WO2014187269A1

WO2014187269A1 - Method for producing dimerized fusion protein by fermentation

Info

Publication number: WO2014187269A1
Application number: PCT/CN2014/077618
Authority: WO
Inventors: 李红玉; 安黎哲; 支德娟; 李洋; 冯娜; 郭玎玎; 王勇; 史彦斌; 茹毅; 王梅竹; 汤伟; 高江力; 侯荣丽; 徐晶; 鲜军; 徐银丽; 张丽芸; 王海晴; 董信芳; 马兴铭
Original assignee: 兰州大学
Priority date: 2013-03-15
Filing date: 2014-05-15
Publication date: 2014-11-27
Also published as: CN104046642B; CN104046642A

Abstract

Construction and fermentation of dimerized thrombopoietin (TPO) mimetic peptide (TMP) diad-human serum albumin (HSA) fusion protein. The fusion protein contains one HSA and two TPO mimetic peptides that are connected by means of a short connecting peptide and a dimerization domain.

Description

Method for producing dimerized fusion protein by fermentation

Technical field

The present invention belongs to the field of genetic engineering pharmaceuticals, and more particularly to a method for expressing and producing a dimerized fusion protein in an inducible manner in Pichia pastoris.

Background of the invention

Pichia pastoris iPichiapastoris is the most widely used exogenous protein expression host, one of the methanolic yeasts that can grow in medium with methanol as the sole carbon source (Xiong Hua, 2006). Pichia pastoris is one of the most mature foreign protein expression systems to date, and hundreds of foreign protein genes have been expressed in Pichia pastoris. There are several basic conditions for the expression of a foreign gene in Pichia pastoris: one is the need for a highly efficient promoter and terminator; the other is to have a homologous sequence so that the foreign gene can be efficiently integrated into the Pichia genome. The third is to have a high-throughput screening method. In addition, the expression of the foreign gene in Pichia pastoris is also the culture conditions, the preference of the codon, and the tertiary structure of the protein.

The most widely used inducible promoter is the promoter of Alcohol Oxidase (AOX). In Pichia pastoris, there are two different genes that encode alcohol oxidase: A0X1 and A0X2, respectively. There is 97% amino acid sequence homology between the two. In Pichia pastoris cells, expression of the gene A0X1 plays a major role in alcohol oxidase activity. The first step in methanol metabolism is the oxidation of methanol to form formaldehyde and hydroperoxide. To avoid cellular hydroperoxide poisoning, methanol metabolism is carried out in peroxisomes. The expression of the A0X1 gene is strictly regulated and can be reached at a very high level by methanol induction. Typically, when the Pichia pastoris cells are grown in a medium containing methanol, the AOX1 expression product can account for 30% of the total soluble protein of the cell. Above, while AOX2 is very low.

Pichia pastoris has many advantages as a foreign protein expression system. It belongs to lower eukaryotes and has the characteristics of both eukaryotes and prokaryotes. Pichia pastoris is a single-celled organism with a relatively thorough genetic background. Its physiological and biochemical properties are clear, and its genetic engineering operations are simpler and faster than plant or animal cells. At the same time, it acts as a eukaryote. It also possesses properties not found in prokaryotes, such as post-translational processing and modification of proteins, including disulfide bond formation, glycosylation, and fatty acylation. For cytotoxic exogenous recombinant proteins, it can be localized to the peroxisome of Pichia pastoris, which can ensure that the host cells are not damaged by toxic proteins, and can prevent the degradation of the foreign recombinant protein by the protease. For extracellularly expressed proteins, since Pichia has a small amount of secreted proteins, it facilitates the isolation and purification of exogenous recombinant proteins. Pichia pastoris strains and their metabolites are not toxic to any mammal, and they are capable of high-density fermentation, low cost of cultivation, simple operation, and are highly suitable for industrial large-scale fermentation production.

The technology for the production of recombinant proteins by Pichia pastoris as an expression vector is now relatively mature. The fermentation strategy of the company is usually used in the fermentation strategy of the company, Pichia Fermentation Process Guidelines. The specific process is summarized as follows:

1 enrichment stage: inorganic salt medium, glycerol as a carbon source, add ammonia water to supplement the nitrogen source, and adjust the pH to about 6.0.

2 Induced expression stage: Inorganic salt culture, adding methanol as a carbon source, adding ammonia water as a nitrogen source, and adjusting the pH to about 6.0. With the gradual application of this expression system, more and more different types of fusion proteins have been tried to induce expression using the Pichia system, but during the fermentation process, different foreign genes are integrated into the host chromosome. The changes in the properties of the bacteria cause great differences in the culture characteristics of the engineering bacteria. Therefore, the traditional fermentation strategy is often not used to achieve the desired fermentation effect.

The invention discloses the construction and fermentation of a dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein. The fusion protein comprises 1 HSA and 2 TP0 mimetic peptides TMP linked by a short peptide and a dimerization domain, and the fusion protein is transformed into a Pichia pastoris strain, and a fusion protein gene is integrated. Pichia pastoris, and this engineered bacteria is effective in shake flasks The protein of interest is expressed. However, when we fermented the Pichia yeast host strain integrated with the fusion protein gene into the cans according to the invitrogen fermentation strategy Pichia Fermentation Process Guidelines, it was found that the host bacteria could not accumulate to the desired biomass and could not achieve the target protein. Effectively induce expression. In view of the above problems, the present invention provides a fermentation strategy of a dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein in Pichia pastoris, which is suitable not only for the growth of engineered bacteria but also for the growth of engineered bacteria. The productivity of the target protein induced by the engineered bacteria can be significantly improved.

Summary of the invention

It is an object of the present invention to provide a method for expressing a dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein in recombinant Pichia pastoris.

Another object of the present invention is to provide a method for efficiently fermenting recombinant Pichia pastoris to produce recombinant protein.

The present invention provides a DNA sequence encoding a dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein, the nucleotide sequence of which is shown in SeqID No. 1.

The dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein of the present invention has an amino acid sequence as shown in SeqID No. 2.

The DNA sequence encoding the dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein of the present invention, which is recombinantly expressed in pPmka-HC or other capable of inducing expression and secretion of recombinant protein to extracellular After the plasmid vector, the recombinant plasmid vector is integrated into the chromosome of the yeast host cell.

The yeast host cell of the present invention is Pichia PmkTM Expression Strains or other yeast strain capable of expressing a foreign gene.

The present invention also provides a method for efficiently expressing and producing a dimeric chitosan-promoting peptide TMP conjugate-human serum albumin fusion protein using the PichiaPinkTM Expression Strains, which comprises the following stages:

a: Preparation of seed solution: Pick a yeast single colony integrated with SeqID No. 1 DNA sequence stored at -20 ° C, inoculate it in 10 mL of YPD liquid medium, shake culture at 30 ° C overnight, to 10% v / v The inoculation amount was transferred to 100 mL of YPD liquid medium, cultured at 30 ° C for 24 hours, and then transferred to 1 L of BMGY medium at 10% v/v inoculation, and cultured at 30 ° C for 16-24 hours. When the amount of yeast in the fermentation broth reaches OD600 = 5-20, the fermentation is stopped, and the fermentation broth is used as a seed liquid for fermentation in the fermenter.

b: Cell culture: 7L base salt fermentation medium is contained in a 20L fermenter, and each 1L base salt fermentation medium contains 40g 100% glycerol, 26.7ml 85% v/v phosphoric acid, 0.93g calcium sulfate, 18.2 g potassium sulfate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, cultured for 20-28 hours.

c: Flowing carbon source: Adding feed liquid through peristaltic pump, the feed liquid is 50% v/v glycerin aqueous solution containing 12ml PTM 1 L, flow rate is 10 ml/hr L, 30 °C ventilation Stirring for 2-8 hours, until the wet weight of the fermentation broth reaches 180-220 g L;

d: induced expression: a three-stage pulsed flow plus 100% methanol, the methanol contains 12ml / L PTM l, to ensure that the dissolved oxygen in the fermentation broth is always greater than 20%, 26-28 °C aeration and stirring culture 60- 96 hours:

The first stage: a 2 ml/hr/L pulse stream plus 100% methanol for 8 hours, the methanol contains 12 ml of PTM 1 L, and 0.5 M of citric acid is added at this stage to adjust the pH of the fermentation broth at 5.90-6.00.

The second stage: 4 ml / hr / L pulse flow plus 100% methanol for 4 hours, the methanol contains 12ml PTM 1 L, this stage adds 50% v / v The ammonia water adjusts the pH of the fermentation broth at 5.90-6.00.

The third stage: 8 ml/hr L pulse flow plus methanol for 48-72 hours to the end of the fermentation, the methanol contains 12 ml of PTM 1 L, and the stage is added with 50% v/v ammonia to adjust the pH of the fermentation broth at 5.90-6.00. DRAWINGS

Figure 1. Dimerized thrombopoietin peptidomimetic peptide TMP dimer - Human serum albumin fusion protein gene fragment construction pathway Figure 2. Pichia pastoris fermentation process parameters (experimental group)

Figure 3. Parameters of Pichia pastoris fermentation process (control group)

Figure 4. Pichia pastoris fermentation results (experimental group): lane 1 is the standard protein molecular weight; lane 2 is the HSA protein; lane 3 is the final fermentation product.

Figure 5. Pichia pastoris fermentation results (control group): lane 1 is the standard protein molecular weight; lane 2 is the HSA protein; lane 3 is the final fermentation product.

Example 1 Construction and screening of dimerized thrombopoietin mimetic peptide TMP conjugate-human serum albumin fusion protein expression vector 1. Construction of vector containing TMP-Ll-TMP-L2-H-fip-HSA

Using the yeast expression vector pPinka-HC (invitrogen, USA) as a template, using the primers P12 (cccgctttttggatgatt), P13 (gacttccggagccgccaccggccctagcagccagccctgccgcagtgtggggccttcgat cc cage ctcgagagatacc), α-factor-TMP-Ll was obtained by PCR amplification, and the gene sequence such as Seq ID No: As shown in 3, the amino acid sequence is shown as Seq ID No: 4.

The plasmid pcDNA3.1-fip-HSA (plasmid pcDNA3.1 was purchased from Invitrogen, fip-HSA was synthesized by Dalian Bao Biotech Co., Ltd.) as a template, and primer 1 ( gaaaccactctagagaagtgctgtg ) and arch I 2 ( cggggtacctcagtggtggtggtggtggtgtaagcctaaggcagcttgacttgcagc ) were used for PCR. Amplification obtained HSA (post)-His, the gene sequence is shown as Seq ID No: 5, and the amino acid sequence is shown as Seq ID No: 6. The amount of template DNA in the above PCR amplification reaction is 250 ng, the primer is ΙΟΟρΜ, the polymerase is EasyA PolymeraseC Stratagene, USA), using 50μ1 system, 30 cycles reaction (pre-denaturation at 94 °C for 3 min; 94 denaturation 30 56 (;, 55 annealing) 30 56 (;, 72 ° C extension for 2 min).

The whole gene is synthesized by TMP-L2-H-fip-HSA (pre), the gene sequence is shown as Seq ID No: 7, and the amino acid sequence is shown as Seq ID No: 8.

Under the same conditions, the pPinka-HC vector (invitrogen, USA) was double-digested with Sacl and Kpnl, and the pPinka-HC vector fragment (6902 bp) was recovered. 5 α-factor-TMP-Ll was treated with restriction endonucleases BspEl and Sad, respectively, and 5 μ _δ HSA (post) fragment was taken and treated with restriction endonuclease Kp«I, Χ6«Ι, respectively. (figure 1 ).

The restriction endonuclease-treated three fragments were ligated to obtain a human serum albumin-thrombopoietin fusion gene fragment, which was ligated to the yeast expression vector pPmka-HC by molecular cloning, and finally the Pichia pastoris recombinant plasmid was constructed. pPinka-TMP-Ll -TMP-L2-H-fip-HSA (Figure 1). Methods as below:

pPinka-HC (Sac l / Kpn l ) 1.5μ1 TMP-L2-H-fip-HSA (pre ) ( spEl/ Xbal) 6 μΐ

α-factor-TMP-Ll ( spElfSacl) 7μ1

HSA (Post) -Bis (Kpnl / Xbal) 7 μΐ

10χΤ4 ligase buffer 2.5μ1

T4 DNA ligase Ι μΐ

At 16 ° C, the reaction was carried out after the overnight ligation reaction: 4 μΐ of the ligation product was mixed with 50 μΐ of TOP10 E. coli competent cells (mvitrogen, USA), and then placed in a 0.1 cm electric shock cup, and the electric shock was performed once under the corresponding program of the electrorotator ( 1.8KV, 3.4ms), quickly add 1ml LB medium, mix and transfer to 1.5ml centrifuge tube, incubate for 1hr at 37°C, 150rpm, and apply appropriate amount of bacteria solution to LB (Amp+) plate. Store in a 37 ° C incubator and incubate overnight.

Monoclonal access to lmL LB liquid medium from the transformation plate, culture at 37 ° C, 220 rpm for 6-8 hr, PCR screening of bacterial cells, screening for a small amount of plasmid after positive inoculation, and enzyme digestion identification, After the enzyme digestion was confirmed, it was sent to the company for sequencing. The correct pPinka-TMP-Ll-TMP-L2-H-fip-HSA plasmid was clone No. 1. Example 2: Transformation, Screening, Identification of Recombinant Vectors Screening and identification of expression vectors usually adopt the following methods: First, the Pichia pastoris recombinant plasmid, pPinka-TMP-Ll-TMP-L2-H-fip-HSA, with restriction The endonuclease was linearized, transferred to Pichia pastoris by electroporation, plated for 3-7 days, and 3-8 white clones were selected for inoculation into liquid BMGY medium (recipe reference PiCHIPink ^TM Expression System) )), replace the BMMY liquid medium (recipe according to the "PichiaPink ^TM Expression System") and continue to shake the flask for 3-4 days to obtain a small amount of expression product, which can be PCR, SDS-PAGE or Western blot. Example 4) Screening and identification of the expression product; then optimizing the fermentation conditions of the selected strain containing the appropriate positive target band, thereby realizing the recombinant Pichia pastoris dimerization thrombopoietin mimetic peptide TMP doublet - High expression of human serum albumin fusion protein. Detailed procedures can be found in the PichiaPinkTM Expression System (Invitrogen, USA) operating instructions. The specific method of electrical transformation of the expression vector is as follows:

1) Large-scale extraction of the constructed recombinant plasmid pPinka-TMP-Ll-TMP-L2-H-fip-HSA plasmid DNA, followed by restriction endonuclease Λ/ΠΙ (NEB, USA) to linearize the plasmid, purification and quantification After the backup.

2) Preparation of competent yeast: The ^{PichiaPink TM Expression Strains (invitrogen, USA} ) streaked on a YPD plate, 28 ° C for 3-5 days culture. After the clone was grown, the monoclonal was picked into 10 ml of YPD medium at 28 ° C, and cultured at 300 rpm for 1-2 days. 1 ml of the culture was added to 100 ml of YPD medium, and cultured to OD ₆ under the same conditions. . =1.3-1.5. The culture was transferred to a 250 ml centrifuge tube, centrifuged at 1500 x g for 5 mm at 4 ° C, the supernatant was discarded, and the pellet was resuspended in 250 ml of ice water. The previous step was repeated and centrifuged again, the supernatant was discarded, and the pellet was resuspended in 50 ml of ice water. The previous step was repeated and the centrifugation was continued, the supernatant was discarded, and the pellet was resuspended in 10 ml of 1 M sorbitol. The conditions of the previous step were repeated, the centrifugation was continued, the supernatant was discarded, and the pellet was resuspended in 300 μl of 1 Torr of sorbitol. The prepared yeast competent state was placed on ice and used on the same day.

3) The 10 linearized pPinka-TMP-Ll-TMP-L2-H-fip-HSA plasmid DNA was mixed with the prepared yeast strain competent cells and transferred to a 0.2 cm electric shock cup. Set 5mm on the ice and electric shock once under the program corresponding to the electric machine. Immediately add the YPDS in the lml ice bath, mix and place in a 28 °C incubator for 6 hr. The appropriate amount of the bacterial suspension was applied to the PAD plate and cultured at 28 ° C for 3-10 days. After the apparent cloning, multiple white clones were picked and re-streaked on the PAD plate.

The white clones which were respectively picked up by the double scribing were inoculated into 50 ml of BMGY medium, and cultured at 28 ° C, 300 rpm for 3 days.

The bacterial solution was centrifuged, the supernatant was discarded, and the cells were resuspended in 10 ml of BMMY medium, and cultured at 28 ° C, 300 rpm for 72-96 hr. 500 μl was sampled every 12 hr and 500 μl of 40% methanol was added. After sampling, the remaining cells were further cultured, and the samples were centrifuged at 1500 x g for 10 min. The supernatant and precipitate were stored at -80 ° C for subsequent detection.

At the end of induction, all cells were collected, centrifuged at 1500 x g for 10 mm, and the supernatant and pellet were stored at -80 °C.

The supernatant and precipitated samples of all the above clones before and after induction were subjected to reducing SDS-PAGE electrophoresis. Only the supernatant sample after methanol induction had a target band at 75 kDa, and the expression time was induced. Increase, the content of the strip object increases. The clone having the highest expression level of the target was selected as the obtained yeast strain No. 1 having the TMP-L1-TMP-L2-H-fip-HSA sequence.

Example 3 Fermentation of Pichia pastoris recombinant with TMP-Ll-TMP-L2-H-fip-HSA sequence

YPD liquid medium (1L as an example): 10g yeast extract, 20g peptone, 20g glucose.

BMGY medium (1L as an example): 10g yeast extract, 20g peptone, 100ml 1 M pH6.0 phosphate buffer, 13.4g amino acid-free yeast basic nitrogen source medium, 0.004g biotin, 10g l00% glycerol .

BMMY medium (1L as an example): 10g yeast extract, 20g peptone, 100ml of 1 M pH6.0 phosphate buffer, 13.4g amino acid-free yeast basic nitrogen source medium, 0.004g biotin, 5ml 100% methanol .

Fermentation base salt medium (1 L as an example): 40 g l00% glycerol, 26.7 ml 85% v/v phosphoric acid, 0.93 g calcium sulfate, 18.2 g potassium sulfate, 14.9 g magnesium sulfate heptahydrate, 4.13 g potassium hydroxide.

PTMj (1L as an example): 6.0g copper sulfate pentahydrate, 0.08g sodium iodide, 3.0g magnesium sulfate, 0.2g sodium molybdate, 0.02g boric acid, 0.5g cobalt chloride, 20g zinc chloride, 65g heptahydrate Ferrous sulfate, 0.2 g biotin, 5 ml sulfuric acid.

a: Preparation of seed solution: Pick a single colony of Pichia pastoris stored at -20 °C, inoculate it in 10 mL of YPD liquid medium, shake overnight at 30 °C, and transfer to 100 mL with 10% inoculum. YPD liquid medium, cultured at 30 °C for 24 hours, then transferred to 1 L BMGY medium with 10% v/v inoculum, shake culture at 30 °C for 16-24 hours, to the amount of yeast in the fermentation broth When the OD600 = 5-20 is reached, the fermentation is stopped, and the above fermentation liquid is used as a seed liquid for fermenter fermentation.

The first stage: 2 ml/hr L pulse flow plus 100% methanol for 8 hours, the methanol contains 12 ml of PTM 1 L, and the pH of the fermentation broth is adjusted to 5.90-6.00 with 0.5 M citric acid.

The second stage: 4 ml/hr L pulse flow plus 100% methanol for 4 hours, the methanol contains 12 ml of PTM 1 L, and the stage is adjusted with 50% v/v ammonia water to adjust the pH of the fermentation broth at 5.90-6.00.

The third stage: 8 ml / hr L pulse flow plus 100% methanol for 48-84 hours to the end of the fermentation, the methanol contains 12ml PTM 1 L, this stage with 50% v / v ammonia water flow to adjust the fermentation broth pH at 5.90 -6.00. The control group also used Pichia pastoris strain 1 for fermentation, and the fermentation strategy commonly used in the Pichia Fermentation Process Guidelines was used to induce the expression of the target protein:

a: Preparation of seed solution: Pick a single colony of Pichia pastoris stored at -20 °C, inoculate it in 10 mL of YPD liquid medium, shake overnight at 30 °C, and inoculate at 10% v/v. The cells were cultured in a 100 mL YPD liquid medium at 30 ° C for 24 hours, then transferred to 1 L BMGY medium at a 10% v/v inoculum, and cultured at 30 ° C for 16-24 hours until the fermentation broth. When the amount of yeast reaches OD600 = 5-20, the fermentation is stopped, and the above fermentation liquid is used as a seed liquid for fermentation of the fermenter.

c: Flowing carbon source: Adding feed liquid through peristaltic pump, the feed liquid is 50% v/v glycerin aqueous solution containing 12ml PTM 1 L, flow rate is 10 ml/hr L, 30 °C ventilation Stirring for 2-8 hours, until the wet weight of the fermentation broth reaches 180-220g / L;

The first stage: a 2 ml/hr/L pulse stream plus 100% methanol for 4 hours, the methanol containing 12 ml of PTM 1 L.

The second stage: a 4 ml/hr/L pulse stream plus 100% methanol for 4 hours, the methanol containing 12 ml of PTM 1 L.

The third stage: a pulse flow of 8 ml/hr/L plus 100% methanol for 52-88 hours to the end of the fermentation, the methanol containing 12 ml of PTM 1 L. The above-mentioned addition stage uses a 50% v/v ammonia stream to adjust the pH of the fermentation broth at 5.90-6.00.

The fermentation results are shown in Fig. 2 and Fig. 3. In the experimental group, the amount of Pichia pastoris 1 gradually increased; while in the control group, the amount of Pichia pastoris gradually increased in the glycerol enrichment stage. High, but gradually decreased in the methanol-induced expression phase.

Example 4 Western blotting detection of the target protein

The purified target product (control sample, experimental sample) to be detected is subjected to Western blotting.

1) Conventional SDS-PAGE method, the specific steps are omitted.

2) Transfer film: Prepare 4 sheets of filter paper, one nitrocellulose membrane, according to the size of the target protein area block indicated by Protein Maker. Soak the filter paper, membrane and sponge in the electric clip with electric fluid. After the electrophoresis is completed, the gel block containing the protein of interest is cut out, and the electric clip is clamped in the order of sponge-two filter paper-nitrocellulose membrane-block-two filter paper-sponge, and the membrane is on the positive side. Place the ice cube in the electric rotating tank to cool down, 300mA, 1 hour.

3) Closed: Remove the membrane from the electrorotation tank, rinse with TTBS 30mm, immerse in blocking solution (1% w/v casein) and shake slowly for 2 hours.

4) Combining primary antibody: Immerse the membrane in a closed plastic membrane containing primary antibody (Anti-HSA/human, 1:1000, Shanghai Biotech), incubate for 1 hour at room temperature or overnight at 4 °C.

5) Washing: After the primary antibody is incubated, rinse with TTBS three times, 5-10 mm each time.

6) Binding to the secondary antibody: The membrane was immersed in a closed plastic membrane containing a secondary antibody (horseradishase-labeled goat anti-mouse IgG, 1 : 1000, Nakasu Jinqiao Biotechnology Co., Ltd.) and incubated for 1 hour at room temperature with gentle shaking.

7) Washing: After the incubation of the secondary antibody, rinse the membrane three times with TTBS, 5-10 mm each time. 8) DAB color development. Follow the steps of DAB staining kit (Beijing Boaosen Biotechnology Co., Ltd.).

The test results are shown in Fig. 4 and Fig. 5. Fig. 4 shows that the target product (TMP-L1 - TMP-L2-H-fip-HSA) was detected in the fermentation product of the experimental group, and Fig. 5 showed that the control product was not detected in the fermentation product. The desired product. Both the fermentation result and the target product detection result indicate that when the fermentation strategy of the present invention is used to ferment the Pichia pastoris strain No. 1, the strain can grow rapidly and stably in a high methanol environment, and the wet weight of the bacteria is obviously increased and expressed. The protein of interest. When the fermentation strategy of the classic im trogen was used for fermentation, the Pichia pastoris strain 1 could not grow in a high concentration of methanol, the wet weight of the bacteria gradually decreased, and a large number of deaths occurred, and the target protein could not be expressed.

Claims

Claim WO 2014/187269 PCT/CN2014/077618

A DNA sequence encoding a dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein, characterized in that the nucleotide sequence thereof is as shown in SeqID No. 1.

2. Dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein characterized in that its amino acid sequence is as shown in SeqID No. 2.

The DNA sequence encoding the dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein according to claim 1, wherein the sequence is recombinantly expressed in pPinka-HC or other capable of inducing expression. After the recombinant protein is secreted into an extracellular plasmid vector, the recombinant plasmid vector is integrated into the chromosome of the yeast host cell.

The DNA sequence encoding the dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein according to claim 3, wherein the yeast host cell is PichiaPink ^TM Expression Strains Or other yeast strain capable of expressing a foreign gene.

5. PichiaPink ^TM Expression Strains efficiently expresses and produces a method for encoding a dimeric thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein, including a glycerol enrichment stage and a methanol induced expression stage. It is characterized in that: in the initial stage of the methanol-induced expression phase, the pH of the fermentation broth is adjusted to 5.90-6.00 with 0.5 M citric acid.

The method for efficiently expressing and producing a dimerized thrombopoietin peptidomimetic TMP dimer-human serum albumin fusion protein according to claim 5, wherein the PichiaPinkTM Expression Strains is characterized by: At the beginning of the methanol-induced expression phase, the flow acceleration of 100% methanol was 2 ml/hr/L, the addition time was 8 hours, and methanol contained 12 ml of PTM 1 L.