present invention provides a saccharomyces cerevisiae engineered bacterium displaying acid protease on cell surface, and the construction method and application thereof, which are described in detail below with reference to the examples, but they should not be construed as limiting the scope of the present invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in the molecular cloning guidelines (third edition, sambrook, inc.), or according to the kit and product instructions; the reagents and biomaterials, if not specifically indicated, are commercially available.

Experimental materials and reagents:

1. strains and plasmids: the host strain used in the research is haploid S.cereviae BY4741 (MATa; his3 Delta 1; leu2 Delta 0; met15 Delta 0; ura3 Delta 0) and is purchased from Wuhan vast Ling Biotech, Inc. Escherichia coli containing the acidic protease gene pepA of Aspergillus usamii was synthesized by Biotech, and the target pepA gene was amplified by PCR using an amplification system of DNA Polymerase from Phanta @ Turbe Super-Fidelity, Poncirus BombH, and directly purified and recovered by using a kit manufactured by Takala. Escherichia coli competent cell DH5 alpha was purchased from Tiangen Biochemical technology (Beijing) Ltd, and the plasmid was a plasmid vector PUC-GAP-alpha-factor-HQM-SED 1 stored in Escherichia coli in the laboratory.

2. The tool enzymes and main reagents are shown in Table 1.

TABLE 1 sources List of the tool enzymes and reagents described in the examples of the invention

3. The primer sequences are shown in Table 2.

TABLE 2 primer sequences List referred to in the examples of the present invention

4. Buffer and culture medium formula

1M Tris-HCl solution (pH8.0) preparation: 6.06g of Tris alkali is accurately weighed, 40mL of ultrapure water is added for ultra-washing and dissolving, concentrated HCl is added dropwise to adjust the pH value to 8.0, then the volume is adjusted to 50mL by a volumetric flask, and the solution is stored in a refrigerator at 4 ℃.

Preparation of 0.5M EDTA solution (pH 8.0): accurately weighing EDTA-Na₂·2H₂O9.306 g, 35mL of ultrapure water was added thereto, the mixture was vigorously and rapidly stirred to make the solution uniform, the pH of the solution was adjusted to 8.0 with NaOH having a concentration of about 2M, the volume of the solution was adjusted to 50mL with a volumetric flask, and the solution was stored in a refrigerator at 4 ℃.

TE buffer solution: accurately sucking 1mL of Tris-HCl solution (pH8.0) with a concentration of 1M and 0.2mL of EDTA solution (pH8.0) with a concentration of 0.5M by using a pipette, dissolving by ultra-washing with ultrapure water, finally fixing the volume to 100mL by using a volumetric flask, and storing in a refrigerator at 4 ℃.

Ampicillin (Amp): 0.1g/mL of ampicillin, 0.22 μm of membrane sterilization, preservation at-20 ℃ and actual required concentration of 100 μ g/mL.

1M sorbitol: sorbitol 18.21g/L, autoclave for 20min at 121 ℃.

Yeast competence preparation treatment solution: accurately weighing 9.1g of sorbitol and 0.5g of lithium acetate, dissolving by ultra-washing with ultrapure water, and finally metering the volume to 50mL by using a volumetric flask, and storing in a refrigerator at 4 ℃.

Yeast complete nutrient medium (YPD): 10g/L glucose, 5g/L yeast extract, 10g/L peptone and 20min at 121 ℃, adding 2% agar powder into a solid culture medium and sterilizing at 121 ℃ for 20 min.

Uracil deficient synthetic glucose basal medium (SD-URA): glucose 20g/L, Ura-DO-Supplement 0.77g/L and YNB1.7 g/L, adjusting pH to 5.8 with 4mol/L NaOH, sterilizing at 121 ℃ for 15min, adding 2% agar powder into solid culture medium, and sterilizing at 121 ℃ for 15 min.

Uracil deficient synthetic galactosyl basal medium (SG-URA): 20g/L galactose, 1.7 g/L YNB, 0.77g/L SD-Ura-DO-Supplement, 4mol/L NaOH to adjust pH to 5.8, 2% agar powder added into solid culture medium, and sterilization at 121 ℃ for 15 min.

