CN110923215B - Method for producing rhizomucor miehei lipase mRML enzyme powder - Google Patents
Method for producing rhizomucor miehei lipase mRML enzyme powder Download PDFInfo
- Publication number
- CN110923215B CN110923215B CN201811092251.1A CN201811092251A CN110923215B CN 110923215 B CN110923215 B CN 110923215B CN 201811092251 A CN201811092251 A CN 201811092251A CN 110923215 B CN110923215 B CN 110923215B
- Authority
- CN
- China
- Prior art keywords
- mrml
- supernatant
- fermentation liquor
- enzyme powder
- rhizomucor miehei
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
- C12N9/20—Triglyceride splitting, e.g. by means of lipase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
A method for producing Rhizomucor miehei lipase mRML enzyme powder comprises the following steps: constructing an engineering strain containing lipase gene mRML and capable of expressing mRML; culturing an engineering strain; obtaining fermentation liquor containing rhizomucor miehei lipase mRML through induced expression; centrifuging the fermentation liquor, taking the supernatant, adjusting the pH to 7.0, and then placing the supernatant in a low-temperature environment until the surface of the supernatant is frozen; adding precooled acetone into the supernatant, standing, removing the supernatant, and collecting the precipitate; air-drying the precipitate to obtain the Rhizomucor miehei lipase mRML enzyme powder. The method for producing the Mucor miehei lipase mRML enzyme powder takes 50mL of fermentation liquor as a research object, the volume ratio of acetone to the fermentation liquor is 2:1, and when the pH value of the fermentation liquor is adjusted to 5.0-7.0, the recovery rate of the enzyme activity is kept above 70%. When the pH value of the fermentation liquor is 7.0, the recovery rate of the enzyme is highest, the weight of the obtained enzyme powder is 1.373g, the specific activity of the enzyme powder is 3367U/g, and the recovery rate of the enzyme powder is 94.4%, which is obviously superior to that of the existing production method.
Description
Technical Field
The invention relates to the fields of molecular biology and genetic engineering, in particular to a method for producing Rhizomucor miehei lipase mRML enzyme powder.
Background
Lipases (E C3.1.1.3) are a class of enzymes that can hydrolyze triacylglycerols, catalyzing a variety of chemical reactions such as: hydrolysis, esterification, transesterification, ammonolysis, etc., and has the advantages of mild reaction conditions, strong specificity, no pollution, etc., and is widely applied to the industries of food, medicine, cosmetics, petroleum, etc., which is called as the third industrial enzyme. The enzyme powder is one of the commonly used forms for preserving the enzyme, and has the advantages of convenient preservation, transportation, good stability and the like. Rhizomucor miehei lipase is a1, 3 position specific lipase, and can be used for preparing milk flavor essence, producing biodiesel and other aspects.
Disclosure of Invention
The invention aims to provide a method for producing rhizomucor miehei lipase mRML enzyme powder.
In order to achieve the purpose, the technical scheme of the invention is as follows:
a method for producing Rhizomucor miehei lipase mRML enzyme powder comprises the following steps:
s1: constructing an engineering strain containing lipase gene mRML and capable of expressing mRML;
s2: culturing an engineering strain;
s3: obtaining fermentation liquor containing rhizomucor miehei lipase mRML through induced expression;
s4: centrifuging the fermentation liquor, taking the supernatant, adjusting the pH to 7.0, and then placing the supernatant in a low-temperature environment until the surface of the supernatant is frozen;
s5: adding precooled acetone into the supernatant, standing, removing the supernatant, and collecting the precipitate;
s6: air-drying the precipitate to obtain the Rhizomucor miehei lipase mRML enzyme powder.
Preferably, the engineering strain is pichia pastoris.
Preferably, the inducing condition in step S3 is to supplement inducer methanol every 24 hours to a final methanol concentration of 1.0% (v/v).
Preferably, the step S4 specifically includes: centrifuging the fermentation liquid at 4 deg.C and 5000rpm for 10min, taking 40 volume parts of supernatant of the fermentation liquid, placing in a container, adjusting pH to 7.0, and placing the container in-20 deg.C environment until the liquid surface in the container is frozen.
