CN113462582B

CN113462582B - OverexpressionSpt7Genetic aspergillus niger engineering strain and application

Info

Publication number: CN113462582B
Application number: CN202110310595.0A
Authority: CN
Inventors: 薛鲜丽; 王德培; 王静然; 毕杭杭; 李洁
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2021-03-24
Filing date: 2021-03-24
Publication date: 2022-07-08
Anticipated expiration: 2041-03-24
Also published as: CN113462582A

Abstract

The invention discloses overexpressionSpt7Genetic aspergillus niger engineering strain and application. It is based onΔSpt7The Aspergillus niger mutant strain presents the same strain as the original strainA. niger CGMCC 10142 has a greatly different growth form, hyphae are condensed and grow slowly, and extracellular secretion of citric acid is inhibited, so Spt7 in Aspergillus niger plays a vital role in Aspergillus niger. The engineering strain is successfully over-expressedSpt7A gene, designated: OE:Spt7a strain of Aspergillus niger. The invention aims to determine that the Spt7 can be applied to improving the antioxidant stress, the high-temperature and high-permeability resistance and the citric acid yield of Aspergillus niger.

Description

OverexpressionSpt7Genetic aspergillus niger engineering strain and application

Technical Field

The invention belongs to the technical field, and particularly relates to functions and application of a transcription regulatory factor Spt7 in an Aspergillus niger strain.

Background

SAGA (Spt-Ada-Gcn 5 Acetyltransferase complex), a multi-subunit conserved transcription cofactor, is mainly responsible for 10% of gene transcription in vivo, i.e., the Spt-Ada-Gcn5 Acetyltransferase complex. Originally discovered in s.cerevisiae and subsequently identified as present in eukaryotes such as fruit flies, rabbits, and humans. As a multifunctional protein complex, the SAGA complex realizes the conversion of chromatin structure between silent and active states through histone post-translational modification including histone acetylation and deubiquitylation, and creates a proper genetic condition for gene transcription initiation. It also acts with gene-specific transcriptional activators, universal transcription factors, and RNA polymerase II, helping recruit them to the promoter region of target genes, and directly participate in a variety of biological processes, including gene transcription, DNA damage repair, mRNA export, and the like.

Structure and function of SAGA complexes it has now been found that SAGA complexes are composed of at least 20 proteins, exemplified by saccharomyces cerevisiae, divided into four broad categories, including the transcriptional linker proteins (Ada): responsible for the acetylation of histones; spt structural protein: is responsible for the stability of the composite structure; TBP-related protein (Taf) and Tral protein: these two classes of protein subunits are related proteins of TATA BOX, and are mainly responsible for chromatin remodeling and recruitment of other transcription factors to the promoter region, and are involved in transcriptional regulation of genes. And simultaneously contains two subunits with catalytic functions, namely Gcn5 and Ubp8, which can perform acetylation and deubiquitination on histones H3 and H2B respectively. The SAGA compound is mainly involved in the regulation and control of eukaryotic genes through histone acetylation, deubiquitination and TATA binding protein functions. In addition, Spt7, Adal, Spt20 are the structural cores that constitute the SAGA complex, and together maintain the stability of the SAGA complex. Most of these components contain at least one conserved domain, which is involved in the transcriptional regulation of organisms. In recent years, the regulation of gene transcription and the influence on cell growth and ontogeny of each subunit of the SAGA complex have been extensively studied. It has been reported that the deletion of the structural regulatory gene Spt7 in SAGA in Saccharomyces cerevisiae results in the retardation of the growth of the thallus. The SAGA complex is highly conserved in eukaryotes, and homologous proteins of various subunits of the SAGA complex in Saccharomyces cerevisiae have been identified in Drosophila and humans. Although the three-dimensional structure of the SAGA complex is highly similar in yeast and human cells, it does not mean that the functions are the same, but it is useful for the functional study in higher eukaryotes.

The current research on SAGA complex with Spt7 as core component only focuses on yeast, fruit fly, human, plant organism, and there is no report on other fungi except yeast. Aspergillus niger of citric acid fermentation industrial strain is selected in the researchAspergillus nigerCGMCC 10142 and Aspergillus niger for metabolizing ochratoxinAspergillus nigerCGMCC 1062 is respectively used as an original strain and is firstly on-lineBasic research is carried out on the function and application of Spt7 in mycoides.

Disclosure of Invention

The invention is based onΔSpt7The Aspergillus niger mutant strain presents the same strain as the original strainA. niger CGMCC 10142 has a greatly different growth form, hyphae are condensed and grow slowly, and extracellular secretion of citric acid is inhibited, so Spt7 in Aspergillus niger plays a vital role in Aspergillus niger. The research is carried out inA. niger Overexpression or knockout in CGMCC 10142Spt7Gene comparisonΔSpt7Aspergillus niger mutant strain,OE: Spt7Growth, oxidative stress, high temperature resistance and hyperosmotic analyses between the A.niger mutant and the original strain were performed, and the effect of over-expressing Spt7 on citric acid production by the strain was investigated. The object of the present invention was to identify Spt7 as applicable for improving citric acid production from aspergillus niger or as a targeting site for reducing metabolism ochratoxins.

In order to achieve the purpose, the invention discloses the following technical contents:

overexpressionSpt7A gene characterized by:Spt7the nucleic acid sequence of the gene is shown as SEQ ID No. 1,Spt7the corresponding amino acid sequence of the gene is shown as SEQ ID No.2,Spt7the nucleic acid sequence of the upstream of the gene is shown as SEQ ID No. 3,Spt7the nucleic acid sequence of the downstream of the gene is shown as SEQ ID No. 4, the nucleic acid sequence of the promoter PglaA of the constructed vector is shown as SEQ ID No.5, and the hygromycin resistance marker gene used in the screeninghygThe nucleic acid sequence of (A) is shown as SEQ ID No. 6.

The invention further discloses an Aspergillus niger engineering strain for over-expressing the Spt7 gene, which is named as: spt7 A.niger strain, OE: the engineering strain successfully overexpresses the Spt7 gene. The construction method of the Aspergillus niger engineering strain for over-expressing the Spt7 gene is characterized in that the selected starting strain isA. nigerCGMCC 10142 strain, overexpression of which is achieved by agrobacterium tumefaciens mediated transformation methodSpt7The plasmid of the gene was randomly integrated into the A.niger genome for expression.

The detailed construction method comprises the following steps:spt7construction of a Gene overexpression vector, i.e., p44-PglaA-spt7,spt7constructing a gene knockout vector, namely p 44-delta spt7, respectively transferring the expression vector into aspergillus niger strains by virtue of an agrobacterium transformation method, and screening aspergillus niger recombinant strains; the engineering construction method of the recombinant aspergillus niger comprises the following steps:

(a)PglaA、spt7a target gene,hygThe gene,spt7Amplifying an upstream sequence and a downstream sequence of the gene;

(b) separately adding PglaA and PglaAspt7Fragments of the target Gene andhyggene, gene,spt7The upstream sequence and the downstream sequence of the gene are fused by Over-lapPCR to obtain fusion fragments PglaA-spt7 and delta respectivelyspt7-hgy；

(c) The pCAM-BIA-1300 plasmid was subjected toEcoR I andPsti, double enzyme digestion linearization treatment;

(d) respectively connecting the fragments in the step (b) with the linearized plasmids in the step (c) by using recombinase to construct recombinant plasmids pOE, spt7 and p delta spt 7;

(e) and (d) transforming the two recombinant plasmids in the step (d) into aspergillus niger by an agrobacterium transformation method, and screening aspergillus niger engineering strains with target genes integrated into a genome and engineering strains with the target genes knocked out.

The invention further discloses the overexpression of the strainSpt7The application of the genetic aspergillus niger engineering strain in improving the citric acid yield of the recombinant aspergillus niger strain. In particular over-expressionSpt7The genetic aspergillus niger engineering strain is applied to the aspects of improving the oxidation stress resistance and the hypertonicity resistance of the strain; the oxidation stress resistance and the hypertonicity resistance mean that the strain can be in high concentration H₂O₂Growth under NaCl and glucose conditions. The experimental results show that: over-expressionSpt7The yield of citric acid of the genetic aspergillus niger engineering strain is improved by 30 percent, and the aspergillus niger engineering strain can normally grow under the conditions of 30mM H2O2, 42 ℃, 10 percent NaCl and 20 percent glucose.

ATGTCGCTCGGACACCACCACGCCTGGCTCCCCCCAGGTCATCTGCGCCCGCCGGATGATTTCCATGATGCGCGGTCTGTCAATGGCTATCCCAAATCTTTTTCCGGTTCGCGAACCCCCCAGATGCGCGCTTCGGCCGACGCCGACGGGTCTCACGCGGGCGGTCTGATATCAGATGCCGATATTGCAGGCGACGAGGACCCGCGCATCGCCATGTTCCGGGATCTGTACAAACGCAGTGAGGCGCAAATAAATTCCCTCTTTGCCAACCAGAAAGCTGCCGAGGATGCCCGCCCTGCCATCGACTCCGACGAGTCCCAAGCCGAGAGCCAACGCGCCGACGAACCCGCTCCGCCCCCGGCGCCCCCCAAGAAGCCCGCCAGGAAGTTAGATGACGATGACTACGATGAGTATGACGACGAAGATGACGCTGAGGATACCGAAGCCACATCTCCTCCCAAGCCCAAATCTCTCGCTGCGTCTCAACTACCTAGTAGTTTCCCATCGCCCAGCCGACCGCCCAGCGGCTCCGTGTCGGTCGGGCCCGATGCGCAGAAGGAGACCAAGAAAGAGACATTGGAGGATATCCGCAAGAAGCTAGAGGAAGATAAGAAGGCGACTGAGGAAGCTGCCAGAAGAAGCTTTCACACACTCTTTTATACTTTAGAGAATGATAGAGATGCCATGCTGGACCAGCAGCGCCTAGAAGAGTCGGAGCGACAGGTGGAAGCGGAAATGTCAGGCCAGGCGAACGCCGGCAACAATGCGAATCCAACCTCCAATGGATATGGGTCGCTGAGTAGCGCGAACCTGGGCGCCTCGAGCCTGACCCTCAAGAACCTGATCGCGAGAATTGATATGAAGCGGAGCTTGGTCCAAGCATCCGATGCGGAACTCCGAAGCCTGATGAGCGAGGTTCGTAAGAACCGGAGTAAGTGGGCTAGTGAGGACAAGATTGGCCAAGAAGAGCTGTATGAAGCTGCGGAGAAGGTGCTTAGTGAGCTCAAGGCGATGACAGAGCATTCAAGCGCGTTCTTGACTCGAGTAAATAAGCGCGATGCGCCTGATTATTATACAAGTGAGATACCCCGACGGACAAAGTGCCACGCCGTGCGCTCAGTTGCTGACCTCCTGCGCTAGTCATCAAACATCCGATGGATCTGGGAACCATGACCAAGAAGCTGAAAGCGCTGCAATACAAGTCGAAGCAGGAATTTGTCGATGACATTAATCTAATATGGTCGAACTGCTTCAAGTATAACACTAACCCAGAACACTTCCTCCGCAAGCATGCTTTATACATGAAGAAGGAGACGGAGAAGCTTGTTCCTCTGATTCCAGACATCGTCATTCGAGACCGCGCTGAAGTCGAGGCAGAAGAGCGCCGACTGCAGATGGCCGAAATGGATGGCGCCGAAGAGAGCGACGACGAACCGATCATGTCGTCCCGCGGCCGCAAAGCCCCCGGCAAGTCATCATCGAAGAAAGGCACTGCGCCTGTTCGAAATACTCCCAGCGGGTCGGAGCCGCCTGGCCAGAGCTCTCAGCCACCGGGGCCGGTCCGTTCGGACTCTGATGTTGTGATGGAGGGAACTCAGAACGGGCTTGTAACGCCGCCCCCGGGCACACAGACGCCATCTGACCCTGCGGGCGTCAGCTCTGGTGTACCTGGAAGCCAGGGTGATGCTATGGACATTGATGGGTTAGTCCCGACAAGTACCGCACTGAGCGCATTGCCCGCGTCCGGTGTGGATTCAGAAGACCCCGAGTACAAAGTATGGAAACAGGTCACGAAGAAGGATCGTGCTCTCATTGCCGCAGAGAGGCATCGTCTCTTTAAAGGTGACAAGCTCAACTCCGATGAGCCAGCATTGCTCCGTACCAAAGCGGGCATGCGCCGGTGGATCAGAAACCAAAAGCACAACCTTGCAGAGAACGACAAGGCGCGAGATTCAACAGCACAAGGCATGGAACCTGGTGCTGCAGGTGAGACGCTCGCGGAAGGTATTGAGGTGGACGAGGATCGAGTGATTCCCGACTATTACGATGTCATGTCCGGTGTCCCCGATCTACCTTCTCAGCTACTCTGGAAGGAAGACTCGGACGGCAACATTGTGGATGCGTCCGAAGAGTTCTTGAGGATCCTCCCGCAAGGCTCATTCACTCAACCAGATAGTAAGCTGGCCCGGAAAATGGATGCAAACATGCGCCAAATGCAGGAAACGCGAAAGGTCTGCTCGAAAATCGGCATCGTCAAGCAGATGCAACTGCAGTCTCAGGTAGGCGATCTCTCAAATCGTGATGTTTCTTCTGTCTAACTCTTCGAAGATGTACCAGAATCAGTTTCAAAAATACCAGCCGGAACCCTTCGTCGAGCAGGATGTGTCTCCTCATGTGATGAACGACGGGGGCCCAGTCATTGCTCCTTGGGTTTGCAAGGCGGCCTTGCAGCGCTCCGTGGCAAAAATCTTCTACCACACGGGGTTTGAGGAGTATCAGCCTTCGGCCCTGGATGCAGTGACTGATATTGCCTCCGACTTCTTCCAGAAGATCGGCGAAACCTTGAAGTCGTACATGGAATCCCCGAAAGTTCCGACTACCGACGCGTCCGAGGCTACGGGTACAGCTCAGTGGAAGCGAGCGTATACGGAGCCGGAGATCGTACTACATACTCTCTCATCTGTTGGCATCGATGTAGAGTCTCTGGAGTCTTACATCAAGGACGATGTGGAGCGGCTCGGGACGAAGCTCTCCACAGTTCATGACCGGCTGCGCTCGCTGTTGTCCGAGCTCCTGCGACCTGCGCTTGCAGATGGCGGGGAGGATGGCTCCAACGCCTTCCAGGACGGCAGTGAACAGTTCATCGGCGGTGACTTTGCAGAAGACATCGACGAGGACTTCTTCGGGTTCAAAGAATTGGGGCTGGACAAGGAGTTTGGACTTGCCACCCTCAGCGTGCCACTTCATCTCTTGCAGAACAGGATGTACAATGCCGCGCAGGCACAGAACACCAGGTATGTCTCTCTTATTGTATCGACTATTGCTTGCTTGATACTGATGTGTCTTGCAGTGCTGCCCAAGCCGTCACTCTCTTTCCCCCGCCCGCTCCCTATCCTCGCATCACAAACGACTCTCTCTCTTTGCAAATTGGGTTGGTTCAAGAATTCTTCAGCACCAAGCTCCAAGCAAACAACAACGAGCCTTTGGTCGAAGATCTTGAGCTACCACCGAAACAACGACCCATGGCCGCGCGACCTCGTCTACCGGCGTCCGGCAAGATCCCGCCGCCTTCCGCTCCTTCGGGCTTGACCACCAGTCCCCAGAAGCGACCGCTCCCGCCCTCAGCATCGGGGCAGTCGGGCGCTAAGGCTGGTACGTCGGAACCGAGCAAAAAGAAACTCAAGAAGAACGGGCCTAGCCTGGGCGCTCCCGACTCGACAGCCGAAGGAGACGAAGCCGCCGCCGTTGGAGGAGATGGCAGCAAGCCGTCGAACGGATCGTTGTTCACTGCCGCGTCAGCGGACGAGCCCTCTGCTCCGGATGCAACTAGTAAGGGTGAGATGGCCAACTCGACCGCGCCAGAAGGGGCTGGTGCTGAGCATCAGGCCCCAGCTGGGACCTCAAACGATGACCAGAATCCCAACCACGACAGCGCCGCTGCCCTACCAAACGGAACGGCAGATGAAGCGTCATGA

SEQ ID NO.2

MSLGHHHAWLPPGHLRPPDDFHDARSVNGYPKSFSGSRTPQMRASADADGSHAGGLISDADIAGDEDPRIAMFRDLYKRSEAQINSLFANQKAAEDARPAIDSDESQAESQRADEPAPPPAPPKKPARKLDDDDYDEYDDEDDAEDTEATSPPKPKSLAASQLPSSFPSPSRPPSGSVSVGPDAQKETKKETLEDIRKKLEEDKKATEEAARRSFHTLFYTLENDRDAMLDQQRLEESERQVEAEMSGQANAGNNANPTSNGYGSLSSANLGASSLTLKNLIARIDMKRSLVQASDAELRSLMSEVRKNRSKWASEDKIGQEELYEAAEKVLSELKAMTEHSSAFLTRVNKRDAPDYYTIIKHPMDLGTMTKKLKALQYKSKQEFVDDINLIWSNCFKYNTNPEHFLRKHALYMKKETEKLVPLIPDIVIRDRAEVEAEERRLQMAEMDGAEESDDEPIMSSRGRKAPGKSSSKKGTAPVRNTPSGSEPPGQSSQPPGPVRSDSDVVMEGTQNGLVTPPPGTQTPSDPAGVSSGVPGSQGDAMDIDGLVPTSTALSALPASGVDSEDPEYKVWKQVTKKDRALIAAERHRLFKGDKLNSDEPALLRTKAGMRRWIRNQKHNLAENDKARDSTAQGMEPGAAGETLAEGIEVDEDRVIPDYYDVMSGVPDLPSQLLWKEDSDGNIVDASEEFLRILPQGSFTQPDSKLARKMDANMRQMQETRKVCSKIGIVKQMQLQSQMYQNQFQKYQPEPFVEQDVSPHVMNDGGPVIAPWVCKAALQRSVAKIFYHTGFEEYQPSALDAVTDIASDFFQKIGETLKSYMESPKVPTTDASEATGTAQWKRAYTEPEIVLHTLSSVGIDVESLESYIKDDVERLGTKLSTVHDRLRSLLSELLRPALADGGEDGSNAFQDGSEQFIGGDFAEDIDEDFFGFKELGLDKEFGLATLSVPLHLLQNRMYNAAQAQNTSAAQAVTLFPPPAPYPRITNDSLSLQIGLVQEFFSTKLQANNNEPLVEDLELPPKQRPMAARPRLPASGKIPPPSAPSGLTTSPQKRPLPPSASGQSGAKAGTSEPSKKKLKKNGPSLGAPDSTAEGDEAAAVGGDGSKPSNGSLFTAASADEPSAPDATSKGEMANSTAPEGAGAEHQAPAGTSNDDQNPNHDSAAALPNGTADEAS

SEQ ID NO.3

GGGGAGGATTGGGGGAAAAGACATACCCGCGAAAGGGTAACGGATTCGCATGATGGGCGATCTGGAAGTAGGACGTTTAAGGGGGGAGATGTGTAGAAAGAGGAGGCCGTGGAGGGGAGAAAGAAAGGCCGGAAGAGGAAAACTGGATGATGAAGCGATGAAGATGATGGCATGTCATGTGGTTTAGCTTACGATACAGACAGACAGACAGACCGCAGAGACGCAGCCTCAGGCTGAAACTTGGGTTTATTGTGGTTGAAACATCCTCGGGAAACTCCCTGCCATTCTTCTTGTCCATCGAGGCTGGAGTGTTGCTTGTCCCCGTTCAGTTCAATACATTGACGGGTTATTGCTCTCCTCGTTGGATTGGGTTTTTTTTTATTTAATATTAATGCGGATTCACTTTTTTTCGGCTCATTCCTTATTTTTCACAGTGTTGTCTGCCTAATTTCATTCCTATATCTTCTTCTACTTTGCTAGTTGCTTAACTGCTGGCGTCAACGAATTGCGCGGTTGGTCTGAAGCTGCGGTCGCCGTTCCGCCTTCACGCTCCAACTTCATCTCATCCGTTCGCGCAGAGAACCTTATAAAGAAGCCCTCCAGTCCCCCATCAAATCCCCCACTGTTTCATCACTTGGGGCCTCCAAATCATCGTCCCTCATTTCCTGGCCCCTGTCCCCTAATGTATATGTCTTTTTCAGCGTCTCAAAAGGCTCCCTTGTACCCTAGCTGGACCTGATCCGAACCGTGGAGAAACGAGCCCCCCTCGCCCGCCCCAGAACCGGGGTCTTGGAGCGAGCATGTCGCTCGG

SEQ ID NO.4

ATGAAGCGTCATGATATGATCTGTCCTACCTCAATGCCATGATCGCTATTTCCCCCCGCACTGTACTACCTCACTATACCATGATTATTTTACCCCTATCTCTTTCTACCAATTCTTATTTCCTTTTTCTTTTCGTCCATGTCTTCTTTGCAGTATATTATATCGTCCACCACTTATGTCTTATCTACCTTTTACCCACTTTTGCTTCTTATTCTTCCTCACTTGTTTTTTTTTCTTCTCTCATCGCCTGTTTTCACTCTTGGATGATATATAGTGTGCGATATGTGGCGTCGCGCTTCTTCTTTTCAGCTAGCTGCCTTTACCCGAACCCACGTTTGAATTCGGTTCGAGTTCGAGCCCCTCTTGTCCTATCTAATCCCAGCATTAACAGTGTGCGACAAGAGAACGGAATTACAGCGGGGGGAACACACAAAAAACAGATATATGAGATACACAAATACAAACGATGCATCCTTGTTCAGTGTACTTGCCTTGTATACCGTGACACGAAGATCATGCGTAGCTGTTCAACATATATTAAACTAAGGGCAGGGATTCAATTCCTTCCATTACGATCTGGCCTGCGTCTACATCAGCCCTTTTGTCTTGGCTTGGCTTGTGCGTTACTTCTTATCCAGTGTTCTGGACTAAACCGGGGTATCTGCCAACCATCTACTAGATAAGTGGGACCCTGTAATATTCTTTCTAGATCTCACCAGCAAACGCTCATCTGGTACTACCGTGTAACGATAACCCATTCAGACGGTAAGTAGCCAGCAGGATAACACAAAGACAGACGGACAGGCAGGCAGGCAGGCACCTACATAGTACCTCCATCTACCTCCGAGATGCAGCAGCATCGGCATGCATACATGGCATGATCAGATCCTATCTATACTAATCTAACTGCTCCAACATACATCCCATTGCATCTGAGTACTCCAATCCACATCAGTTATTGTCTGTTTGTCCCTGCTCAGTCAGAACTATCAACCACATAAGCTTGTAATCAACG

SEQ ID NO.5

TGCCATTGGCGGAGGGGTCCGGACGGTCAGGAACTTAGCCTTATGAGATGAATGATGGACGTGTCTGGCCTCGGAAAAGGATATATGGGGATCATGATAGTACTAGCCATATTAATGAAGGGCATATACCACGCGTTGGACCTGCGTTATAGCTTCCCGTTAGTTATAGTACCATCGTTATACCAGCCAATCAAGTCACCACGCACGACCGGGGACGGCGAATCCCCGGGAATTGAAAGAAATTGCATCCCAGGCCAGTGAGGCCAGCGATTGGCCACCTCTCCAAGGCACAGGGCCATTCTGCAGCGCTGGTGGATTCATCGCAATTTCCCCCGGCCCGGCCCGACACCGCTATAGGCTGGTTCTCCCACACCATCGGAGATTCGTCGCCTAATGTCTCGTCCGTTCACAAGCTGAAGAGCTTGAAGTGGCGAGATGTCTCTGCAGGAATTCAAGCTAGATGCTAAGCGATATTGCATGGCAATATGTGTTGATGCATGTGCTTCTTCCTTCAGCTTCCCCTCGTGCAGATGAGGTTTGGCTATAAATTGAAGTGGTTGGTCGGGGTTCCGTGAGGGGCTGAAGTGCTTCCTCCCTTTTAGACGCAACTGAGAGCCTGAGCTTCATCCCCAGCATCATTACACCTCAGCA

SEQ ID NO.6

GGATCCTCCAGGCGGATCACAAAATTTGTGTCGTTTGACAAGATGGTTCATTTAGGCAACTGGTCAGATCAGCCCCACTTGTAAGCAGTAGCGGCGGCGCTCGAAGTGTGACTCTTATTAGCAGACAGGAACGAGGACATTATTATCATCTGCTGCTTGGTGCACGATAACTTGGTGCGTTTGTCAAGCAAGGTAAGTGAACGACCCGGTCATACCTTCTTAAGTTCGCCCTTCCTCCCTTTATTTCAGATTCAATCTGACTTACCTATTCTACCCAAGCATCCAAATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTCCAGCCGGTCGCGGAGGCCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCATGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCCTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGCCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGAAATAG

The invention is described in more detail below:

(1) overexpressionSpt7Gene and one strain knock-outSpt7The genetic aspergillus niger engineering strain is characterized in that: the capability of the over-expression strain for resisting oxidative stress, high temperature and high permeability is improved, and the yield of citric acid is improved; the performance of the knockout strain is reduced.

(2) The aspergillus niger strain is characterized in that: the engineering strain is successfully over-expressed or knocked outSpt7A gene.

(3) The engineering strain of the invention (2) is characterized in that:Spt7the nucleic acid sequence of the gene is shown as SEQ ID No. 1,Spt7the corresponding amino acid sequence of the gene is shown as SEQ ID No.2,Spt7the nucleic acid sequence of the upstream of the gene is shown as SEQ ID No. 3,Spt7the nucleic acid sequence of the downstream of the gene is shown as SEQ ID No. 4, the nucleic acid sequence of the promoter PglaA of the constructed vector is shown as SEQ ID No.5, and the hygromycin resistance marker gene used in the screeninghygThe nucleic acid sequence of (A) is shown as SEQ ID No. 6. The selected starting strain isA. nigerCGMCC 10142 strain, overexpression of which is achieved by agrobacterium tumefaciens mediated transformation methodSpt7The plasmid of the gene was randomly integrated into the A.niger genome for expression.

(4) Overexpression according to the inventionSpt7The construction method of the gene Aspergillus niger engineering strain is characterized by comprising the following steps:spt7construction of a Gene overexpression vector, i.e., p44-PglaA-spt7,spt7of gene knockout vectorsConstructing p 44-delta spt7, respectively transferring the expression vector into Aspergillus niger strains by virtue of an agrobacterium transformation method, and screening Aspergillus niger recombinant strains.

(5) The engineering construction method of the recombinant aspergillus niger comprises the following steps:

(a)PglaA、spt7a target gene,hygGene, gene,spt7Amplifying an upstream sequence and a downstream sequence of the gene;

(7) The technical content relates to an aspergillus niger strain over-expressing Spt7, which is characterized in that: the yield of the citric acid of the recombined aspergillus niger strain is improved by 30 percent compared with that of the original strain, and the application of the recombined aspergillus niger strain in the aspects of improving the yield of the citric acid and reducing the generation of the mixed acid.

The invention mainly considers whether the endogenous gene can be efficiently over-expressed in the citric acid aspergillus niger industrial strainspt7The invention discloses a gene and a method for improving citric acid yield, and mainly aims to solve the problem of ineffectiveness of the existing method for improving citric acid yield, the invention has the difficulty that the genetic operation of an Aspergillus niger industrial strain is more difficult than that of a model strain, and the innovation point of the invention is that the application of the Aspergillus niger industrial strain in the aspect of improving the citric acid yield by exploring unknown functions and overexpression of a transcription activator Spt7 is realized.

The test effect of the invention is as follows:

(1) knockouts constructed by the inventionSpt7A genetically modified Aspergillus niger strain having a hyphal formation comparable to that of the original strainIn a condensed state, the growth is slow, and the production of citric acid is inhibited.

(2) Overexpression constructed according to the inventionSpt7The genetic Aspergillus niger strain was at 30mM H compared to the original strain₂O₂Normal growth was achieved at 42 ℃ with 10% NaCl and 20% glucose.

(3) Overexpression constructed according to the inventionSpt7Compared with the original strain, the yield of citric acid of the gene aspergillus niger strain is improved by 30 percent.

Drawings

FIG. 1 shows the plasmid maps of pHS and pCS; wherein A is plasmid pHS for knocking out the Spt7 gene, and B is plasmid pCS for over-expressing the Spt7 gene;

FIG. 2 shows the original strain andΔspt7、OE:spt7the colony morphology of the strain;

FIG. 3 shows oxidative stress vs OE: spt7 strains andA. niger10142 growth condition analysis;

FIG. 4 is a graph of hyperthermic, hypertonic conditions versus OE, spt7-35 strain andA. niger10142 growth conditions;

FIG. 5 shows the dct gene overexpression plasmid construction.

Detailed Description

The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention. The raw materials and reagents used in the present invention are commercially available. A. The niger CGMCC 10142 strain is deposited in the national Collection.

Example 1

1. Primary reagent

rTaq enzyme, PrimeSTAR Hi-Fi enzyme, restriction enzymes BamHI, PstI, XbaI, EcoRI, Hind III and KpnI, T4 ligase, RNA enzyme, used DL10000 DNA Marker and used DL5000 DNA Marker are purchased from TaKaRa company; the Marker III, the plasmid small-extraction Kit and the common agarose gel DNA recovery Kit used in the experiment are purchased from Tiangen Biotechnology limited company; the efficient competent cell preparation kit is purchased from Shanghai Czeri bioengineering GmbH. All synthetic sequences and primers in this paper were synthesized by Jinwei Zhi Biotechnology Ltd, where the forward primer was F and the reverse primer was R, and the primers used in the experiments are shown in tables 1-2:

TABLE 1 strains and plasmids used in this experiment

TABLE 2 primers used in this experiment

2. Over-expressionOE: Spt7And knock outΔSpt7Construction of vectors

(1) Amplification of fragments of interest

The amplification of a target fragment related to the construction process of the pCS plasmid comprises the following steps: to be provided withA. niger10142 genomic DNA as template, amplifying fragment fragments by primers Spt7-F and Spt7-R (containing terminator), and primers Pgla-F and Pgla-R respectivelyspt7(SEQ ID No. 1) and pgla (SEQ ID No. 5); the fragment pgla and the fragmentspt7A fragment pgla-spt7 was fused by the method of Over-lap PCR.

The pHS plasmid construction process is related to the amplification of target fragments, and comprises the following steps: to be provided withA. niger10142 genomic DNA as template, and through the amplification with upstream primer spt7-F-L-Kpn I and downstream primer spt7-R-L-BamH Ispt7Homologous left arm fragment L-spt7(SEQ ID No. 3), amplification of hygromycin fragments by upstream primer hyg-F and downstream primer hyg-Rhyg(SEQ ID No. 6) by the forward primer spt7-F-R-Pst I and the downstream primer spt7-R-R-Hind III amplificationspt7Homologous right arm fragment R-spt7(SEQ ID No. 4); fragment L-spt7Fragment, fragmenthygAnd fragment R-spt7Fusion of fragment L-by means of the Over-lap PCRspt7-hyg-R-spt7。

(2) Linearization of plasmids and related fragments

The p44 plasmid and the fragment pgla-spt7 were selected separatelyBamH I carrying out single enzyme digestion linearization;

separately adding the pHB plasmid and the fragment L-spt7-hyg-R-spt7HindIII and PstI double-enzyme digestion linearization is carried out.

(3) Glue recovery

And (3) carrying out agarose DNA gel (1% TAE buffer) electrophoresis detection on the enzyme digestion product in the step (2), and carrying out gel cutting and recovery on the target fragment.

(4) Construction of recombinant plasmid

The fragment L recovered in (3) abovespt7-hyg-R-spt7And the linearized pHB plasmid is connected by T4 DNA ligase, and the connection product is transformed intoE. coliDH5 alpha, positive transformants were picked and verified by PCR with spt7-F-det and spt7-R-det primers to successfully construct plasmid pHS, the plasmid map is shown in FIG. 1A.

The fragment pgla-spt7 recovered in (3) above and the linearized p44 plasmid were ligated by T4 DNA ligase, and the ligation product was transformed intoE. coliDH5 alpha, selecting positive transformant, selecting primer 1-YZ-Ku70LL-F, 1-YZ-spt7-5R for PCR verification, the length of amplified fragment is about 1000 bp; the length of the amplified fragment of the primer 1-YZ-spt7-3R and 1-YZ-ku70RR-R is about 1000bp, and the plasmid pCS is successfully constructed, wherein the plasmid map is shown in figure 1B.

3. Agrobacterium tumefaciens mediated transformation aspergillus niger

(1) Preparation of fresh spores of Aspergillus niger

Transferring Aspergillus niger CGMCC No. 10142 spore to CM slant, culturing at 37 deg.C for 5-7 days, washing slant with 0.9% sterile normal saline, and filtering with two layers of filter cloth to obtain fresh spore suspension.

(2) Recombinant plasmid transformed agrobacterium and verification

The constructed pCS, pHS plasmid was electrically transformed into A. tumefactions AGL1, plated on Kana-containing CM medium, and positive transformants were picked for PCR verification.

(3) Aspergillus niger infected by agrobacterium tumefaciens

250 μ L of induced Agrobacterium cells with an OD600 of 0.8 and 250 μ L of 1X 10⁷a/mL a suspension of aspergillus niger spores, in a ratio of 1: 1, and culturing at 24 ℃ in the dark for 2 days.

(4) Screening for Positive transformants

Transferring the microporous filter membrane attached with the thalli to a sterile flat plate by using sterile forceps, adding 3mL of normal saline, slowly rubbing the microporous filter membrane by using an applicator, and washing the thalli; transferring the bacterial liquid to a CM plate containing 100 mu g/mL of ampicillin, 100 mu g/mL of streptomycin, 200 mu M of cefotaxime sodium and 200 mu g/mL of hygromycin B; placing the plate at 35 deg.C, and culturing for 4 d until colony appears; and (4) selecting positive transformants for genome extraction verification.

Example 2

1. ΔSpt7Colony growth morphology of Aspergillus niger strains

Compared with the original strain, the Δ spt7 strain has slow growth of thallus, loose hyphae and serious influence, short aerial hyphae are generated in the early growth stage, but the hyphae are seriously condensed into clusters and are short in the late growth stage, and the most obvious characteristic is that the thallus does not produce conidia, the bacterial colonies are in an umbilical shape and have irregular surface morphology as shown in fig. 2.

2. OE: Spt7Aspergillus niger strain analysis of oxidation stress resistance, high temperature resistance and hyperosmotic condition

（1）OE: Spt7Aspergillus niger strains analysis for oxidative stress resistance

Will be provided withspt7Overexpression strains were spotted at 20mM H₂O₂The cells were cultured at 37 ℃ for 72 hours in the CM medium of (2) and morphological observation of the two strains revealed that the OE: spt7-35, 39, 36 strains were all 20mM H, as compared with the control A. niger 10142, as shown in FIG. 3₂O₂Growth under conditions demonstrating overexpression of spt7To improve the oxidative stress resistance of the strain.

（2）OE: Spt7Analysis of high temperature and hyperosmotic conditions of Aspergillus niger strains

Will be provided withspt7Culturing the over-expression strain on a CM culture medium at 42 ℃ for 72h, and observing the morphology of the two strains; will be provided withspt7As shown in FIG. 4, the control group A. niger 10142 was able to grow at 20% glucose but not at 42 ℃ and 10% NaCl, whereas the OE: spt7-35 strain was able to demonstrate that overexpression of spt7 increased the high temperature and high salt tolerance of the strain.

3. OE: Spt7Shake flask fermentation of aspergillus niger strains

(1) Preparation of spore suspension: culturing the slant for 5-7 days, washing the slant with 0.9% sterile physiological saline, counting with blood counting plate, and making spore concentration of 10⁷Spore suspension/ml.

(2) Fermentation medium: 50ml of corn liquefied liquid with 16 percent of sugar content is prepared and placed in a 500ml triangular flask.

(3) Fermentation conditions are as follows: the rotating speed is 290rpm, the fermentation temperature is 35 ℃, and the fermentation days are 72 h.

The fermentation result is shown in FIG. 5, the yield of citric acid of the OE: spt7-35 strain in each time period is obviously improved relative to the control group, the acid yield of the OE: spt7-35 strain reaches 34.41g/L at 72h and is improved by 39.54% compared with the control group, and the overexpression is provedspt7Can improve the citric acid yield of the strain.

SEQUENCE LISTING

<110> Tianjin university of science and technology

<120> Aspergillus niger engineering strain for overexpression of Spt7 gene and knockout of Spt7 gene and application

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 3695

<212> DNA

<213> Artificial sequence

<400> 1

atgtcgctcg gacaccacca cgcctggctc cccccaggtc atctgcgccc gccggatgat 60

ttccatgatg cgcggtctgt caatggctat cccaaatctt tttccggttc gcgaaccccc 120

cagatgcgcg cttcggccga cgccgacggg tctcacgcgg gcggtctgat atcagatgcc 180

gatattgcag gcgacgagga cccgcgcatc gccatgttcc gggatctgta caaacgcagt 240

gaggcgcaaa taaattccct ctttgccaac cagaaagctg ccgaggatgc ccgccctgcc 300

atcgactccg acgagtccca agccgagagc caacgcgccg acgaacccgc tccgcccccg 360

gcgcccccca agaagcccgc caggaagtta gatgacgatg actacgatga gtatgacgac 420

gaagatgacg ctgaggatac cgaagccaca tctcctccca agcccaaatc tctcgctgcg 480

tctcaactac ctagtagttt cccatcgccc agccgaccgc ccagcggctc cgtgtcggtc 540

gggcccgatg cgcagaagga gaccaagaaa gagacattgg aggatatccg caagaagcta 600

gaggaagata agaaggcgac tgaggaagct gccagaagaa gctttcacac actcttttat 660

actttagaga atgatagaga tgccatgctg gaccagcagc gcctagaaga gtcggagcga 720

caggtggaag cggaaatgtc aggccaggcg aacgccggca acaatgcgaa tccaacctcc 780

aatggatatg ggtcgctgag tagcgcgaac ctgggcgcct cgagcctgac cctcaagaac 840

ctgatcgcga gaattgatat gaagcggagc ttggtccaag catccgatgc ggaactccga 900

agcctgatga gcgaggttcg taagaaccgg agtaagtggg ctagtgagga caagattggc 960

caagaagagc tgtatgaagc tgcggagaag gtgcttagtg agctcaaggc gatgacagag 1020

cattcaagcg cgttcttgac tcgagtaaat aagcgcgatg cgcctgatta ttatacaagt 1080

gagatacccc gacggacaaa gtgccacgcc gtgcgctcag ttgctgacct cctgcgctag 1140

tcatcaaaca tccgatggat ctgggaacca tgaccaagaa gctgaaagcg ctgcaataca 1200

agtcgaagca ggaatttgtc gatgacatta atctaatatg gtcgaactgc ttcaagtata 1260

acactaaccc agaacacttc ctccgcaagc atgctttata catgaagaag gagacggaga 1320

agcttgttcc tctgattcca gacatcgtca ttcgagaccg cgctgaagtc gaggcagaag 1380

agcgccgact gcagatggcc gaaatggatg gcgccgaaga gagcgacgac gaaccgatca 1440

tgtcgtcccg cggccgcaaa gcccccggca agtcatcatc gaagaaaggc actgcgcctg 1500

ttcgaaatac tcccagcggg tcggagccgc ctggccagag ctctcagcca ccggggccgg 1560

tccgttcgga ctctgatgtt gtgatggagg gaactcagaa cgggcttgta acgccgcccc 1620

cgggcacaca gacgccatct gaccctgcgg gcgtcagctc tggtgtacct ggaagccagg 1680

gtgatgctat ggacattgat gggttagtcc cgacaagtac cgcactgagc gcattgcccg 1740

cgtccggtgt ggattcagaa gaccccgagt acaaagtatg gaaacaggtc acgaagaagg 1800

atcgtgctct cattgccgca gagaggcatc gtctctttaa aggtgacaag ctcaactccg 1860

atgagccagc attgctccgt accaaagcgg gcatgcgccg gtggatcaga aaccaaaagc 1920

acaaccttgc agagaacgac aaggcgcgag attcaacagc acaaggcatg gaacctggtg 1980

ctgcaggtga gacgctcgcg gaaggtattg aggtggacga ggatcgagtg attcccgact 2040

attacgatgt catgtccggt gtccccgatc taccttctca gctactctgg aaggaagact 2100

cggacggcaa cattgtggat gcgtccgaag agttcttgag gatcctcccg caaggctcat 2160

tcactcaacc agatagtaag ctggcccgga aaatggatgc aaacatgcgc caaatgcagg 2220

aaacgcgaaa ggtctgctcg aaaatcggca tcgtcaagca gatgcaactg cagtctcagg 2280

taggcgatct ctcaaatcgt gatgtttctt ctgtctaact cttcgaagat gtaccagaat 2340

cagtttcaaa aataccagcc ggaacccttc gtcgagcagg atgtgtctcc tcatgtgatg 2400

aacgacgggg gcccagtcat tgctccttgg gtttgcaagg cggccttgca gcgctccgtg 2460

gcaaaaatct tctaccacac ggggtttgag gagtatcagc cttcggccct ggatgcagtg 2520

actgatattg cctccgactt cttccagaag atcggcgaaa ccttgaagtc gtacatggaa 2580

tccccgaaag ttccgactac cgacgcgtcc gaggctacgg gtacagctca gtggaagcga 2640

gcgtatacgg agccggagat cgtactacat actctctcat ctgttggcat cgatgtagag 2700

tctctggagt cttacatcaa ggacgatgtg gagcggctcg ggacgaagct ctccacagtt 2760

catgaccggc tgcgctcgct gttgtccgag ctcctgcgac ctgcgcttgc agatggcggg 2820

gaggatggct ccaacgcctt ccaggacggc agtgaacagt tcatcggcgg tgactttgca 2880

gaagacatcg acgaggactt cttcgggttc aaagaattgg ggctggacaa ggagtttgga 2940

cttgccaccc tcagcgtgcc acttcatctc ttgcagaaca ggatgtacaa tgccgcgcag 3000

gcacagaaca ccaggtatgt ctctcttatt gtatcgacta ttgcttgctt gatactgatg 3060

tgtcttgcag tgctgcccaa gccgtcactc tctttccccc gcccgctccc tatcctcgca 3120

tcacaaacga ctctctctct ttgcaaattg ggttggttca agaattcttc agcaccaagc 3180

tccaagcaaa caacaacgag cctttggtcg aagatcttga gctaccaccg aaacaacgac 3240

ccatggccgc gcgacctcgt ctaccggcgt ccggcaagat cccgccgcct tccgctcctt 3300

cgggcttgac caccagtccc cagaagcgac cgctcccgcc ctcagcatcg gggcagtcgg 3360

gcgctaaggc tggtacgtcg gaaccgagca aaaagaaact caagaagaac gggcctagcc 3420

tgggcgctcc cgactcgaca gccgaaggag acgaagccgc cgccgttgga ggagatggca 3480

gcaagccgtc gaacggatcg ttgttcactg ccgcgtcagc ggacgagccc tctgctccgg 3540

atgcaactag taagggtgag atggccaact cgaccgcgcc agaaggggct ggtgctgagc 3600

atcaggcccc agctgggacc tcaaacgatg accagaatcc caaccacgac agcgccgctg 3660

ccctaccaaa cggaacggca gatgaagcgt catga 3695

<210> 2

<211> 1175

<212> PRT

<213> corresponding amino acid sequence of Spt7 gene

<400> 2

Met Ser Leu Gly His His His Ala Trp Leu Pro Pro Gly His Leu Arg

1 5 10 15

Pro Pro Asp Asp Phe His Asp Ala Arg Ser Val Asn Gly Tyr Pro Lys

20 25 30

Ser Phe Ser Gly Ser Arg Thr Pro Gln Met Arg Ala Ser Ala Asp Ala

35 40 45

Asp Gly Ser His Ala Gly Gly Leu Ile Ser Asp Ala Asp Ile Ala Gly

50 55 60

Asp Glu Asp Pro Arg Ile Ala Met Phe Arg Asp Leu Tyr Lys Arg Ser

65 70 75 80

Glu Ala Gln Ile Asn Ser Leu Phe Ala Asn Gln Lys Ala Ala Glu Asp

85 90 95

Ala Arg Pro Ala Ile Asp Ser Asp Glu Ser Gln Ala Glu Ser Gln Arg

100 105 110

Ala Asp Glu Pro Ala Pro Pro Pro Ala Pro Pro Lys Lys Pro Ala Arg

115 120 125

Lys Leu Asp Asp Asp Asp Tyr Asp Glu Tyr Asp Asp Glu Asp Asp Ala

130 135 140

Glu Asp Thr Glu Ala Thr Ser Pro Pro Lys Pro Lys Ser Leu Ala Ala

145 150 155 160

Ser Gln Leu Pro Ser Ser Phe Pro Ser Pro Ser Arg Pro Pro Ser Gly

165 170 175

Ser Val Ser Val Gly Pro Asp Ala Gln Lys Glu Thr Lys Lys Glu Thr

180 185 190

Leu Glu Asp Ile Arg Lys Lys Leu Glu Glu Asp Lys Lys Ala Thr Glu

195 200 205

Glu Ala Ala Arg Arg Ser Phe His Thr Leu Phe Tyr Thr Leu Glu Asn

210 215 220

Asp Arg Asp Ala Met Leu Asp Gln Gln Arg Leu Glu Glu Ser Glu Arg

225 230 235 240

Gln Val Glu Ala Glu Met Ser Gly Gln Ala Asn Ala Gly Asn Asn Ala

245 250 255

Asn Pro Thr Ser Asn Gly Tyr Gly Ser Leu Ser Ser Ala Asn Leu Gly

260 265 270

Ala Ser Ser Leu Thr Leu Lys Asn Leu Ile Ala Arg Ile Asp Met Lys

275 280 285

Arg Ser Leu Val Gln Ala Ser Asp Ala Glu Leu Arg Ser Leu Met Ser

290 295 300

Glu Val Arg Lys Asn Arg Ser Lys Trp Ala Ser Glu Asp Lys Ile Gly

305 310 315 320

Gln Glu Glu Leu Tyr Glu Ala Ala Glu Lys Val Leu Ser Glu Leu Lys

325 330 335

Ala Met Thr Glu His Ser Ser Ala Phe Leu Thr Arg Val Asn Lys Arg

340 345 350

Asp Ala Pro Asp Tyr Tyr Thr Ile Ile Lys His Pro Met Asp Leu Gly

355 360 365

Thr Met Thr Lys Lys Leu Lys Ala Leu Gln Tyr Lys Ser Lys Gln Glu

370 375 380

Phe Val Asp Asp Ile Asn Leu Ile Trp Ser Asn Cys Phe Lys Tyr Asn

385 390 395 400

Thr Asn Pro Glu His Phe Leu Arg Lys His Ala Leu Tyr Met Lys Lys

405 410 415

Glu Thr Glu Lys Leu Val Pro Leu Ile Pro Asp Ile Val Ile Arg Asp

420 425 430

Arg Ala Glu Val Glu Ala Glu Glu Arg Arg Leu Gln Met Ala Glu Met

435 440 445

Asp Gly Ala Glu Glu Ser Asp Asp Glu Pro Ile Met Ser Ser Arg Gly

450 455 460

Arg Lys Ala Pro Gly Lys Ser Ser Ser Lys Lys Gly Thr Ala Pro Val

465 470 475 480

Arg Asn Thr Pro Ser Gly Ser Glu Pro Pro Gly Gln Ser Ser Gln Pro

485 490 495

Pro Gly Pro Val Arg Ser Asp Ser Asp Val Val Met Glu Gly Thr Gln

500 505 510

Asn Gly Leu Val Thr Pro Pro Pro Gly Thr Gln Thr Pro Ser Asp Pro

515 520 525

Ala Gly Val Ser Ser Gly Val Pro Gly Ser Gln Gly Asp Ala Met Asp

530 535 540

Ile Asp Gly Leu Val Pro Thr Ser Thr Ala Leu Ser Ala Leu Pro Ala

545 550 555 560

Ser Gly Val Asp Ser Glu Asp Pro Glu Tyr Lys Val Trp Lys Gln Val

565 570 575

Thr Lys Lys Asp Arg Ala Leu Ile Ala Ala Glu Arg His Arg Leu Phe

580 585 590

Lys Gly Asp Lys Leu Asn Ser Asp Glu Pro Ala Leu Leu Arg Thr Lys

595 600 605

Ala Gly Met Arg Arg Trp Ile Arg Asn Gln Lys His Asn Leu Ala Glu

610 615 620

Asn Asp Lys Ala Arg Asp Ser Thr Ala Gln Gly Met Glu Pro Gly Ala

625 630 635 640

Ala Gly Glu Thr Leu Ala Glu Gly Ile Glu Val Asp Glu Asp Arg Val

645 650 655

Ile Pro Asp Tyr Tyr Asp Val Met Ser Gly Val Pro Asp Leu Pro Ser

660 665 670

Gln Leu Leu Trp Lys Glu Asp Ser Asp Gly Asn Ile Val Asp Ala Ser

675 680 685

Glu Glu Phe Leu Arg Ile Leu Pro Gln Gly Ser Phe Thr Gln Pro Asp

690 695 700

Ser Lys Leu Ala Arg Lys Met Asp Ala Asn Met Arg Gln Met Gln Glu

705 710 715 720

Thr Arg Lys Val Cys Ser Lys Ile Gly Ile Val Lys Gln Met Gln Leu

725 730 735

Gln Ser Gln Met Tyr Gln Asn Gln Phe Gln Lys Tyr Gln Pro Glu Pro

740 745 750

Phe Val Glu Gln Asp Val Ser Pro His Val Met Asn Asp Gly Gly Pro

755 760 765

Val Ile Ala Pro Trp Val Cys Lys Ala Ala Leu Gln Arg Ser Val Ala

770 775 780

Lys Ile Phe Tyr His Thr Gly Phe Glu Glu Tyr Gln Pro Ser Ala Leu

785 790 795 800

Asp Ala Val Thr Asp Ile Ala Ser Asp Phe Phe Gln Lys Ile Gly Glu

805 810 815

Thr Leu Lys Ser Tyr Met Glu Ser Pro Lys Val Pro Thr Thr Asp Ala

820 825 830

Ser Glu Ala Thr Gly Thr Ala Gln Trp Lys Arg Ala Tyr Thr Glu Pro

835 840 845

Glu Ile Val Leu His Thr Leu Ser Ser Val Gly Ile Asp Val Glu Ser

850 855 860

Leu Glu Ser Tyr Ile Lys Asp Asp Val Glu Arg Leu Gly Thr Lys Leu

865 870 875 880

Ser Thr Val His Asp Arg Leu Arg Ser Leu Leu Ser Glu Leu Leu Arg

885 890 895

Pro Ala Leu Ala Asp Gly Gly Glu Asp Gly Ser Asn Ala Phe Gln Asp

900 905 910

Gly Ser Glu Gln Phe Ile Gly Gly Asp Phe Ala Glu Asp Ile Asp Glu

915 920 925

Asp Phe Phe Gly Phe Lys Glu Leu Gly Leu Asp Lys Glu Phe Gly Leu

930 935 940

Ala Thr Leu Ser Val Pro Leu His Leu Leu Gln Asn Arg Met Tyr Asn

945 950 955 960

Ala Ala Gln Ala Gln Asn Thr Ser Ala Ala Gln Ala Val Thr Leu Phe

965 970 975

Pro Pro Pro Ala Pro Tyr Pro Arg Ile Thr Asn Asp Ser Leu Ser Leu

980 985 990

Gln Ile Gly Leu Val Gln Glu Phe Phe Ser Thr Lys Leu Gln Ala Asn

995 1000 1005

Asn Asn Glu Pro Leu Val Glu Asp Leu Glu Leu Pro Pro Lys Gln

1010 1015 1020

Arg Pro Met Ala Ala Arg Pro Arg Leu Pro Ala Ser Gly Lys Ile

1025 1030 1035

Pro Pro Pro Ser Ala Pro Ser Gly Leu Thr Thr Ser Pro Gln Lys

1040 1045 1050

Arg Pro Leu Pro Pro Ser Ala Ser Gly Gln Ser Gly Ala Lys Ala

1055 1060 1065

Gly Thr Ser Glu Pro Ser Lys Lys Lys Leu Lys Lys Asn Gly Pro

1070 1075 1080

Ser Leu Gly Ala Pro Asp Ser Thr Ala Glu Gly Asp Glu Ala Ala

1085 1090 1095

Ala Val Gly Gly Asp Gly Ser Lys Pro Ser Asn Gly Ser Leu Phe

1100 1105 1110

Thr Ala Ala Ser Ala Asp Glu Pro Ser Ala Pro Asp Ala Thr Ser

1115 1120 1125

Lys Gly Glu Met Ala Asn Ser Thr Ala Pro Glu Gly Ala Gly Ala

1130 1135 1140

Glu His Gln Ala Pro Ala Gly Thr Ser Asn Asp Asp Gln Asn Pro

1145 1150 1155

Asn His Asp Ser Ala Ala Ala Leu Pro Asn Gly Thr Ala Asp Glu

1160 1165 1170

Ala Ser

1175

<210> 3

<211> 811

<212> DNA

<213> Artificial sequence

<400> 3

ggggaggatt gggggaaaag acatacccgc gaaagggtaa cggattcgca tgatgggcga 60

tctggaagta ggacgtttaa ggggggagat gtgtagaaag aggaggccgt ggaggggaga 120

aagaaaggcc ggaagaggaa aactggatga tgaagcgatg aagatgatgg catgtcatgt 180

ggtttagctt acgatacaga cagacagaca gaccgcagag acgcagcctc aggctgaaac 240

ttgggtttat tgtggttgaa acatcctcgg gaaactccct gccattcttc ttgtccatcg 300

aggctggagt gttgcttgtc cccgttcagt tcaatacatt gacgggttat tgctctcctc 360

gttggattgg gttttttttt atttaatatt aatgcggatt cacttttttt cggctcattc 420

cttatttttc acagtgttgt ctgcctaatt tcattcctat atcttcttct actttgctag 480

ttgcttaact gctggcgtca acgaattgcg cggttggtct gaagctgcgg tcgccgttcc 540

gccttcacgc tccaacttca tctcatccgt tcgcgcagag aaccttataa agaagccctc 600

cagtccccca tcaaatcccc cactgtttca tcacttgggg cctccaaatc atcgtccctc 660

atttcctggc ccctgtcccc taatgtatat gtctttttca gcgtctcaaa aggctccctt 720

gtaccctagc tggacctgat ccgaaccgtg gagaaacgag cccccctcgc ccgccccaga 780

accggggtct tggagcgagc atgtcgctcg g 811

<210> 4

<211> 1015

<212> DNA

<213> Artificial sequence

<400> 4

atgaagcgtc atgatatgat ctgtcctacc tcaatgccat gatcgctatt tccccccgca 60

ctgtactacc tcactatacc atgattattt tacccctatc tctttctacc aattcttatt 120

tcctttttct tttcgtccat gtcttctttg cagtatatta tatcgtccac cacttatgtc 180

ttatctacct tttacccact tttgcttctt attcttcctc acttgttttt ttttcttctc 240

tcatcgcctg ttttcactct tggatgatat atagtgtgcg atatgtggcg tcgcgcttct 300

tcttttcagc tagctgcctt tacccgaacc cacgtttgaa ttcggttcga gttcgagccc 360

ctcttgtcct atctaatccc agcattaaca gtgtgcgaca agagaacgga attacagcgg 420

ggggaacaca caaaaaacag atatatgaga tacacaaata caaacgatgc atccttgttc 480

agtgtacttg ccttgtatac cgtgacacga agatcatgcg tagctgttca acatatatta 540

aactaagggc agggattcaa ttccttccat tacgatctgg cctgcgtcta catcagccct 600

tttgtcttgg cttggcttgt gcgttacttc ttatccagtg ttctggacta aaccggggta 660

tctgccaacc atctactaga taagtgggac cctgtaatat tctttctaga tctcaccagc 720

aaacgctcat ctggtactac cgtgtaacga taacccattc agacggtaag tagccagcag 780

gataacacaa agacagacgg acaggcaggc aggcaggcac ctacatagta cctccatcta 840

cctccgagat gcagcagcat cggcatgcat acatggcatg atcagatcct atctatacta 900

atctaactgc tccaacatac atcccattgc atctgagtac tccaatccac atcagttatt 960

gtctgtttgt ccctgctcag tcagaactat caaccacata agcttgtaat caacg 1015

<210> 5

<211> 651

<212> DNA

<213> Artificial sequence

<400> 5

tgccattggc ggaggggtcc ggacggtcag gaacttagcc ttatgagatg aatgatggac 60

gtgtctggcc tcggaaaagg atatatgggg atcatgatag tactagccat attaatgaag 120

ggcatatacc acgcgttgga cctgcgttat agcttcccgt tagttatagt accatcgtta 180

taccagccaa tcaagtcacc acgcacgacc ggggacggcg aatccccggg aattgaaaga 240

aattgcatcc caggccagtg aggccagcga ttggccacct ctccaaggca cagggccatt 300

ctgcagcgct ggtggattca tcgcaatttc ccccggcccg gcccgacacc gctataggct 360

ggttctccca caccatcgga gattcgtcgc ctaatgtctc gtccgttcac aagctgaaga 420

gcttgaagtg gcgagatgtc tctgcaggaa ttcaagctag atgctaagcg atattgcatg 480

gcaatatgtg ttgatgcatg tgcttcttcc ttcagcttcc cctcgtgcag atgaggtttg 540

gctataaatt gaagtggttg gtcggggttc cgtgaggggc tgaagtgctt cctccctttt 600

agacgcaact gagagcctga gcttcatccc cagcatcatt acacctcagc a 651

<210> 6

<211> 1313

<212> DNA

<213> Artificial sequence

<400> 6

ggatcctcca ggcggatcac aaaatttgtg tcgtttgaca agatggttca tttaggcaac 60

tggtcagatc agccccactt gtaagcagta gcggcggcgc tcgaagtgtg actcttatta 120

gcagacagga acgaggacat tattatcatc tgctgcttgg tgcacgataa cttggtgcgt 180

ttgtcaagca aggtaagtga acgacccggt cataccttct taagttcgcc cttcctccct 240

ttatttcaga ttcaatctga cttacctatt ctacccaagc atccaaatga aaaagcctga 300

actcaccgcg acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg tctccgacct 360

gatgcagctc tcggagggcg aagaatctcg tgctttcagc ttcgatgtag gagggcgtgg 420

atatgtcctg cgggtaaata gctgcgccga tggtttctac aaagatcgtt atgtttatcg 480

gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg agttcagcga 540

gagcctgacc tattgcatct cccgccgtgc acagggtgtc acgttgcaag acctgcctga 600

aaccgaactg cccgctgttc tccagccggt cgcggaggcc catggatgcg atcgctgcgg 660

ccgatcttag ccagacgagc gggttcggcc cattcggacc gcaaggaatc ggtcaataca 720

ctacatggcg tgatttcata tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg 780

tgatggacga caccgtcagt gcgtccgtcg cgcaggctct cgatgagctg atgctttggg 840

ccgaggactg ccccgaagtc cggcacctcg tgcatgcgga tttcggctcc aacaatgtcc 900

tgacggacaa tggccgcata acagcggtca ttgactggag cgaggcgatg ttcggggatt 960

cccaatacga ggtcgccaac atcctcttct ggaggccgtg gttggcttgt atggagcagc 1020

agacgcgcta cttcgagcgg aggcatccgg agcttgcagg atcgccgcgc ctccgggcgt 1080

atatgctccg cattggtctt gaccaactct atcagagctt ggttgacggc aatttcgatg 1140

atgcagcttg ggcgcagggt cgatgcgacg caatcgtccg atccggagcc gggactgtcg 1200

ggcgtacaca aatcgcccgc agaagcgcgg ccgtctggac cgatggctgt gtagaagtac 1260

tcgccgatag tggaaaccga cgccccagca ctcgtccgag ggcaaagaaa tag 1313

Claims

1. OverexpressionSpt7A gene characterized by:Spt7the nucleic acid sequence of the gene is shown as SEQ ID No. 1,Spt7the corresponding amino acid sequence of the gene is shown as SEQ ID No.2,Spt7the nucleic acid sequence of the upstream of the gene is shown as SEQ ID No. 3,Spt7the nucleic acid sequence of the downstream of the gene is shown as SEQ ID No. 4, the nucleic acid sequence of the promoter PglaA of the constructed vector is shown as SEQ ID No.5, and the hygromycin resistance marker gene used in the screeninghygThe nucleic acid sequence of (A) is shown as SEQ ID No. 6.

2. The strain of claim 1 which overexpressesSpt7The genetic aspergillus niger engineering strain is characterized in that: the engineering strain is successfully over-expressedSpt7A gene, designated: OE Spt7 A.niger strain.

3. The strain of claim 2 which overexpressesSpt7The construction method of genetic aspergillus niger engineering strain is characterized by that the selected starting strain isA. nigerCGMCC 10142 strain, overexpression of which is achieved by agrobacterium tumefaciens mediated transformation methodSpt7Plasmid random integration of genes into the Aspergillus niger geneExpression was performed on the panels.

4. The method of construction as claimed in claim 3, including:spt7construction of a Gene overexpression vector, i.e., p44-PglaA-spt7,spt7constructing a gene knockout vector, namely p 44-delta spt7, respectively transferring the expression vector into aspergillus niger strains by virtue of an agrobacterium transformation method, and screening aspergillus niger recombinant strains; the engineering construction method of the Aspergillus niger recombinant strain comprises the following steps:

5. The strain of claim 2 which overexpressesSpt7The application of the genetic aspergillus niger engineering strain in improving the citric acid yield of the recombinant aspergillus niger strain.

6. The strain of claim 2 which overexpressesSpt7The application of the genetic aspergillus niger engineering strain in the aspect of reducing the generation of the heteropolyacid; the reduction of the generation of the heteropolyacid means that the generation amount of the oxalic acid is reduced.