Luria-Bertain (LB) Medium: 10g/L of sodium chloride, 10g/L of tryptone, 5g/L of yeast extract powder, 4mol/L of NaOH to regulate the pH value to 7.2, sterilizing at 121 ℃ for 20min, adding 2% agar powder into a solid culture medium, and sterilizing at 121 ℃ for 20 min.

LB-Amp medium: ampicillin was added to LB liquid or solid medium to a final concentration of 100 mg/L.

5. Preparation of reagent for measuring acid protease activity

(a) Lactic acid buffer (pH 3.0)

Solution A: weighing lactic acid C₃H₆O₃(the concentration is 80% -90%) 10.6g, and water is added to dissolve and fix the volume to 1000 mL.

And B, liquid B: weighing sodium lactate C₃H₅O₃16g of Na (with the concentration of 70 percent) is dissolved by adding water and is added to the solution to be volume to 1000 mL.

The use solution: accurately sucking 8mL of solution A and 1mL of solution B, shaking up vigorously during mixing, diluting with ultrapure water for one time during use to obtain 0.05mol/L lactic acid buffer solution, and storing in a refrigerator at 4 deg.C.

(b) Sodium carbonate Na with concentration of 0.4mol/L₂CO₃Solution: 42.4g of anhydrous sodium carbonate is accurately weighed, dissolved by ultrapure water, and is stored in a refrigerator at 4 ℃ after the volume of a volumetric flask is adjusted to 1000 mL.

(c) Trichloroacetic acid solution at a concentration of 0.4 mol/L: 65.4g of trichloroacetic acid is accurately weighed, dissolved by ultrapure water, and stored in a refrigerator at 4 ℃ after the volume is up to 1000mL by a volumetric flask.

(d) Sodium hydroxide NaOH at a concentration of 0.5 mol/L: 2.0g of NaOH solid is accurately weighed, a small amount of ultrapure water is dissolved, the volume is determined to be 100mL by a volumetric flask, and the solution is stored in a refrigerator at 4 ℃.

(e) Casein solution with concentration of 10.00 mg/mL.

Weighing 1.000g of casein, accurately weighing to 0.001g, and sucking concentrated lactic acid C with rubber-tipped dropper₃H₆O₃Wetting casein with two drops, adding appropriate amount of lactic acid C₃H₆O₃Heating the buffer solution to about 80mL in a magnetic stirrer, dissolving at constant temperature of 50 deg.C, cooling at normal temperature, transferring into a 100mL volumetric flask, and adding lactic acid C₃H₆O₃(pH 3.0) buffer was diluted to the mark and the solution was stored in a refrigerator at 4 ℃ for three days.

(f) Folin-phenol reagent

50.0g of sodium tungstate (H) was accurately weighed₄Na₂O₆W), 12.5g sodium platinate (Na)₂MoO₄·2H₂O), 25mL of 85% phosphoric acid H₃PO₄Adding 350mL of ultrapure water and 50mL of concentrated hydrochloric acid HCL into a 1000mL clean and dry round-bottom flask, refluxing with slow fire even if the liquid keeps a slightly boiling state for about 10h, taking off a condenser, adding 25mL of ultrapure water and 150.0g of lithium sulfate (Li)₂O₄) And adding about 5.5mL of bromine water to decolor after being mixed evenly. Decolorizing until the solution is golden yellow, maintaining slightly boiling state for about 20min to remove excess bromine, cooling at room temperature, and performing filtration with No. 4 or No. 5 acid-resistant bacteria funnelThe solution was filtered, then the volume was adjusted to 500mL using a volumetric flask, and the prepared liquid was poured into a clean and dry brown bottle and stored in a refrigerator at 4 ℃ in the dark. In use, one part of the forlin-phenol reagent is sucked in two parts of ultrapure water, and the volume ratio of 1: 2 is used as an indicator for enzyme activity determination reaction color development.

(g) Tyrosine standard solution with concentration of 100 mu g/mL

Accurately weighing 0.1000g of L-tyrosine which is dried to constant weight in a drier at 105-110 ℃, dissolving the L-tyrosine by using hydrochloric acid HCL60mL with the concentration of 1mol/L, using a volumetric flask to fix the volume to 100mL, namely obtaining 1.00mg/mL tyrosine solution, and storing the tyrosine solution in a refrigerator at 4 ℃. Sucking 10.00mL of 1.00mg/mL tyrosine standard solution, and diluting to 100mL with 0.1mol/L HCl (HCl) to obtain 100.0 mu g/mL L-tyrosine standard solution, wherein the 100.0 mu g/mL L-tyrosine standard solution is prepared on site when used.

Example 1

The method for constructing the PUC-GAP-alpha-factor-pepA-SED 1 is as follows:

the high copy 2. mu. plasmid pYES 2/CT/alpha-Factor was purchased from Youbia as starting plasmid, HQM as target protein, SED1 as anchor protein, and E.coli competent cell DH5 alpha was purchased from Tiangen Biochemical department (Beijing) Co., Ltd. In the experiment, HQM and the anchoring protein gene Sed1 are fused by an In-fusion technology and then respectively inserted into pYES 2/CT/alpha-Factor plasmids, and the used primers are shown In Table 1.

1. Plasmid extraction, DNA fragment recovery, ligation and the like were performed according to the corresponding instructions. The Double Digestion system was performed according to the instruction manual of Double digest Universal Buffer provided by Tarkara corporation, and the calculation was performed according to the Digestion system. The transformed E.coli clones were identified by colony PCR. Individual colonies were picked with autoclaved toothpick or tip and gently mixed in 20. mu.L Triton-x 100. The EP tube containing 20. mu.L of Tritonx-100 was boiled at 100 ℃ for 2min, 1. mu.L of the supernatant was used as a template, and Easy Taq DNA polymerase was used to perform PCR reaction in 20. mu.L. And (4) selecting positive cloning bacteria for overnight culture, extracting plasmids, and performing DNA sequencing identification on the cloning segments.

2. The method for yeast genome comprises the following steps: DNA was extracted by SDS disruption. 1) Carrying out 28 ℃ streaking culture on a YEPD solid culture medium, selecting a single colony, carrying out 48h liquid culture at the YEPD 28 ℃, and then centrifuging and collecting thalli; 2) adding 200 μ L yeast lysate, and crushing with tissue crusher for 2 min; 3) then adding 200 μ L phenol chloroform isoamyl alcohol, and crushing for 2min by a tissue crusher; 4) adding 200 μ L TE buffer solution, reversing the above direction for 5 times, and centrifuging at 12000rpm for 10 min; 5) sucking supernatant, adding 700 μ L of anhydrous ethanol, freezing at-20 deg.C for 10min, and centrifuging at 12000rpm for 10 min; 6) pouring out the supernatant, adding 1mL of 70% ethanol, washing the precipitate, centrifuging at 12000rpm for 1min, and drying the ethanol; 7) dissolving 50 μ L of sterile water, adding 3 μ L of RNase, and carrying out water bath at 65 ℃ for 10 min; 8) repeating steps 3-6 (without using tissue disruptor), blow-drying, dissolving with 100 μ L sterile water, and storing at-20 deg.C.

3. Designing Cloning primers according to the In-Fusion HD Cloning kit instructions, respectively taking Saccharomyces cerevisiae BY4741 genome and pYES2-EGFP plasmid as DNA templates, taking GS linker-Sed1-F/R and HQM-F/R as primers to carry out PCR amplification, and referring to a PCR system

Instructions for use of Super-Fidelity DNA Polymerase. The annealing temperature was adjusted to 55 ℃. And recovering the amplified PCR fragment through DNA gel, and carrying out subsequent experiments.

4. The commercial plasmid pYES 2/CT/alpha-Factor is digested by EcoRI and Xba I, linearized, the recovered DNA fragments of HQM, dockerin and linker (Sed1-GS linker) with homologous arms and linearized plasmid fragments are connected by In-Fusion technology and transferred into Escherichia coli competent cell DH5 alpha, and 2 mu vector is obtained by colony PCR, gene sequencing and subsequent digestion and other tests: PYES2-e GFP-Sed1 (PUC-GAP-. alpha. -factor-pepA-SED 1).

Example 2

Cloning of the acid protease encoding gene pepA of Aspergillus usamii (A. usamii)

The pepA gene is searched for a corresponding sequence (GenBank TM access number XM-001401056) through NCBI, synthesized by Biotech engineering, and an upstream primer pepA-F of the pepA gene fragment is amplified by using Phanta @ Turbe Super-Fidelity DNA Polymerase (system is referred to Bao biological official gaku network); the downstream primer pepA-R is directly purified and recovered by using a kit. The following table shows the target fragment PCR system and PCR reaction conditions: 95 ℃ for 3min, (98 ℃ 10sec, 55 ℃ 15sec, 72 ℃ 30 sec). times.30 cycles, 72 ℃ for 5 min. The reaction system is shown in Table 3.

TABLE 3 PCR amplification reaction System of acidic protease encoding Gene pepA

Example 3

Construction of TFP6 factor expression vector

The carrier PUC-GAP-alpha-factor-HQM-SED 1 of the TFP6 is subjected to double enzyme digestion by fast cutting enzymes Sph I and Cla I, and the kit is directly purified and recovered; then, the target gene fragment and the linearized plasmid vector were ligated by a one-step Cloning method (the procedure is described In the Takara In Fusion RHD Cloning Kit). The specific operation steps refer to an OMEGA plasmid extraction kit and a DNA purification and recovery kit of Tiangen. The double enzyme system is shown in Table 4.

TABLE 4 double enzyme digestion System

Example 4

Transformed Saccharomyces cerevisiae and recombinant screening

(1) E.coli transformation, namely immediately performing E.coli DH5 alpha (purchased from Takara Shuzo) transformation on the expression vector subjected to one-step cloning connection, coating the E.coli DH5 alpha on an LB-Amp solid plate, culturing for 12-14 h at 37 ℃, selecting a single colony, performing colony PCR verification by using a Taq enzyme system (reference Takara Shuzo), inoculating the successfully verified Escherichia coli single colony in an LB-Amp liquid culture medium, and performing shake culture for 12h at 37 ℃ and 180 rpm. The one-step cloning system is shown in Table 5.

TABLE 5 one-step cloning System

Before use, the coli DH5 alpha competence is thawed on ice, mixed cells cannot be shaken vigorously, DNA samples (2.5 mu L of DNA samples are added into 50 mu L competence), the ice is placed for 30min, metal bath is carried out at 42 ℃ for 60s, the ice is placed for 1-2 min, SOC liquid culture medium or LB liquid culture medium is added to be recovery liquid, the final volume is 1mL, the ice is subjected to shaking culture at 37 ℃ and 200rpm for 1h, part of supernatant is removed by centrifugation by about 900 mu L, bacterial liquid is left after shaking dispersion by about 100 mu L, 50 mu L of supernatant is sucked and coated on an LB-Amp plate, the constant temperature incubator is carried out at 37 ℃ for 12h, and then PCR verification of coliform Taq enzyme is carried out. The Taq enzyme PCR system is shown in Table 6, and the program is pre-denaturation at 94 ℃ for 3 min; 30s at 98 ℃, 30s at 55 ℃ and 40s at 72 ℃ for 32 cycles; 2min at 72 ℃; stopping at 4 ℃.

TABLE 6 Taq enzyme PCR System

Insertion of target enzyme genes into the yeast genome: extracting recombinant plasmid containing target fragment pepA in escherichia coli by using an OMEGA plasmid extraction kit, performing single enzyme digestion by using DNA restriction fast-cutting enzyme SmaI, and purifying and recycling the kit. And (2) clicking and converting the recovered DNA fragment to SD-Ura defective saccharomyces cerevisiae haploid BY4741 for electrotransformation (homologous recombination of a target enzyme fragment and a yeast genome occurs BY virtue of a His3 histidine homology arm), coating the target enzyme fragment on an SD-Ura flat plate, culturing at the constant temperature of 30 ℃ for 48 hours, selecting a yeast single colony to carry out yeast colony PCR verification on recombinant yeast, wherein a Taq enzyme system PCR verification primer: an upstream primer is His-f, a downstream primer is pepA-R, and the program is pre-denaturation at 94 ℃ for 3 min; 30s at 98 ℃, 30s at 55 ℃ and 40s at 72 ℃ for 32 cycles; 4min at 72 ℃; stopping at 4 ℃. The Sma I enzyme single enzyme digestion system is shown in Table 7.

TABLE 7 Sma I enzyme Single cleavage System

Example 5

Enzyme activity determination of recombinant pepA acid protease saccharomyces cerevisiae

Drawing a standard curve: the preparation concentrations are respectively (unit: mu g/ml): 0. 20, 40, 60, 80 and 100 of tyrosine solution, taking l ml (making 4 parallel samples) respectively, adding into different test tubes, adding diluted welan reagent l ml and 0.4mol/l of sodium carbonate 5ml respectively, shaking up, placing in a water bath kettle, and preserving heat at 40 ℃ for color development for 20 min. Then, the colorimetric determination was carried out on an ultraviolet-visible spectrophotometer (wavelength: 680nm, tyrosine reaction solution at concentration: 0. mu.g/ml was used as a blank).

TABLE 8 tyrosine Standard Curve preparation

(2) The determination of enzyme activity is that 1.0mL of thalli suspended by lactic acid buffer solution with the pH value of 3.0 is added into a 5mL centrifuge tube, the thalli are placed in a water bath at 40 ℃ for preheating for 3min, a liquid transfer gun absorbs 1.0mL of casein into the centrifuge tube, the heat preservation is carried out in a water bath pot at 40 ℃ for 10min, then 2.0mL of trichloroacetic acid solution is added, the thalli are taken out, the thalli are placed statically at normal temperature for 10min, and then the thalli are centrifuged at 12000rpm for 1 min. The pipette gun aspirates 1.0mL of the supernatant into a 10mL test tube, and simultaneously adds 5.0mL of sodium carbonate solution and 1.0mL of formalin reagent solution, and develops color in a 40 ℃ water bath for 20min at constant temperature.

(3) Calculation of enzyme Activity protease activity ═ A × 4 × N/10 in the formula: a-tyrosine release by reference to the standard curve; taking out 1ml of 4-4 ml of reaction liquid; dilution factor of N-enzyme; 10-reaction time 10 min. Definition of acid protease enzyme activity: hydrolysis of casein at 40 ℃ per minute produces 1 μ g tyrosine per minute defined as one protease activity unit. The relationship between the OD value of the positive clone haploid BY4741-i and the time is shown in Table 9, and the relationship between the enzyme activity of the acid protease and the time is shown in Table 9.

TABLE 9 Positive clones haploid BY4741-i

And (4) analyzing results: the target gene and the linearized vector are connected by a one-step cloning method, and the acid protease gene is displayed on the surface of a saccharomyces cerevisiae cell, so that the secretion performance of the enzyme can be greatly improved, and the enzyme activity is obviously improved.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> northwest agriculture and forestry science and technology university

<120> saccharomyces cerevisiae engineering bacteria for displaying acid protease on cell surface, and construction method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1182

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtcgtct tcagcaaaac cgctgccctc gttctgggtc tgtccaccgc cgtctctgcg 60

gcaccggctc ccactcgcaa gggcttcacc atcaaccaga ttgcccggcc tgccaacaag 120

acccgcaccg tcaacttgcc gggtttgtat gcccgttccc tggccaagtt tggcggtacg 180

gtgccccaga gcgtgaagga ggctgccagc aagggtagtg ccgtgaccac gccccagaac 240

aatgacgagg agtacctgac tcccgtcact gtcggaaagt ccacccttca tctggacttt 300

gacaccggat ctgcagatct ctgggtcttc tcagacgagc tcccttcctc ggagcagacc 360

ggtcacgatc tgtacacgcc tagctccagc gcgaccaagt tgagcggcta ctcttgggac 420

atctcttacg gtgacggcag ctcggccagc ggagacgtct accgggatac tgtcactgtt 480

ggcggtgtca ccaccaacaa gcaggccgtt gaagctgcca gcaagatcag ctccgagttc 540

gttcaggaca cggccaatga tggtcttctg ggtctggcct tcagctccat caacactgtc 600

cagcccaagg cacagaccac cttcttcgac accgtcaagt ctcagctgga ctctcctctt 660

ttcgccgtgc agttgaagca cgacgcccct ggtgtctacg actttggcta catcgatgac 720

tccaagtaca ccggttccat cacctacacg gatgccgata gctcccaggg ctactggggc 780

ttcagcaccg acggctacag catcggcgac ggcagctcca gctccagcgg cttcagcgcc 840

attgctgaca ccggtaccac cctcatcctc ctcgacgatg agatcgtttc cgcctactac 900

gagcaggttt ccggcgccca ggagagctat gaagctggtg gctacgtttt ctcttgctct 960

actgaccttc ctgacttcac cgtcgtgatc ggcgactaca aggccgtcgt tcctggcaag 1020

tacatcaact acgctcccgt ttcgaccggc agctccacct gctacggcgg tatccagagc 1080

aacagcggtc tcggactgtc catcctgggt gatgtgttct tgaagagcca gtacgtggtc 1140

ttcaactctg agggacctaa gctgggcttt gctgctcagg ct 1182

<210> 2

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agagaggctg aagctatcga tatggtcgtc ttcagcaaaa ccgct 45

<210> 3

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cagaaccacc accaccgcat gcagcctgag cagcaaagcc cagctt 46

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtgttgcta tgttattctt ataatctaga gggcccttcg aaggt 45

<210> 5

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtggtggtg gttctggtgg tggtggttct ggtggtggtg gttctaaatt atcaactgtc 60

ctattatct 69

<210> 6

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gctgaagctt acgtagaatt catggtgagc aagggcgagg agctg 45

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agaaccacca ccaccgcatg ccttgtacag ctcgtccatg ccgag 45

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcgtaccacc accattacac atgt 24

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cctgcctgga gtaaatgatg acac 24

Claims

1. A construction method of a saccharomyces cerevisiae engineering bacterium for displaying acid protease on the cell surface is characterized by comprising the following steps:

2. The construction method according to claim 1, wherein the nucleotide sequence of the codon-optimized acid protease encoding gene is as shown in SEQ ID NO: 1 is shown.

3. The construction method according to claim 1, wherein the primers for amplifying the gene encoding acidic protease are pepA-F/pepA-R;

the nucleotide sequence of pepA-R is shown as SEQ ID NO: 3, respectively.

4. The method according to claim 1, wherein the method for constructing PUC-GAP- α -factor-SED1 comprises the steps of:

A. taking a genome of saccharomyces cerevisiae as a template, and carrying out PCR amplification by adopting a GS linker-Sed1-F/Sed1-R primer pair to obtain a DNA fragment of Sed1-GS linker;

the nucleotide sequence of the GS linker-Sed1-F is shown as SEQ ID NO: 5 is shown in the specification;

the nucleotide sequence of the Sed1-R is shown as SEQ ID NO: 4 is shown in the specification;

5. The construction method according to claim 4, wherein the insertion multiple cloning site of the Saccharomyces cerevisiae surface display expression vector is SphI/Cla I.

6. The construction method according to any one of claims 1, 4 and 5, wherein the host strain Saccharomyces cerevisiae comprises Saccharomyces cerevisiae BY4741 strain.

7. The saccharomyces cerevisiae engineering bacteria with the cell surface displaying the acid protease constructed by the construction method of any one of claims 1-6, wherein the acid protease is stably expressed on the cell surface of the saccharomyces cerevisiae engineering bacteria.

8. The saccharomyces cerevisiae engineering bacteria of claim 7, wherein the enzyme activity of the acid protease of the saccharomyces cerevisiae engineering bacteria is 4.01-5.80U/mL.

9. Use of the engineered saccharomyces cerevisiae strain of claim 7 or 8 in catalyzing protein hydrolysis.

10. A whole-cell catalyst for catalyzing proteolysis, which contains the engineered Saccharomyces cerevisiae strain of claim 7 or 8.