Preferably, the step S5 specifically includes: adding 8 parts by volume of acetone precooled at the temperature of-20 ℃ into a container, slowly stirring while adding, then standing for 10min at the temperature of-20 ℃, then slowly adding 72 parts by volume of acetone precooled at the temperature of-20 ℃ into the container, slowly stirring while adding, then standing for 2-3h at the temperature of-20 ℃, centrifuging the mixed solution in the container for 10min at the temperature of 4 ℃ at 8000rpm, removing the supernatant, and collecting the precipitate.
The invention has the beneficial effects that: the method for producing the Mucor miehei lipase mRML enzyme powder takes 50mL of fermentation liquor as a research object, the volume ratio of acetone to the fermentation liquor is 2:1, and when the pH value of the fermentation liquor is adjusted to 5.0-7.0, the recovery rate of the enzyme activity is kept above 70%. When the pH value of the fermentation liquor is 7.0, the recovery rate of the enzyme is highest, the weight of the obtained enzyme powder is 1.373g, the specific activity of the enzyme powder is 3367U/g, and the recovery rate of the enzyme powder is 94.4%, which is obviously superior to that of the existing production method.
Drawings
FIG. 1 is a flow chart of the construction of pPICZ. alpha.A-mrml expression plasmid;
FIG. 2 z α -mRML-X33 Shake flask fermentation for enzyme production.
The specific implementation mode is as follows:
the following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The percent in the present invention means mass percent unless otherwise specified; but the percentage of the solution, unless otherwise specified, means that 100ml of the solution contains several grams of solute; the percentage between the liquids refers to the ratio of the volumes at 20 ℃. The steps of conventional experimental operations such as enzyme digestion, ligation, recovery, transformation, PCR amplification and the like are described in molecular cloning (third edition). Primer synthesis and sequencing was done by english jun (Invitrogen) bio-inc.
The invention clones 1, 3-position specific lipase (m-RML) gene m-RML from Rhizomucor miehei strain, the nucleotide sequence is shown as SEQ ID No.1, the total length of the gene is (810) bp, analysis shows that GC content is (49.8)%, and protein consisting of (269) amino acids is coded. The amino acid sequence of the Rhizomucor miehei lipase coded by the gene is shown in SEQ ID No. 2. The protein has the size of 29.5kDa, the isoelectric point is predicted to be 4.88(http:// web. expasy. org/computer _ pi /), and the active center is Ser at position 144, His at position 257 and Asp at position 203. The enzyme has an optimum reaction temperature of 45 deg.C, an optimum reaction pH of 8.0, and stability at pH 4.0-9.0, as determined by enzymology properties. For convenience of description, the lipase was named mRML.
EXAMPLE 1 preparation of Mucor miehei cDNA
1.1 extraction of Total RNA from Mucor miehei
(1) Taking appropriate amount of Rhizomucor miehei mycelium, drying with filter paper, grinding with liquid nitrogen, adding 1ml Trizol reagent (Invitrogen), shaking with oscillator for 5min, and standing at room temperature for 1 min;
(2) adding 0.2ml chloroform, shaking for 15s, and standing for 2 min;
(3)4℃，12000rpm，15min；
(4) sucking supernatant, adding equal volume of isopropanol, and precipitating at-20 deg.C for 30 min;
(5)4℃，12000rpm，15min；
(6) the supernatant was decanted off and the precipitate was washed with 1ml of 75% ethanol at 7500rpm, 4 ℃ for 5 min;
(7) repeating the step (6) once;
(8) pouring off the supernatant, and drying for 10 min;
(9) adding a proper amount of DEPC water to dissolve to obtain total RNA;
1.2 preparation of the first Strand of the cDNA of Mucor miehei
The reverse transcription was specifically performed using reverse transcriptase (MMLV) manufactured by Promega corporation as follows:
a25. mu.l reaction was prepared by adding the following ingredients to a nuclease-free centrifuge tube:
bathing at 42 deg.C for 60 min; heating at 95 deg.C for 5min to terminate reaction, and freezing for storage.
Example 2 primer design of Mucor miehei Lipase Gene m-rml
2.1 primer design
Based on the sequence of the rml gene in GenBank (GenBank accession No. A02536.1), the following pair of primers were designed and synthesized:
FW(P1)：5’—CCGGAATTCAGCATTGATGGTGG—3’(SEQ ID No.3)
REV(P2)：5’—CTAGTCTAGAGTACAGAGGCCTGTG—3’(SEQ ID No.4)
the two ends of P1 and P2 are respectively designed with EcoR I and Xba I enzyme cutting sites (see the italic and underlined parts in the above sequence)
2.2 PCR amplification of Mucor miehei Lipase m-rml
Adopting P1 and P2 primers, taking Mucor miehei cDNA as a template, and adopting a PCR reaction system as follows:
the reaction conditions are as follows: circulating 30 times at 95 deg.C for 5min, 5 deg.C for 40s, 60 deg.C for 40s, and 72 deg.C for 1min, at 72 deg.C for 10min, and at 4 deg.C for 2 min.
2.3 recovery of the fragment of interest from the PCR reaction product
The target gene fragment is purified and recovered from the PCR product by a gel cutting and column passing method, the PCR reaction product is subjected to agarose gel electrophoresis, the target gene DNA is cut under the irradiation of an ultraviolet lamp, the length of the target gene is 810bp, and the target gene is recovered according to the method of the DNA recovery kit instruction (purchased from Tiangen company, and the product number is DP 209-02).
2.4 cloning of TA
The PCR-recovered product was ligated to the vector pPICZ. alpha.A (purchased from Invitrogn), the objective genes mrml and pPICZ. alpha.A were double digested with restriction enzymes EcoR I and Xba I, respectively, recovered, ligated with T4 ligase, and the ligation product was transformed into E.coli DH 5. alpha. (purchased from Shanghai Bioengineering Co., Ltd.). The expression plasmid pPICZ alpha A-mrml was obtained (see FIG. 1 for the construction scheme). The expression plasmid pPICZ alpha A-mrml is transferred into Escherichia coli DH5 alpha for amplification and PCR detection, and sent to invitrogen company for sequencing.
Example 3 secretory expression of pPICZ. alpha.A-mrml vector electrotransformation into Pichia pastoris X-33
3.1 preparation of Pichia pastoris X-33 (purchased from Invitrogen) electrotransformation competent cells and electroporation thereof
(1) Picking fresh single colony in 5ml YPD liquid culture medium, culturing at 30 deg.c and 250rpm for 12-14 hr;
(2) inoculating into 2L Erlenmeyer flask containing 500ml YPD medium at 0.1%, culturing at 30 deg.C and 250rpm for 12-14 hr to make OD600＝1.3-1.5；
(3) Centrifuging at 1500rpm at 4 deg.C for 5min, and collecting cells;
(4) cells were washed twice with 500-;
(5) the cells were washed once with 20ml of ice-pre-chilled 1M sorbitol solution;
(6) resuspending the cells with 1ml of ice-precooled 1M sorbitol solution to a final volume of about 1.5ml, and packaging in 80. mu.l small centrifuge tubes;
3.2 electroporation transformation of Pichia pastoris cells
(1) About 10. mu.l of the prepared non-linearized expression plasmid at about 100. mu.g/. mu.l was mixed with 80. mu.l of yeast competent cells, and left on ice for about 5 minutes;
(2) transferring the DNA-mixed competent cells into an ice-precooled 0.2cm electric rotor;
converting at a voltage of 1.5 kilovolts;
(3) then 1ml of ice-pre-cooled 1M sorbitol solution was immediately added to the transformed cells, the cells were mixed well and transferred to a 1.5ml small centrifuge tube and allowed to stand at 30 ℃ for 1-2 h.
(4) 50-200ul of the resulting suspension was spread on YPDS plates (yeast extract 1%, peptone 2%, dextrase 2%, Sorbitol 1M, agar 2%,) containing 100ug/ml, and cultured at 30 ℃ for 2 to 3 days to observe the results.
3.3. Identification of correctly integrated transformants by the yeast colony PCR method
Positive colonies were selected on the plates and further verified to give correctly integrated transformants by the yeast colony PCR method using 5 'AOX 1, 3' AOX1 as primers.
The primer sequence is as follows: 5' AOX 1: 5'-GACTGGTTCCAATTGACAAGC-3' (SEQ ID No.5)
3’AOX1：5′-GCAAATGGCATTCTGACATCC-3′(SEQ ID No.6)
The template processing method comprises the following steps:
(1) a small amount of colonies were picked up with a sterile pipette tip and dissolved in 50. mu.l of D2-Buffer (1L: guanidinium isothiocyanate 472.64g,1 mol/L50 ml of pH8.0Tris-HCl Buffer, 7ml of. beta. -mercaptoethanol) and mixed well;
(2) placing the mixed solution in 100 deg.C boiling water bath for 5 min;
(3) centrifuging at 12000rpm for 30s, and discarding the supernatant;
(4) washing the precipitate with sterile water for 2 times;
(5) the precipitate was dissolved in 20. mu.l of ddH2O, acting at 95 ℃ for 5 min;
(6) and centrifuging to obtain supernatant as the template.
And (3) PCR reaction system:
reaction conditions are as follows: 5min at 95 ℃; 30cycles at 95 ℃ for 40s, 60 ℃ for 40s, 72 ℃ for 1min for 30 s; 10min at 72 ℃.
3.4. Expression of a lipase of interest in Pichia pastoris
Determination of lipase activity by NaOH titration
(1) Preparation of 0.05M NaOH: first use without CO2Preparing 5M NaOH stock solution by using water; accurately diluting by 50 times, weighing 0.38g of potassium hydrogen phthalate, drying at 100 deg.C to constant weight, and dissolving in 80ml of solution without CO2In water, calibrating the accurate concentration of the stock solution, and then calculating the concentration of the stock solution; 0.05M NaOH solution to free of CO2Preparing water in situ after using a stock solution;
(2) preparation of PVA-olive oil emulsion substrate: mixing 100ml of olive oil and 300ml of 2% PVA1750 (polyvinyl alcohol), heating for dissolving, emulsifying by ultrasonic waves with the power of 300W, the ultrasonic waves for 3s, the intermittence for 4s, the circulation for 99 times and the like;
(3) adding 5ml of emulsion substrate and 4ml of 0.1M disodium hydrogen phosphate-citric acid buffer solution with pH of 6.0 into a 150ml triangular flask, placing in a constant temperature water bath shaker at 35 ℃, and incubating for 5min at 150 rpm;
(4) adding 1ml of properly diluted enzyme solution into the substrate and the buffer solution, reacting at 35 ℃ and 150rpm for 10min, and adding 15ml of absolute ethyl alcohol to terminate the reaction;
(5) dripping 4 drops of phenolphthalein as an indicator, and titrating the fatty acid generated by enzymolysis by using 0.05M NaOH until the reaction solution turns pink;
the blank operation is identical to that described above except that the fermentation broth is mixed with absolute ethanol for 10min and added to the substrate and buffer.
The enzyme activity is defined as the amount of enzyme that releases 1. mu. mol of fatty acid in 1min under the measurement conditions as one unit of enzyme activity.
The za-mRML-X33 was inoculated into 25ml BMGY medium (1% yeast powder, 2% peptone, 1% glycerol) and shake-cultured at 28 ℃ and 200rpm to OD600About 4.0-8.0, transferring into 500ml triangular flask containing 50ml BMMY culture medium (1% yeast powder, 2% peptone, 1.0% methanol, 100mmol/l phosphate buffer solution, pH 7.0), continuing culturing under the same culture condition, supplementing 100% methanol to the culture medium every 24 hours until the final concentration is 1.0%, and inducing expression for 6 days. Sampling at regular intervals, and measuring the enzyme activity of the extracellular Rhizomucor miehei lipase.
As shown in the attached figure 2, under the condition of shake flask culture of BMMY medium (initial pH 7 and culture temperature 28 ℃) for 4 days, the za-mRML-X33 enzyme activity reaches the maximum 98U/mL.
3.5 preparation of enzyme powder
(1) Collecting fermentation liquor: centrifuging the fermentation liquid at 4 deg.C and 5000rpm for 10min, collecting supernatant 50mL, adjusting pH to 5.0-7.0, and standing at-20 deg.C until the surface is frozen.
(2) Adding 8mL of acetone (precooled at-20 ℃ in advance) into the fermentation liquor obtained in the step (1), slowly stirring while adding, and standing for 10min at-20 ℃;
(3) slowly adding 72mL of acetone (precooled at-20 ℃) into the mixture obtained in the step (2), slowly stirring the mixture while adding the acetone, and standing the mixture for 2 to 3 hours at-20 ℃;
(4) centrifuging the mixed solution in the step (3) at 8000rpm and 4 ℃ for 10min, removing supernatant, and collecting precipitate;
(5) adding precooled acetone with the volume 2 times that of the precipitate into the precipitate in the step (4), uniformly stirring, and centrifuging at the temperature of 4 ℃ and the rpm of 8000 for 10 min;
(6) repeating the step (5) once;
(7) the precipitate was air-dried in a fume hood, and enzyme powder was obtained.
The results are shown in Table 1, 50mL of fermentation broth is used as the research object, the volume ratio of acetone to the fermentation broth is 2:1, and when the pH of the fermentation broth is adjusted to 5.0-7.0, the recovery rate of the enzyme activity is kept above 70%. When the pH value of the fermentation liquor is 7.0, the recovery rate of the enzyme is highest, the weight of the obtained enzyme powder is 1.373g, the specific activity of the enzyme powder is 3367U/g, and the recovery rate of the enzyme powder is 94.4%.
TABLE 150mL fermentation broths at different pH to obtain enzyme powder properties
Sequence listing
<110> university of Jiangsu profession
<120> method for producing Rhizomucor miehei lipase mRML enzyme powder
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 810
<212> DNA
<213> Mucor miehei Rice (Rhizomucor miehei)
<400> 1
agcattgatg gtggtatccg cgctgcgacc tcgcaagaaa tcaatgaatt gacttattac 60
actacactat ctgccaactc gtactgccgc actgtcattc ctggagctac ctgggactgt 120
atccactgtg atgcaacgga ggatctcaag attatcaaga cttggagcac gctcatctat 180
gatacaaatg caatggttgc acgtggtgac agcgaaaaaa ctatctatat cgttttccga 240
ggttcgagct ctatccgcaa ctggattgct gatctcacct ttgtgccagt ttcatatcct 300
ccggtcagtg gtacaaaagt acacaaggga ttcctggaca gttacgggga agttcaaaac 360
gagcttgttg ctactgttct tgatcaattc aagcaatatc caagctacaa ggttgctgtt 420
acaggtcact cactcggtgg tgctactgcg ttgctttgcg ccctgggtct ctatcaacga 480
gaagaaggac tctcatccag caacttgttc ctttacactc aaggtcaacc acgggtaggc 540
gaccctgcct ttgccaacta cgttgttagc accggcattc cttacaggcg cacggtcaat 600
gaacgagata tcgttcctca tcttccacct gctgcttttg gttttctcca cgctggcgag 660
gagtattgga ttactgacaa tagcccagag actgttcagg tctgcacaag cgatctggaa 720
acctctgatt gctctaacag cattgttccc ttcacaagtg ttcttgacca tctctcgtac 780
tttggtatca acacaggcct ctgtacttaa 810
<210> 2
<211> 269
<212> PRT
<213> Mucor miehei Rice (Rhizomucor miehei)
<400> 2
Ser Ile Asp Gly Gly Ile Arg Ala Ala Thr Ser Gln Glu Ile Asn Glu
1 5 10 15
Leu Thr Tyr Tyr Thr Thr Leu Ser Ala Asn Ser Tyr Cys Arg Thr Val
20 25 30
Ile Pro Gly Ala Thr Trp Asp Cys Ile His Cys Asp Ala Thr Glu Asp
35 40 45
Leu Lys Ile Ile Lys Thr Trp Ser Thr Leu Ile Tyr Asp Thr Asn Ala
50 55 60
Met Val Ala Arg Gly Asp Ser Glu Lys Thr Ile Tyr Ile Val Phe Arg
65 70 75 80
Gly Ser Ser Ser Ile Arg Asn Trp Ile Ala Asp Leu Thr Phe Val Pro
85 90 95
Val Ser Tyr Pro Pro Val Ser Gly Thr Lys Val His Lys Gly Phe Leu
100 105 110
Asp Ser Tyr Gly Glu Val Gln Asn Glu Leu Val Ala Thr Val Leu Asp
115 120 125
Gln Phe Lys Gln Tyr Pro Ser Tyr Lys Val Ala Val Thr Gly His Ser
130 135 140
Leu Gly Gly Ala Thr Ala Leu Leu Cys Ala Leu Gly Leu Tyr Gln Arg
145 150 155 160
Glu Glu Gly Leu Ser Ser Ser Asn Leu Phe Leu Tyr Thr Gln Gly Gln
165 170 175
Pro Arg Val Gly Asp Pro Ala Phe Ala Asn Tyr Val Val Ser Thr Gly
180 185 190
Ile Pro Tyr Arg Arg Thr Val Asn Glu Arg Asp Ile Val Pro His Leu
195 200 205
Pro Pro Ala Ala Phe Gly Phe Leu His Ala Gly Glu Glu Tyr Trp Ile
210 215 220
Thr Asp Asn Ser Pro Glu Thr Val Gln Val Cys Thr Ser Asp Leu Glu
225 230 235 240
Thr Ser Asp Cys Ser Asn Ser Ile Val Pro Phe Thr Ser Val Leu Asp
245 250 255
His Leu Ser Tyr Phe Gly Ile Asn Thr Gly Leu Cys Thr
260 265
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccggaattca gcattgatgg tgg 23
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctagtctaga gtacagaggc ctgtg 25
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gactggttcc aattgacaag c 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gcaaatggca ttctgacatc c 21
Claims (1)
1. A method for producing Rhizomucor miehei lipase mRML enzyme powder is characterized by comprising the following steps:
s1: constructing an engineering strain containing lipase gene mRML and capable of expressing mRML; the nucleotide sequence of the lipase gene mrml is shown as SEQ ID No.1, and the engineering strain is Pichia pastoris;
s2: culturing an engineering strain;
s3: obtaining fermentation liquor containing rhizomucor miehei lipase mRML through induction expression, wherein the induction condition is that inducer methanol is supplemented every 24 hours until the final concentration of the methanol is 1.0% v/v;
s4: centrifuging the fermentation liquor at 4 ℃ and 5000rpm for 10min, then taking 40 parts by volume of supernatant of the fermentation liquor, placing the supernatant in a container, adjusting the pH to 7.0, and placing the container in an environment at-20 ℃ until the liquid surface in the container is frozen;
s5: adding 8 parts by volume of acetone precooled at the temperature of-20 ℃ into a container, slowly stirring while adding, then standing for 10min at the temperature of-20 ℃, then slowly adding 72 parts by volume of acetone precooled at the temperature of-20 ℃ into the container, slowly stirring while adding, then standing for 2-3h at the temperature of-20 ℃, centrifuging for 10min at the temperature of 4 ℃ at 8000rpm, removing supernatant, and collecting precipitate;
s6: adding pre-cooled acetone with the volume 2 times that of the precipitate into the precipitate obtained in the step S5, uniformly stirring, and centrifuging for 10min at 8000rpm and 4 ℃; repeating the operation once;
s7: air-drying the precipitate to obtain the Rhizomucor miehei lipase mRML enzyme powder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811092251.1A CN110923215B (en) | 2018-09-19 | 2018-09-19 | Method for producing rhizomucor miehei lipase mRML enzyme powder |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811092251.1A CN110923215B (en) | 2018-09-19 | 2018-09-19 | Method for producing rhizomucor miehei lipase mRML enzyme powder |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923215A CN110923215A (en) | 2020-03-27 |
| CN110923215B true CN110923215B (en) | 2021-08-10 |
Family
ID=69855069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811092251.1A Active CN110923215B (en) | 2018-09-19 | 2018-09-19 | Method for producing rhizomucor miehei lipase mRML enzyme powder |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923215B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS5948073A (en) * | 1982-09-13 | 1984-03-19 | Mitsui Petrochem Ind Ltd | Preparation of lipase |
| CN101374947A (en) * | 2006-01-23 | 2009-02-25 | 诺维信公司 | Polypeptides having lipase activity and polynucleotides encoding the same |
| CN101960008A (en) * | 2008-02-29 | 2011-01-26 | 诺维信公司 | Polypeptides having lipase activity and polynucleotides encoding same |
| CN103361327A (en) * | 2013-07-19 | 2013-10-23 | 中国农业大学 | Recombinant pichia pastoris for heterogenous high level expression of lipase |
| CN103981197A (en) * | 2014-04-21 | 2014-08-13 | 中国科学院广州能源研究所 | Novel leader peptide-containing rhizomucor mieheilipase gene and expression of rhizomucor mieheilipase gene in pichia pastoris |
| CN106459937A (en) * | 2014-05-27 | 2017-02-22 | 诺维信公司 | Methods for producing lipases |
| CN108239627A (en) * | 2016-12-27 | 2018-07-03 | 丰益(上海)生物技术研发中心有限公司 | The lipase and its application that activity improves |
| CN108239648A (en) * | 2016-12-26 | 2018-07-03 | 丰益(上海)生物技术研发中心有限公司 | The method of high efficient expression rhizomucor miehei lipase |
-
2018
- 2018-09-19 CN CN201811092251.1A patent/CN110923215B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS5948073A (en) * | 1982-09-13 | 1984-03-19 | Mitsui Petrochem Ind Ltd | Preparation of lipase |
| CN101374947A (en) * | 2006-01-23 | 2009-02-25 | 诺维信公司 | Polypeptides having lipase activity and polynucleotides encoding the same |
| CN101960008A (en) * | 2008-02-29 | 2011-01-26 | 诺维信公司 | Polypeptides having lipase activity and polynucleotides encoding same |
| CN103361327A (en) * | 2013-07-19 | 2013-10-23 | 中国农业大学 | Recombinant pichia pastoris for heterogenous high level expression of lipase |
| CN103981197A (en) * | 2014-04-21 | 2014-08-13 | 中国科学院广州能源研究所 | Novel leader peptide-containing rhizomucor mieheilipase gene and expression of rhizomucor mieheilipase gene in pichia pastoris |
| CN106459937A (en) * | 2014-05-27 | 2017-02-22 | 诺维信公司 | Methods for producing lipases |
| CN108239648A (en) * | 2016-12-26 | 2018-07-03 | 丰益(上海)生物技术研发中心有限公司 | The method of high efficient expression rhizomucor miehei lipase |
| CN108239627A (en) * | 2016-12-27 | 2018-07-03 | 丰益(上海)生物技术研发中心有限公司 | The lipase and its application that activity improves |
Non-Patent Citations (2)
| Title |
|---|
| A novel mono- and diacylglycerol lipase highly expressed in Pichiapastoris and its application for food emulsifier preparation;Jinjin Huang等;《Process Biochemistry》;20130904;第48卷;第1899-1904页 * |
| Improved production of a recombinant Rhizomucor miehei lipase expressed in Pichia pastoris and its application for conversion of microalgae oil to biodiesel;Jinjin Huang等;《Biotechnology for Biofuels》;20141231;第7卷;第1-17页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923215A (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101952469B1 (en) | Filamentous fungi having an altered viscosity phenotype | |
| JP3140206B2 (en) | A method for the synthesis of stable single-stranded cDNA in eukaryotes by bacterial retron and its products and uses | |
| CN107083373B (en) | Recombinant pichia pastoris for heterologous high-efficiency expression of lipase and application thereof | |
| CN103361327B (en) | The recombinant yeast pichia pastoris of allos high expression lipase | |
| CN107043757B (en) | Recombinant pichia pastoris for heterologous high-efficiency expression of rhizomucor miehei lipase and application thereof | |
| CN113462582B (en) | OverexpressionSpt7Genetic aspergillus niger engineering strain and application | |
| CN110923216B (en) | Method for producing rhizomucor miehei lipase pRML enzyme powder | |
| CN109402092B (en) | Chitinase derived from marine environment and gene thereof | |
| JP5438259B2 (en) | Yeast presenting Candida antarctica-derived lipase B on the cell surface | |
| CN110923215B (en) | Method for producing rhizomucor miehei lipase mRML enzyme powder | |
| CN104480125B (en) | Trachinotus ovatus thioredoxin gene | |
| CN110923260B (en) | Engineering strain for producing rhizomucor miehei lipase powder and application thereof | |
| CN111979255B (en) | Low-temperature high-yield single subunit RNA polymerase, and purification method and application thereof | |
| CN116064266B (en) | Recombinant saccharomyces cerevisiae with enhanced salt stress resistance, and construction method and application thereof | |
| CN110923259A (en) | Engineering strain for producing rhizomucor miehei lipase mRML enzyme powder and construction method thereof | |
| CN107217064B (en) | Superoxide dismutase gene and its coding albumen | |
| CN106635941A (en) | Thermophilic esterase derived from aquifex aeolicus strain and functional verification of thermophilic esterase | |
| CN111808836B (en) | Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof | |
| CN111394372B (en) | Phthalate degrading enzyme gene, its coding product and preparation method | |
| WO2014082513A1 (en) | Lipase and use thereof | |
| CN112662642B (en) | Reverse transcriptase of skin sarcoma virus of mutant type large-eyed zander and application thereof | |
| CN110551702B (en) | Recombinant aspergillus tubingensis tannase and expression and application thereof | |
| CN108192906B (en) | Engineering bacterium containing low-temperature lipase gene and construction method and application thereof | |
| Chen et al. | Functional expression, purification, and characterization of the extra stable human placental alkaline phosphatase in the Pichia pastoris system | |
| CN105368802A (en) | Salt-tolerant esterase, coding gene of salt-tolerant esterase and application of salt-tolerant esterase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |