CN110628804A - Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol - Google Patents
Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol Download PDFInfo
- Publication number
- CN110628804A CN110628804A CN201910548636.2A CN201910548636A CN110628804A CN 110628804 A CN110628804 A CN 110628804A CN 201910548636 A CN201910548636 A CN 201910548636A CN 110628804 A CN110628804 A CN 110628804A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- spt15
- plasmid
- isobutanol
- ycplac22
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for constructing a saccharomyces cerevisiae strain with high tolerance to isobutanol, which relates to a technology for introducing mutant DNA (deoxyribonucleic acid) recombination into a yeast by using a carrier, transforms a saccharomyces cerevisiae cell by using molecular biology and gene recombination technology, converts a plasmid YCplac22-spt15-30 of an over-expression saccharomyces cerevisiae mutant gene spt15-30 into a host bacterium, namely a saccharomyces cerevisiae wild strain W303-1A, and screens a transformant with the plasmid after culturing for 2-3 days on a CM-Tryptophan solid culture medium to construct the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol. The invention overcomes the defects that the yield of the isobutanol is reduced in the later fermentation period and the tolerance of the existing saccharomyces cerevisiae strain for producing the isobutanol cannot adapt to the requirement of further improving the yield of the isobutanol in the later fermentation period in the prior art.
Description
Technical Field
The technical scheme of the invention relates to a recombinant technology for introducing mutant DNA into yeast by using a vector, in particular to a method for constructing a saccharomyces cerevisiae strain with high tolerance to isobutanol.
Background
Isobutanol has low volatility, corrosivity, high octane number and energy density, is easy to store and transport, and is a novel biofuel with great market potential. The saccharomyces cerevisiae has better tolerance to isobutanol, has the advantages of utilizing cellulose hydrolysate and the advantages of synthesizing isobutanol by itself, and can be used as an advantageous host strain for producing isobutanol.
Prior art CN103789341B discloses a method for constructing a high-yield strain of saccharomyces cerevisiae isobutanol, which has the defects that the yield of isobutanol is reduced in the later fermentation period, and the isobutanol tolerance of the existing saccharomyces cerevisiae strain for producing isobutanol cannot be adapted to the requirement of further improving the yield of isobutanol in the later fermentation period.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: the method comprises the steps of modifying a saccharomyces cerevisiae cell by using molecular biology and gene recombination technology, transforming a plasmid YCplac22-spt15-30 of an over-expression saccharomyces cerevisiae mutant gene spt15-30 into a host bacterium which is a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-trypophan solid culture medium, screening a transformant with the plasmid, and constructing the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol.
The technical scheme adopted by the invention for solving the technical problem is as follows: a method for constructing a saccharomyces cerevisiae strain with high tolerance to isobutanol is characterized by transforming a saccharomyces cerevisiae cell by using molecular biology and gene recombination technology, transforming a plasmid YCplac22-spt15-30 of an over-expression saccharomyces cerevisiae mutant gene spt15-30 into a host bacterium which is a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-Tryptophan solid culture medium, screening a transformant with the plasmid, and constructing the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol, wherein the specific steps are as follows:
firstly, constructing a plasmid YCplac22-spt15-30 for over-expressing a saccharomyces cerevisiae mutant gene spt 15-30:
(1.1) Synthesis of a fragment of the mutant Gene spt 15-30:
designing a mutation site according to the sequence of the SPT15 gene on the chromosome W303-1A of the saccharomyces cerevisiae, and synthesizing a mutant gene SPT15-30 fragment;
(1.2) construction of plasmid YCplac22-spt15-30 for overexpression of Saccharomyces cerevisiae mutant gene spt 15-30:
the plasmid YCplac22 and the mutant spt15-30 fragment obtained in step (1.1) above were digested with restriction enzymes SalI and BamHI, respectively, as follows: DNA was 5. mu.L, digested with SalI and BamHI each 0.25. mu.L, 10 Xenzyme buffer 2. mu.L, sterile water 12.5. mu.L at 37 ℃ for 10min, and digested with T4The plasmid YCplac22 and the mutant gene spt15-30 fragment are connected by ligase, and the connection operation is as follows: into a 1.5mL centrifuge tube, 10 XT was added4Ligase buffer 2. mu. L, T4Respectively adding 0.2 mu L of ligase, 0.5 mu L-8 mu L of plasmid YCplac22 and the mutant gene spt15-30 fragment obtained in the step (1.1), supplementing the total volume to 20 mu L with sterile water, connecting for 1-2 h at 16 ℃ to obtain a connection product, transferring 10 mu L of the connection product into escherichia coli competent cells for culture, extracting plasmids, and constructing the plasmid YCplac22-spt15-30 of the over-expressed saccharomyces cerevisiae mutant gene spt15-30 through enzyme digestion verification;
secondly, constructing a saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol:
and (2) transforming the plasmid YCplac22-spt15-30 for over-expressing the saccharomyces cerevisiae mutant gene spt15-30 constructed in the first step into a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-Tryptophan solid culture medium, and screening a transformant with the plasmid to construct a saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol, namely MATa leu2-3,112ura3-1trp1-92his3-11,15ade2-1can1-100YCplac22-spt 15-30.
A large number of experiments prove that: the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol can be constructed by the method.
The method for constructing the saccharomyces cerevisiae strain with high tolerance to isobutanol is characterized in that the operation method for transforming the plasmid YCplac22-spt15-30 for over-expressing the saccharomyces cerevisiae mutant gene spt15-30 into the saccharomyces cerevisiae wild strain W303-1A is as follows:
(1) inoculating the wild strain W303-1A of the Saccharomyces cerevisiae on the plate into 5mL YPD liquid culture medium, and carrying out shaking culture at 30 ℃ and 200rpm overnight;
(2) boiling 2mg/mL of carrier DNA in boiling water bath for 5 minutes, and then rapidly placing on ice;
(3) putting 1.5mL of the saccharomyces cerevisiae culture solution obtained in the step (1) into a centrifuge tube, centrifuging at 13000rpm for 30sec, collecting thalli, and removing supernatant;
(4) to the tube of (3) above, 360. mu.L of the transformation mixture was added and mixed by vortexing on a vortex separator at a high speed, and the transformation mixture was prepared as follows:
(5) carrying out water bath on the transformation system obtained in the step (4) at 42 ℃ for 20-30 minutes;
(6) centrifuging the transformation system treated in the step (5) for 30s at the rotating speed of 13000rpm by using a centrifugal machine, collecting thalli, and discarding supernatant;
(7) and (3) resuspending the thallus obtained in the step (6) by using 100 mu L of sterile water, coating the thallus on a proper screening plate, and culturing for 2-3 days at the temperature of 30 ℃ to complete the transformation of the plasmid YCplac22-spt15-30 into the saccharomyces cerevisiae wild strain W303-1A.
One of the above-described methods for constructing a strain of Saccharomyces cerevisiae with high tolerance to isobutanol, using well-known and commercially available starting materials, is to:
coli E.coli Top10 was purchased from Beijing Tiangen Biochemical technology Ltd;
the host strain Saccharomyces cerevisiae is W303-1A (MATa leu2-3,112ura3-1trp1-92his3-11,15ade2-1can1-100(Thomas and Rothstein, 1989));
plasmid YCplac22 was purchased from Beijing Tiangen Biochemical technology Ltd;
the spt15-30 mutant gene fragment was synthesized by Beijing Okkensheng Biotech Co., Ltd;
support DNA (Single-stranded DNA) was obtained from Sigma-Aldrich.
PEG4000 50% (v/v), 10 XTE (pH7.5) 10% and 10 lithium acetate stock solution 10%.
LB (Luria-Bertani) liquid medium: 1% tryptone, 0.5% yeast extract and 1% NaCl, adjusted to pH7.5 with NaOH, sterilized at 121 ℃ for 25min, cooled to room temperature and added ampicillin to a final concentration of 1g ampicillin/L, to give LB liquid medium.
LB solid medium: adding 1.5% agar powder into LB liquid culture medium with pH value of 7.5, sterilizing at 121 deg.C for 25min, cooling to room temperature, adding ampicillin to final concentration of 1g ampicillin/L to obtain LB solid culture medium.
YPD liquid medium: 1% yeast extract and 2% peptone, sterilized at 121 ℃ for 25min under natural pH conditions, and then separately sterilized 40% glucose was added to a final concentration of 2%.
YPD solid Medium: 1.5% (w/v) agar powder was added to YPD liquid medium and sterilized at 121 ℃ for 25 min.
Complete minimal medium (CM): 0.67% YNB (Bacto Yeast Nitrogen Base with out Amino Acids (Difco)) and 0.83g/L Dropout Power, wherein Dropout Power consists of the following components: adenine 50mg/L, leucine 100m/L, arginine 20mg/L, lysine 30mg/L, aspartic acid 100mg/L, methionine 20mg/L, glutamic acid 100mg/L, phenylalanine 50mg/L, histidine 100mg/L, serine 150mg/L, isoleucine 30mg/L, threonine 150mg/L, tryptophan 100mg/L, tyrosine 30mg/L, uracil 50mg/L, valine 150 mg/L.
Omitting the above specific amino acid components, making into selective culture medium, adjusting pH to 5.6 in liquid culture medium and pH to 6.5 in solid culture medium, adding 1.5% agar, and sterilizing at 121 deg.C for 25 min.
The above-mentioned percentages are mass percentages unless otherwise indicated.
The method for constructing the saccharomyces cerevisiae strain with high tolerance to isobutanol is characterized in that mutation sites are designed according to the sequence of the SPT15 gene on the saccharomyces cerevisiae W303-1A chromosome, and the synthesis of the SPT15-30 fragment of the mutant gene is completed by a gene synthesis company.
The above-mentioned method for constructing a Saccharomyces cerevisiae strain with high tolerance to isobutanol is performed by a process known to those skilled in the art.
The invention has the following beneficial effects:
compared with the prior art CN103789341B, the invention has the following prominent substantive characteristics that the invention applies molecular biology and gene recombination technology to transform the saccharomyces cerevisiae cell, the host bacterium is saccharomyces cerevisiae, simultaneously the plasmid YCplac22-spt15-30 of over-expression mutant gene spt15-30 is transferred, and the mutant gene recombination DNA technology is applied to transform the saccharomyces cerevisiae cell to construct the saccharomyces cerevisiae strain with high tolerance to isobutanol.
Compared with the prior art, the invention has the remarkable improvements that: the saccharomyces cerevisiae strain constructed by the method solves the key technical problem of low isobutanol tolerance of the strain which restricts the further improvement of isobutanol yield at present, and provides an excellent strain for synthesizing isobutanol by a biological method. The method specifically comprises the following steps: compared with the strain HBGDAL-103 obtained by CN103789341B, the 'saccharomyces cerevisiae strain HBGDAL-104' prepared by the method has greatly improved isobutanol tolerance: the relative survival rate of strain HBGDAL-104 produced by the method of the present invention was 9.25 times higher than that of strain HBGDAL-103 produced by CN103789341B when cultured in YPD liquid medium containing 2.5% isobutanol for 32 hours (see the description of FIG. 1 for details). In addition, the yield of isobutanol of the saccharomyces cerevisiae strain HBGDAL-104 constructed by the method is improved by 11 times compared with that of a control strain by fermenting the saccharomyces cerevisiae strain HBGDAL-104 in a YPD liquid culture medium with the initial glucose concentration of 6% for 32 hours. The data show that the 'saccharomyces cerevisiae strain HBGDAL-104' prepared by the method has unexpected technical effect on the tolerance to the isobutanol compared with the prior 'saccharomyces cerevisiae strain HBGDAL-103' and other prior related saccharomyces cerevisiae strains.
Drawings
The invention is further illustrated with reference to the following figures and examples.
FIG. 1 is a graph showing the relative survival rate of s.cerevisiae strain HBGDAL-104, i.e., W303-1A YCplac22-spt 15-30.
FIG. 2 is a restriction map of plasmid YCplac22-spt 15-30.
FIG. 3 shows the DNA sequence of the mutant gene spt 15-30.
Detailed Description
The example shown in FIG. 1 shows that the relative survival rate of strain HBGDAL-104, W303-1A YCplac22-spt15-30 produced by the method of the present invention is 9.25 times the relative survival rate of strain HBGDAL-103, W303-1A YCplac22 produced by CN103789341B, as shown by the time-relative survival rate curve, when cultured in YPD liquid medium containing 2.5% isobutanol for 32 hours.
The example shown in FIG. 2 shows that plasmid YCplac22-spt15-30 is a mutant DNA sequence with spt15-30 linked to plasmid YCplac22, and the restriction enzyme sites at both ends of the mutant DNA of spt15-30 are SalI and BamHI.
Example 1
A saccharomyces cerevisiae cell is transformed by using molecular biology and gene recombination technology, a plasmid YCplac22-spt15-30 of an over-expression saccharomyces cerevisiae mutant gene spt15-30 is transformed into a host bacterium, namely a saccharomyces cerevisiae wild strain W303-1A, MATaleu2-3,112ura3-1trp1-92his3-11, and 15ade2-1can1-100(Thomas and Rothstein,1989), and the specific steps are as follows:
firstly, constructing a plasmid for over-expressing a saccharomyces cerevisiae mutant gene spt 15-30:
(1.1) Synthesis of a fragment of the mutant Gene spt 15-30:
designing a mutation site according to the sequence of the SPT15 gene on the chromosome W303-1A of the saccharomyces cerevisiae, entrusting a gene synthesis company to synthesize a mutant gene SPT15-30 fragment, wherein the DNA sequence of the mutant gene SPT15-30 is shown in a figure 3;
(1.2) construction of plasmid YCplac22-spt15-30 for overexpression of Saccharomyces cerevisiae mutant gene spt 15-30:
the plasmid YCplac22 and the mutant spt15-30 fragment obtained in step (1.1) above were digested with restriction enzymes SalI and BamHI, respectively, as follows: DNA 5. mu.L using Sal0.25. mu.L of each of I and BamHI, 2. mu.L of 10 Xenzyme buffer, 12.5. mu.L of sterile water, digestion at 37 ℃ for 10min, and application of T4The plasmid YCplac22 and the mutant gene spt15-30 fragment are connected by ligase, and the connection operation is as follows: into a 1.5mL centrifuge tube, 10 XT was added4Ligase buffer 2. mu. L, T4Respectively adding 0.2 mu L of ligase, 0.5 mu L of plasmid YCplac22 and the mutant gene spt15-30 fragment obtained in the step (1.1), supplementing the total volume to 20 mu L with sterile water, connecting for 1h at 16 ℃ to obtain a connection product, transferring 10 mu L of the connection product into escherichia coli competent cells for culture, extracting plasmids, and constructing the plasmid YCplac22-spt15-30 of the over-expressed saccharomyces cerevisiae mutant gene spt15-30 through enzyme digestion verification;
secondly, constructing a saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol:
transforming the plasmid YCplac22-spt15-30 for over-expressing the saccharomyces cerevisiae mutant gene spt15-30 constructed in the first step into a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-Tryptophan solid culture medium, and screening a transformant with the plasmid to obtain a saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol, namely MATa leu2-3,112ura3-1trp1-92his3-11,15ade2-1can1-100YCplac22-spt 15-30;
the operation method for transforming the plasmid YCplac22-spt15-30 of the over-expression saccharomyces cerevisiae mutant gene spt15-30 into the saccharomyces cerevisiae wild strain W303-1A is as follows:
(1) inoculating the wild strain W303-1A of the Saccharomyces cerevisiae on the plate into 5mL YPD liquid culture medium, and carrying out shaking culture at 30 ℃ and 200rpm overnight;
(2) boiling 2mg/mL of carrier DNA in boiling water bath for 5 minutes, and then rapidly placing on ice;
(3) putting 1.5mL of the saccharomyces cerevisiae culture solution obtained in the step (1) into a centrifuge tube, centrifuging at 13000rpm for 30sec, collecting thalli, and removing supernatant;
(4) to the tube of (3) above, 360. mu.L of the transformation mixture was added and mixed by vortexing on a vortex separator at a high speed, and the transformation mixture was prepared as follows:
(5) carrying out water bath on the transformation system obtained in the step (4) at 42 ℃ for 20-30 minutes;
(6) centrifuging the transformation system treated in the step (5) for 30s at the rotating speed of 13000rpm by using a centrifugal machine, collecting thalli, and discarding supernatant;
(7) and (3) resuspending the thallus obtained in the step (6) by using 100 mu L of sterile water, coating the thallus on a proper screening plate, and culturing for 2-3 days at the temperature of 30 ℃ to complete the transformation of the plasmid YCplac22-spt15-30 into the saccharomyces cerevisiae wild strain W303-1A.
And thirdly, detecting the relative survival rate of the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol:
relative viability assay of the Saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol made in this example: before use, the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol prepared in the second step is connected to a CM-Tryptophan plate for 2 times of activation treatment, and is inoculated to a CM-Tryptophan liquid culture medium containing 2.5% of isobutanol for culture, the initial concentration of glucose is 2%, the culture temperature is 30 ℃, and the initial OD is600nmIs 1 and the initial viable cell number is calculated. Culturing for 60 hours, sampling every four hours, determining the number of living cells, and dividing the number of the living cells at a sampling point by the initial number of the living cells to obtain the relative survival rate of the sampling point;
the survival rate of the saccharomyces cerevisiae strain HBGDAL-104 (namely W303-1A YCplac22-spt 15-30) prepared in the embodiment is greatly improved compared with that of the strain HBGDAL-103 (namely W303-1A YCplac 22) obtained by CN103789341B by culturing the saccharomyces cerevisiae strain HBGDAL-104 prepared in the embodiment in a culture medium containing 2.5% isobutanol; when cultured in YPD liquid medium containing 2.5% isobutanol for 32 hours, the relative survival rate of strain HBGDAL-104, i.e., W303-1A YCplac22-spt15-30, was 9.25 times that of strain HBGDAL-103, i.e., W303-1A YCplac22, obtained from CN103789341B, which indicates that the tolerance of the Saccharomyces cerevisiae strain HBGDAL-104 prepared in this example is greatly improved compared with that of the control strain HBGDAL-103 (see FIG. 1). Meanwhile, the isobutanol yield of the saccharomyces cerevisiae strain HBGDAL-104 prepared by the embodiment is improved by 11 times compared with that of a control strain.
Example 2
Removing T4The plasmid YCplac22 and the mutant gene spt15-30 fragment are connected by ligase, and the connection operation is as follows: into a 1.5mL centrifuge tube, 10 XT was added4Ligase buffer 2. mu. L, T4Respectively adding 0.2 mu L of ligase, 0.6 mu L of plasmid YCplac22 and the mutant gene spt15-30 fragment obtained in the step (1.1), supplementing the total volume to 20 mu L with sterile water, connecting for 1.5h at 16 ℃ to obtain a connection product, transferring 10 mu L of the connection product into an escherichia coli competent cell for culture, extracting plasmids, and constructing the plasmid YCplac22-spt15-30 of the over-expressed saccharomyces cerevisiae mutant gene spt15-30 through enzyme digestion verification; before use, the prepared saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol is inoculated on a CM-Tryptophan plate for 3 times of activation treatment, cultured in a CM-Tryptophan liquid culture medium containing 2.5% isobutanol, the inoculation amount is 12%, the initial concentration of glucose is 2%, the culture temperature is 30 ℃, the pH is 5.5, the culture is carried out for 60h, samples are taken every four hours, and the number of viable cells is determined, except that the method is the same as that of the example 1.
Example 3
Removing T4The plasmid YCplac22 and the mutant gene spt15-30 fragment are connected by ligase, and the connection operation is as follows: into a 1.5mL centrifuge tube, 10 XT was added4Ligase buffer 2. mu. L, T4Respectively adding 8 muL of ligase 0.2 muL, plasmid YCplac22 and the mutant gene spt15-30 fragment obtained in the step (1.1), supplementing the total volume to 20 muL by using sterile water, connecting for 2h at 16 ℃ to obtain a connection product, transferring 10 muL of the connection product into an escherichia coli competent cell for culture, extracting the plasmid, and constructing the plasmid YCplac22-spt15-30 of the over-expressed saccharomyces cerevisiae mutant gene spt15-30 by enzyme digestion verification; before use, the prepared saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol is connected to a CM-Tryptophan plate for 3 times of activation treatment, cultured in a CM-Tryptophan liquid culture medium containing 2.5 percent of isobutanol, the inoculation amount is 15 percent, the initial concentration of glucose is 4 percent,the fermentation temperature was 30 ℃ and pH 6.0, the fermentation was carried out for 60 hours, samples were taken every four hours, and the number of viable cells was determined, otherwise the same as in example 1.
Example 4
The same procedure as in example 1 was repeated, except that the host strain was Saccharomyces cerevisiae wild type strain W303-1A, which was an industrial Saccharomyces cerevisiae strain.
The starting materials used in the above examples are well known and commercially available, and the procedures used are within the skill of those in the art.
Sequence listing
TATA-binding protein spt15-30 gene sequence
<110> Hebei university of industry
<120> a method for constructing a saccharomyces cerevisiae strain having high tolerance to isobutanol
<160> 1541
<210> 1
<211> 1541
<212> DNA
<213> Saccharomyces cerevisiae
〈400〉1
ctgtattcctgtgctaagtggtatacttgtgaaatactaagtttgtcgccaagattttcc 60
atgaatttgtacttctttcgaaatcgttcaatttctaccaatactgattcccctctgata 120
gctgagatgtcgggattccctttgctgatagatctaactcatctctttacgtattttaat 180
tgtgaagccgtaaatagttatcttccaagtttctcttacgcgagctttttgggaaaagaa 240
aaaaatttgaagatctacatataaaacatggcttcaaaggattactaatgacttttttta 300
ccttgataggtattcttgatggtaagagtaaacaagggacgtgaaaattacagtagttac 360
tgttttttttggactataagatcgggggaagataacacataagaaataaaacgactact 419
agttagactgctctgcggaagaagcaaggaagtaaagggctgcattttatttttcttttc 479
tagtccaacataaacaggtgtatcaagagaaacttttttaattatggccgatgaggaacg 539
tttaaaggagtttaaagaggcaaacaagatagtgtttgatccaaataccagacaagtatg 599
ggaaaaccagaatcgagatggtacaaaaccagcaactactttccagagtgaagaggacat 659
aaaaagagctgccccagaatctgaaaaagacacctccgccacatcaggtattgttccaac 719
actacaaaacattgtggcaactgtgactttggggtgcaggttagatctgaaaacagttgc 779
gctacatgcccgtaatgcagaatataaccccaagcgttttgctgctgtcatcatgcgcat 839
tagagagccaaaaactacagctttaatttttgcctcagggaaaatggttgttaccggtgc 899
aaaaagtgaggatgactcaaagctggccagtagaaaatatgcaagaattatccaaaaaat 959
cgggtttgctgctaaattcacagacttcaaaatacaaaatattgtcggttcgtgtgacgt 1019
taaattccctatacgtctagaagggttagcattcagtcatggtactttctcctcctatga 1079
gccagaattgtttcctggtttgatctatagaatggtgaagccgaaaattgtgttgttaat 1139
ttttgtttcaggaaagattgttcttactggtgcaaagcaaagggaagaaatttaccaagc 1199
ttttgaagctatataccctgtgctaagtgaatttagaaaaatgtgatggggaaggagtag 1259
acgaaaagaaaaaaaggttttctatttgttccattttctcaattattaatggtcctcaaa 1319
gaaataaaagaaaaggaagaagaagtaattgtaatatcaaacggttttttatagtatatt 1379
cttcttattctatatttatatatcaatgttttataataagatgtttattcatagcatatc 1439
tggtggatcgtctctattaagcgccagcgaggtgtttgcctctgcatttttcagcaaagc 1499
aagctccctttccagcttgaatctatgttcacgctcatccga 1541
Claims (2)
1. A method for constructing a saccharomyces cerevisiae strain with high tolerance to isobutanol, which is characterized by comprising the following steps: transforming saccharomyces cerevisiae cells by using molecular biology and gene recombination technology, transforming a plasmid YCplac22-spt15-30 of an over-expression saccharomyces cerevisiae mutant gene spt15-30 into a host bacterium, namely a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-Tryptophan solid culture medium, screening a transformant with the plasmid, and constructing a saccharomyces cerevisiae HBGDAL-104 with high tolerance to isobutanol, wherein the specific steps are as follows:
firstly, constructing a plasmid YCplac22-spt15-30 for over-expressing a saccharomyces cerevisiae mutant gene spt 15-30:
(1.1) Synthesis of a fragment of the mutant Gene spt 15-30:
designing a mutation site according to the sequence of the SPT15 gene on the chromosome W303-1A of the saccharomyces cerevisiae, and synthesizing a mutant gene SPT15-30 fragment;
(1.2) construction of plasmid YCplac22-spt15-30 for overexpression of Saccharomyces cerevisiae mutant gene spt 15-30:
the plasmid YCplac22 and the mutant spt15-30 fragment obtained in step (1.1) above were digested with restriction enzymes SalI and BamHI, respectively, as follows: DNA was 5. mu.L, digested with SalI and BamHI each 0.25. mu.L, 10 Xenzyme buffer 2. mu.L, sterile water 12.5. mu.L at 37 ℃ for 10min, and digested with T4The plasmid YCplac22 and the mutant gene spt15-30 fragment are connected by ligase, and the connection operation is as follows: into a 1.5mL centrifuge tube, 10 XT was added4Ligase buffer 2. mu. L, T4Respectively adding 0.2 mu L of ligase, 0.5 mu L-8 mu L of plasmid YCplac22 and the mutant gene spt15-30 fragment obtained in the step (1.1), supplementing the total volume to 20 mu L with sterile water, connecting for 1-2 h at 16 ℃ to obtain a connection product, transferring 10 mu L of the connection product into escherichia coli competent cells for culture, extracting plasmids, and constructing the plasmid YCplac22-spt15-30 of the over-expressed saccharomyces cerevisiae mutant gene spt15-30 through enzyme digestion verification;
secondly, constructing a saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol:
and (2) transforming the plasmid YCplac22-spt15-30 for over-expressing the saccharomyces cerevisiae mutant gene spt15-30 constructed in the first step into a saccharomyces cerevisiae wild strain W303-1A, culturing for 2-3 days on a CM-Tryptophan solid culture medium, and screening a transformant with the plasmid to obtain the saccharomyces cerevisiae strain HBGDAL-104 with high tolerance to isobutanol, namely MATaleu2-3,112ura3-1trp1-92his3-11,15 ade2-1can1-100YCplac22-spt 15-30.
2. A method for constructing a saccharomyces cerevisiae strain with high tolerance to isobutanol according to claim 1, wherein: the operation method for transforming the plasmid YCplac22-spt15-30 of the over-expression saccharomyces cerevisiae mutant gene spt15-30 into the saccharomyces cerevisiae wild strain W303-1A is as follows:
(1) inoculating the wild strain W303-1A of the Saccharomyces cerevisiae on the plate into 5mL YPD liquid culture medium, and carrying out shaking culture at 30 ℃ and 200rpm overnight;
(2) boiling the DNA2mg/mL of the supporter in boiling water bath for 5 minutes, and then quickly placing the supporter on ice;
(3) putting 1.5mL of the saccharomyces cerevisiae culture solution obtained in the step (1) into a centrifuge tube, centrifuging at 13000rpm for 30sec, collecting thalli, and removing supernatant;
(4) to the tube of (3) above, 360. mu.L of the transformation mixture was added and mixed by vortexing on a vortex separator at a high speed, and the transformation mixture was prepared as follows:
(5) carrying out water bath on the transformation system obtained in the step (4) at 42 ℃ for 20-30 minutes;
(6) centrifuging the transformation system treated in the step (5) for 30s at the rotating speed of 13000rpm by using a centrifugal machine, collecting thalli, and discarding supernatant;
(7) and (3) resuspending the thallus obtained in the step (6) by using 100 mu L of sterile water, coating the thallus on a proper screening plate, and culturing for 2-3 days at the temperature of 30 ℃ to complete the transformation of the plasmid YCplac22-spt15-30 into the saccharomyces cerevisiae wild strain W303-1A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910548636.2A CN110628804B (en) | 2019-06-24 | 2019-06-24 | Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910548636.2A CN110628804B (en) | 2019-06-24 | 2019-06-24 | Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110628804A true CN110628804A (en) | 2019-12-31 |
| CN110628804B CN110628804B (en) | 2021-04-13 |
Family
ID=68968864
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910548636.2A Active CN110628804B (en) | 2019-06-24 | 2019-06-24 | Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110628804B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100865A (en) * | 2020-01-07 | 2020-05-05 | 江南大学 | Method for improving butanol tolerance of saccharomyces cerevisiae |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007020198A2 (en) * | 2005-08-12 | 2007-02-22 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
| CN101270156A (en) * | 2008-04-25 | 2008-09-24 | 南京工业大学 | Mutation saccharomyces cerevisiae hansen initiation transcription factor,encoding gene and application thereof |
| CN103789341A (en) * | 2014-01-23 | 2014-05-14 | 河北工业大学 | Construction method of saccharomyces cerevisiae strain with high yield of isobutanol |
| CN105950649A (en) * | 2016-05-25 | 2016-09-21 | 西北农林科技大学 | Recombinant plasmid pY16TEF1-delatSPT15-125 capable of increasing saccharomyces cerevisiae ethanol yield and application thereof |
| CN106434700A (en) * | 2016-08-19 | 2017-02-22 | 南阳师范学院 | Saccharomyces cerevisiae spt15 fixed point saturated gene mutation method for increasing yield of ethanol |
-
2019
- 2019-06-24 CN CN201910548636.2A patent/CN110628804B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007020198A2 (en) * | 2005-08-12 | 2007-02-22 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
| CN101270156A (en) * | 2008-04-25 | 2008-09-24 | 南京工业大学 | Mutation saccharomyces cerevisiae hansen initiation transcription factor,encoding gene and application thereof |
| CN103789341A (en) * | 2014-01-23 | 2014-05-14 | 河北工业大学 | Construction method of saccharomyces cerevisiae strain with high yield of isobutanol |
| CN105950649A (en) * | 2016-05-25 | 2016-09-21 | 西北农林科技大学 | Recombinant plasmid pY16TEF1-delatSPT15-125 capable of increasing saccharomyces cerevisiae ethanol yield and application thereof |
| CN106434700A (en) * | 2016-08-19 | 2017-02-22 | 南阳师范学院 | Saccharomyces cerevisiae spt15 fixed point saturated gene mutation method for increasing yield of ethanol |
Non-Patent Citations (7)
| Title |
|---|
| HAL ALPER等: "Engineering Yeast Transcription Machinery for Improved Ethanol Tolerance and Production", 《SCIENCE》 * |
| KAIZHI JIA等: "Systematic engineering of microorganisms to improve alcohol tolerance", 《ENG. LIFE SCI.》 * |
| NCBI: "NCBI Reference Sequence: NM_001179038.3", 《NCBI GENBANK》 * |
| NCBI: "NCBI Reference Sequence: NP_011075.3", 《NCBI GENBANK》 * |
| 刘红梅等: "spt15突变基因对酿酒酵母木糖利用的影响", 《生物工程学报》 * |
| 温智慧等: "EMS诱变高异丁醇耐受性酿酒酵母的筛选", 《中国酿造》 * |
| 芦志龙等: "Spt蛋白与酿酒酵母压力抗性研究进展", 《生物工程学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100865A (en) * | 2020-01-07 | 2020-05-05 | 江南大学 | Method for improving butanol tolerance of saccharomyces cerevisiae |
| CN111100865B (en) * | 2020-01-07 | 2022-03-18 | 江南大学 | Method for improving butanol tolerance of saccharomyces cerevisiae |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110628804B (en) | 2021-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110055248A (en) | Controllable promoter | |
| CN110117601B (en) | Grifola frondosa glucan synthase, encoding gene and application thereof | |
| CN113755354B (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof | |
| CN109722401B (en) | Production of novel indigo dye corynebacterium glutamicum and construction method and application thereof | |
| CN110628804B (en) | Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol | |
| CN113564090B (en) | Construction method for recombinant bacteria producing tetrahydropyrimidine and application thereof | |
| US9273328B2 (en) | Yeast mutant of kluyveromyces and method for ethanol production using the same | |
| CN116732064A (en) | Sphingomonas ergothioneine synthetic gene or gene combination and application thereof | |
| CN116024150A (en) | Genetic engineering strain for producing acetoin and construction method and application thereof | |
| CN110862952B (en) | 5-aminolevulinic acid production strain and construction method and application thereof | |
| CN109370969B (en) | Application of recombinant Klebsiella in preparation of 1, 3-propylene glycol | |
| CN104403956B (en) | The structure of xylitol high temperature high-yielding engineering bacterial strain and application | |
| CN112342148A (en) | Construction and application of ureidoamidohydrolase display strain | |
| CN115896155A (en) | Method for constructing saccharomyces cerevisiae strain with high tolerance to ethanol | |
| CN117286170A (en) | Method for improving ethanol yield of saccharomyces cerevisiae by over-expressing amino acid permease | |
| CN104694586B (en) | A kind of construction method based on pichia stipitis synthesis bacterial strain xylose-fermenting production fumaric acid | |
| CN114634883B (en) | Recombinant engineering bacterium for producing 2' -fucosyllactose and construction method and application thereof | |
| CN116121092B (en) | Recombinant saccharomyces cerevisiae with enhanced multiple stress resistance, construction method and application thereof | |
| CN114634946B (en) | Construction of Pichia pastoris genetically engineered bacteria and application of pichia pastoris genetically engineered bacteria in improving methanol assimilation rate and fixing carbon dioxide | |
| CN116064266B (en) | Recombinant saccharomyces cerevisiae with enhanced salt stress resistance, and construction method and application thereof | |
| CN114456964B (en) | Recombinant yarrowia lipolytica for high yield of stigmasterol, construction method thereof, fermentation medium for producing stigmasterol and application | |
| CN117187206B (en) | Fucosyltransferase from intestinal microorganisms and application thereof | |
| CN109468254B (en) | Method for improving production efficiency of L-alanine and application thereof | |
| WO2024141022A1 (en) | Construction and use of engineering bacterium that produces colanic acid with high yield | |
| CN117487788A (en) | Sesquiterpene cyclase BcABA3 mutant and application thereof in fermentation production of abscisic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |