CN110724746B - Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof - Google Patents
Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof Download PDFInfo
- Publication number
- CN110724746B CN110724746B CN201911063516.XA CN201911063516A CN110724746B CN 110724746 B CN110724746 B CN 110724746B CN 201911063516 A CN201911063516 A CN 201911063516A CN 110724746 B CN110724746 B CN 110724746B
- Authority
- CN
- China
- Prior art keywords
- laodelphax striatellus
- different tissues
- reference gene
- gene
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reference gene stably expressed by different tissues of Laodelphax striatellus and a screening method thereof. Selecting different tissues such as head, midgut, epidermis and fat body of the small brown planthopper as materials, selecting 7 candidate reference genes to perform fluorescent quantitative PCR analysis, analyzing Ct value data of each candidate reference gene by using geNorm, BestKeeper, Normfinder and RefFinder respectively, and screening to obtain the fluorescent quantitative PCR reference gene alpha-TUB stably expressed in different tissues of the small brown planthopper. On the basis, the optimum reference gene alpha-TUB of different tissues of the Laodelphax striatellus under the condition of rice black-streaked dwarf virus infection is obtained by screening by adopting the screening method of the reference gene. In addition, the expression quantity of the rice black-streaked dwarf virus P10 and P5-1 genes in different tissues after the rice black-streaked dwarf virus is infected by the laodelphax striatellus is analyzed by applying the most stable reference gene alpha-TUB in the different tissues of the laodelphax striatellus.
Description
Technical Field
The invention belongs to the technical field of gene expression analysis by adopting fluorescent quantitative PCR in insects, and particularly relates to an internal reference gene for gene expression analysis by adopting fluorescent quantitative PCR in different tissues of laodelphax striatellus, a screening method and application thereof.
Background
Laodelphax striatellus (small colony planter) is an important agricultural pest, which passes through three stages of eggs, nymphs and adults in one generation, and the nymphs are 5 instars. Both nymphs and adults can feed on phloem sap through piercing-sucking mouthparts. Besides the harm of food taking by piercing and sucking, the small brown rice planthopper can also transmit various virus diseases such as rice black-streaked dwarf disease, rice stripe disease and the like. After the plant is infected with rice black-streaked dwarf virus (RBSDV), the plant shows symptoms of dwarfing, incapability of heading and the like; after the plants are infected with the rice stripe leaf virus, yellow-green alternate stripes are shown, tillering is reduced, and diseased plants die in advance. These two viral diseases have occurred in Jiangsu, Zhejiang and Anhui provinces in China, which causes huge economic losses. When the plant infected with the virus is eaten by the laodelphax striatellus, the virus enters the esophagus along with a mouth needle, then enters the midgut, infects the midgut, reaches the salivary gland through the haemolymph, and spreads the virus to a healthy plant when the plant is eaten.
The fluorescent quantitative PCR is a rapid, accurate and high-sensitivity gene expression analysis method, and is widely used for gene expression analysis of plants, animals, microorganisms and the like. In this method, it is necessary to normalize the expression level of a target gene by using the expression level of a stably expressed reference gene as a reference when analyzing gene expression. The selection of stably expressed reference genes has important significance on the reliability of the fluorescent quantitative PCR result. Fluorescent quantitative PCR methods are commonly used as an important method for analyzing gene expression in different tissues of laodelphax striatellus. However, there is currently no systematic analysis of stably expressed reference genes in different tissues of laodelphax striatellus.
In the research of interaction between viruses and laodelphax striatellus, a housekeeping gene is often selected as a fluorescence quantitative PCR (polymerase chain reaction) reference gene, for example, 18S ribosomal RNA (18S rRNA) is adopted as the reference gene for analyzing different development stages after RSV infection; analyzing the change of the expression quantity of the laodelphax striatellus and the virus in the laodelphax striatellus after the virus infection by using the elongation factor EF2 as an internal reference gene; after the dsRNA is injected in a micro-way to interfere with the gene of the laodelphax striatellus, beta-actin is selected as an internal reference gene for fluorescent quantitative PCR analysis to analyze the interference efficiency of the gene. The ideal reference gene is one that is stably expressed under experimental conditions, and has no tissue specificity, however, it is not clear whether these genes are stably expressed in different tissues under virus infection conditions.
Therefore, five analysis methods (delta Ct method, geonorm, NormFinder, Best-Keeper and RefFinder) are adopted to evaluate the stability of 7 housekeeping genes (LsACT, Ls alpha-TUB, Ls beta-TUB, LsGAPDH, LsRPL5, LsRPL8 and Ls18S rRNA) in different tissues, and stably expressed reference genes are obtained by screening and applied.
Disclosure of Invention
The invention provides an internal reference gene stably expressed by different tissues of laodelphax striatellus, and the internal reference gene is also an internal reference gene of fluorescent quantitative PCR of different tissues of the laodelphax striatellus under a virus infection condition. The invention provides an internal reference selection basis for analyzing the gene expression in different tissues of the laodelphax striatellus by adopting a fluorescent quantitative PCR method.
The invention also provides a screening method and application thereof.
The internal reference gene is alpha-1-tubulin (alpha-TUB), the NCBI gene accession number is AY550922, the nucleotide sequence is SEQ ID NO: 1 is shown. The amplification primer sequence of the fluorescent quantitative PCR reference gene is as follows: forward primer sequence: AGACAATGAGGCTATCTACGACA (SEQ ID NO: 2); reverse primer sequence: CCATCTGGTTGGCGGGTT (SEQ ID NO: 3).
The invention provides a screening method of reference genes of different tissues of Laodelphax striatellus, which comprises the following steps:
step 1: and (5) feeding the laodelphax striatellus. The laodelphax striatellus is bred on rice seedlings in an artificial climate chamber under the following breeding conditions: 25 +/-3 ℃; humidity: 55 plus or minus 5 percent; the photoperiod: 16 hours light, 8 hours dark.
Step 2: and obtaining different tissues of the Laodelphax striatellus. Approximately 200 heads of laodelphax striatellus were dissected under a dissecting scope for head, midgut, epidermis and adipose body tissue.
And 3, step 3: and (3) extracting RNA from different tissues of the laodelphax striatellus and preparing a cDNA template. The collected different tissues were placed in 1.5ml rnase-free centrifuge tubes, 500 μ L Trizol was added, after milling the tissues with a milling bar, total RNA of laodelphax striatellus head, midgut, epidermis and adipose tissue was extracted according to the RNA extraction specification of Trizol reagent, and cDNA was obtained by reverse transcription.
And 4, step 4: selecting candidate reference genes and synthesizing primers. According to the published gene sequence of the laodelphax striatellus housekeeping gene in NCBI, fluorescent quantitative PCR amplification primers are designed and synthesized, 7 candidate internal reference genes are obtained by adopting PCR amplification, and the sequences of the candidate internal reference genes of the laodelphax striatellus are determined by clone sequencing. The primer sequences, amplification lengths, gene accession numbers, nucleotide sequence numbers and other information of 7 fluorescence quantitative PCR candidate reference genes are shown in Table 1.
TABLE 1 fluorescent quantitative PCR primers and other information of 7 candidate housekeeping genes of Laodelphax striatellus
And 5: the specificity of the candidate reference gene primer is determined. The specificity of the candidate reference gene primer amplification was confirmed by agarose gel electrophoresis (FIG. 1) and fluorescent quantitative PCR melting curve (FIG. 2).
Step 6: and (3) performing fluorescent quantitative PCR analysis. The fluorescent quantitative PCR amplification procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 30s, 40 cycles. After the circulation is finished, a dissolution curve is drawn: fluorescence signals were collected at 55-95 ℃ every 0.5 ℃.
And 7: and (5) screening the most stable reference gene. And analyzing the stability of the candidate genes by adopting geNorm, Bestkeeper, Normfinder and RefFinder according to the Ct value obtained by the fluorescent quantitative PCR, and determining the candidate reference gene with the most stable expression. RefFinder software is a network-based internal reference stability analysis software (https:// omictools. com/reflenter-tool), and can comprehensively analyze results obtained by analysis of geNorm, Bestkeeper and Normfinder software. And (3) sequencing the stability of the candidate genes by adopting RefFinder software, wherein the sequence of the stability from high to low is as follows: alpha-TUB > RPL8 > beta-TUB > RPL5 > GAPDH > ACT > 18s rRNA (FIG. 3), therefore, the most stable expression of the reference gene is alpha-TUB.
Drawings
FIG. 1 is an agarose electrophoresis image of the product obtained by PCR amplification using 7 candidate reference gene-specific primers of Laodelphax striatellus. NV indicates a virus-free Laodelphax striatellus, RB-V indicates a Laodelphax striatellus infected with RBSDV, RSV-V indicates a Laodelphax striatellus infected with RSV, dsGFP indicates a Laodelphax striatellus injected with dsGFP, and dsSYNJ1 indicates a Laodelphax striatellus injected with synaptophysin 1 (SYNJ 1) gene dsRNA.
FIG. 2 is a graph showing the melting curve, melting point curve and amplification curve of 7 candidate reference genes of Laodelphax striatellus.
FIG. 3 stability of 7 candidate genes was ranked in different tissues of virus-free Laodelphax striatellus and RBSDV-infected Laodelphax striatellus using the software geNorm, Bestkeeper, Normfinder and RefFinder.
Detailed Description
The reference genes in different tissues of the laodelphax striatellus, the screening method and the application thereof are further explained by combining the attached drawings and the concrete implementation method.
The invention provides an internal reference gene for fluorescent quantitative PCR analysis of genes of different tissues of laodelphax striatellus, wherein the NCBI accession number of the internal reference gene is AY550922, and a nucleic acid sequence is shown in SEQ ID NO: 1.
the primer sequence of the fluorescent quantitative PCR reference gene is as follows:
forward primer sequence: AGACAATGAGGCTATCTACGACA are provided.
Reverse primer sequence: CCATCTGGTTGGCGGGTT are provided.
Example 1
Screening reference genes in different tissues of nontoxic and RBSDV (Bemisia californica) with toxicity comprises the following steps:
step (1): and (5) feeding the laodelphax striatellus. The laodelphax striatellus used in the experiment is bred on rice seedlings in a laboratory phytotron for a long time under the breeding conditions of temperature: 25 +/-3 ℃; humidity: 55 plus or minus 5 percent; the photoperiod: 16 hours light, 8 hours dark. The 2-3-year-old nontoxic Laodelphax striatellus is divided into two groups, one group is placed on rice seedlings infected with RBSDV, and the other group is fed on healthy seedlings to serve as a control without carrying viruses. After feeding for 7 days, transferring the laodelphax striatellus to a new healthy rice seedling and feeding for 7 days.
Step (2): dissection and collection of different tissues of Laodelphax striatellus. Approximately 200 small plant lice were collected for dissection of different tissues. Firstly, a dissecting dish is placed under a dissecting mirror, PBS buffer solution is dripped, and after the laodelphax striatellus is immersed, head, midgut, epidermis and adipose tissue are dissected by adopting dissecting forceps. At least 3 biological replicates were placed per tissue.
And (3): and (3) extracting RNA of different tissues of the laodelphax striatellus and carrying out reverse transcription to obtain cDNA. The collected different tissues were placed in 1.5ml rnase-free centrifuge tubes, 500 μ L Trizol was added, the tissues were milled with a milling rod and RNA extraction instructions for the Trizol reagent were referenced to extract RNA from the different tissues. After obtaining the RNA, the ratio of 260/280 to 260/230 of the RNA sample is determined by using NanoDrop2000, and the result shows that the 260/280 ratio is between 1.8 and 2.2, and the 260/230 ratio is between 2 and 2.5, which indicates that the purity of the extracted RNA is higher.
The reverse transcription step is as follows: using a kit (PrimeScript) TM RT Reagent Kit supplemented with a gDNA Erase) to synthesize cDNA. The reaction system is as follows: 5 × primer RT Mix 4 μ L, RNA 1 μ g, with RNase-free ddH 2 O make up to 20. mu.L. The reverse transcription procedure was: 15min at 37 ℃; 85 ℃ for 5 s.
And (4): and (3) synthesizing a primer. According to 7 Laodelphax striatellus housekeeping gene sequences published by NCBI website (https:// www.ncbi.nlm.nih.gov/genbank /), Primer Premier 5.0 is adopted to design fluorescent quantitative PCR primers of 7 candidate internal reference genes, and the primers are sent to Weichai Jie corporation for synthesis. The primer sequences, amplification lengths, gene accession numbers and other information of 7 fluorescence quantitative PCR candidate reference genes are shown in Table 1.
And (5): the specificity of the primers was analyzed by PCR. Primers of 7 candidate reference genes are adopted for PCR amplification, and the size of the product is observed whether to accord with the expected theoretical size through 1% agarose gel electrophoresis. Electrophoresis shows that the PCR amplification band is consistent, the PCR product is purified and then connected with a pMD18-T vector, and the PCR product is sent to Sipulin Biotech limited company for sequencing, and the result shows that the sequencing sequence is the target gene sequence.
And (6): and (3) performing fluorescent quantitative PCR analysis. And respectively adding 7 fluorescent quantitative PCR primers of candidate genes by taking cDNA of different tissues as templates to perform fluorescent quantitative PCR analysis. The quantitative PCR reaction system is as follows: 10ng of cDNA, 0.5. mu.L of each of the upstream and downstream primers, 10. mu.L of Power SYBR Green PCR Master Mix, made up to 20. mu.L with water. The fluorescent quantitative PCR amplification procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 30s, 40 cycles. And (3) drawing a dissolution curve after circulation is finished: fluorescence signals were collected at 55-95 ℃ every 0.5 ℃. And after the fluorescent quantitative PCR is finished, Ct values amplified by 7 candidate reference gene primers are obtained.
And (7): and (5) screening the most stable reference gene. And inputting the Ct value obtained by the fluorescent quantitative PCR into a geonorm software, analyzing the stability of the candidate gene, and determining that the candidate reference gene with the most stable expression is alpha-TUB. And inputting the Ct value obtained by the fluorescent quantitative PCR into Bestkeeper software, analyzing the stability of the candidate gene, and determining the most stable candidate internal reference gene as beta-TUB. And inputting the Ct value obtained by the fluorescent quantitative PCR into Normfinder software, analyzing the stability of the candidate gene, and taking the candidate internal reference gene with the most stable expression as alpha-TUB. And analyzing the stability of the candidate genes by adopting RefFinder software, wherein the candidate reference gene with the most stable expression is alpha-TUB, and the reference gene with the most unstable expression is RPL 8.
Example 2
Application of a reference gene alpha-TUB of Laodelphax striatellus.
The expression levels of the P10 and P5-1 genes after the laodelphax striatellus is infected with RBSDV are analyzed by fluorescent quantitative PCR by using alpha-TUB as an internal reference gene.
The specific implementation steps comprise:
step (1): dissection and collection of different tissues in infected RBSDV laodelphax striatellus. Placing 2-3-year-old nontoxic laodelphax striatellus on rice seedlings infected with RBSDV, feeding for 2 days, transferring the laodelphax striatellus to healthy rice seedlings, feeding for 7 days, respectively collecting about 200 laodelphax striatellus samples as RBSDV laodelphax striatellus infected samples, dissecting head, midgut, epidermis and adipose tissue under a dissecting lens, and taking the samples as different tissues of the laodelphax striatellus under the condition of virus infection.
Step (2): and (3) extracting RNA of different tissues of the laodelphax striatellus and carrying out reverse transcription to obtain cDNA. The collected different tissues were placed in 1.5ml rnase-free centrifuge tubes, 500 μ L Trizol was added, the tissues were milled with a milling rod and RNA extraction instructions for the Trizol reagent were referenced to extract RNA from the different tissues.
And (3): RBSDV P10 and P5-1 gene quantitative primer design. According to NCBI registered RBSDV P10 and P5-1 gene sequences, Primer Premier 5.0 is adopted to design fluorescent quantitative PCR primers of P10 and P5-1 genes, and SEQ ID NO: 16(RBSDV P10-F: ATGGGTACCAACAAGCCAGC), SEQ ID NO: 17(RBSDV P10-R: CTAGTCATCTGCACCTTCTG), SEQ ID NO: 18(RBSDV P5-1-F: GTTTACGGTGGTGCAATTTTCA) and SEQ ID NO: 19(RBSDV P5-1-R: AGGCTTTCCTTCACTAACTTCTGACT).
And (4): the specificity of the primers and whether the tissues were infected with the virus were analyzed by electrophoresis in 1% agarose gel. The cDNA of different tissues of the laodelphax striatellus with the virus is taken as a template, the RBSDV P10-F/P10-R primer is used for carrying out PCR reaction, and the specificity of the primer is analyzed by 1 percent agarose gel electrophoresis and whether the tissues are infected with the virus or not is determined.
And (5): and (3) performing fluorescent quantitative PCR analysis. Respectively taking cDNA of different tissues of the laodelphax striatellus as templates, and selecting alpha-TUB (most suitable reference gene), RPL8 (most unstable reference gene), RBSDV P5-1 and P10 gene primers for carrying out fluorescent quantitative PCR amplification. The fluorescent quantitative PCR reaction system is as follows: 10ng of cDNA, 0.5. mu.L of each of the upstream and downstream primers, 10. mu.L of Power SYBR Green PCR Master Mix, made up to 20. mu.L with water. The fluorescent quantitative PCR amplification procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 30s, 40 cycles.
And (6): taking the expression amount of viruses in the head tissues of the Laodelphax striatellus as a reference, adopting
The method is to calculate the relative expression of RBSDV P5-1 and P10 genes, and compare the expression results obtained by correction with alpha-TUB and RPL8 as reference genes. The results showed that the expression levels of P10 and P5-1 genes in the midgut were 11.82 and 24.6 times those of the head, respectively, when α -TUB was used as the reference gene, and that the expression levels of P10 and P5-1 genes in the midgut were 4.82 and 10.0 times those of the head, respectively, when RPL8 was used as the reference gene, indicating that the difference in the gene expression levels of the viruses was more significant when α -TUB, a stable reference, was used.
SEQUENCE LISTING
<110> agricultural science and academy of Jiangsu province
<120> reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof
<130>20191030
<160>19
<170>PatentIn version 3.5
<210>1
<211>1557
<212>DNA
<213> Laodelphax striatellus)
<400>1
atgcgggagt gtatctcaat ccacgtcggc caggccggag ttcagatcgg taacgcctgc 60
tgggagctgt actgtctgga gcatggcatc cagcctgacg gtcagatgcc ctccgacaaa 120
actgtgggcg gtggtgatgg cagcttcaac acattcttca gcgaaactgg cgccggcaag 180
catgtgccca gggccgtatt tgtcgacctt gagccgacag tagttgacga ggttcgcaca 240
ggcacctacc gccagctgtt tcacccggaa cagctgatca cgggcaaaga ggacgcggcc 300
aacaactacg ccagaggcca ctacaccatc ggcaaggaga tcgtcgacat tgtgctggac 360
cgcatcagga agctgagcga ccagtgcacc gggctgcagg gattccttat cttccactcg 420
ttcggaggcg gcaccggctc tggcttcact tcgctcctga tggagcgtct gtctgtcgac 480
tacggaaaga agtctaagct tgagttcgcc atctaccctg ctcctcaggt atccacagct 540
gtagtggagc cgtacaactc aatccttacc acccacacca ccctggaaca ctctgactgc 600
gcattcatgg tagacaatga ggctatctac gacatctgcc gacgtaacct ggacatcgag 660
cgaccaacct acaccaacct gaaccgtctc atcggccaga ttgtttcctc aatcacagcc 720
tcgctcagat tcgatggagc actcaatgtc gatttgactg aattccagac aaatttggtg 780
ccttacccca ggattcattt cccgttggtc acctacgcgc cagtcatttc agccgagaaa 840
gcctaccacg agcagttgtc tgtgatggag atcacgaatg cctgctttga acccgccaac 900
cagatggtca agtgcgaccc ccgtcacgga aagtacatgg cttgctgtat gctgtaccgt 960
ggcgatgttg tgccgaaaga tgtgaacgcg gccattgcta caatcaagac gaagaggacc 1020
atccagtttg tcgactggtg ccccacggga ttcaaggtcg gcatcaacta ccagcctccc 1080
actgtggttc ccggtggaga cctggccaaa gtgcagcgag ctgtgtgcat gttgtccaac 1140
accaccgcca ttgctgaggc ctgggcgcgt cttgaccaca agttcgatct catgtacgcc 1200
aagcgcgctt tcgttcattg gtacgttggc gaaggtatgg aggaaggtga attcagcgag 1260
gcgcgtgagg atttggccgc ccttgagaag gattacgaag aggttggcat ggactcagtt 1320
gaaggagaag gcgaaggcgc tgaggaatac taaacaaaac aagaatctgt actctgtttt 1380
ttactaagcc ttgaaaaaca cactgacgca gacaagtcat tcatggaatg tgtctccatc 1440
atcccactct atattttgta tgctattttt acttttttta atcatctgtt gaataatttg 1500
cgtaaagtat atcagtaaaa gaaatttgat caagtctaaa aaaaaaaaaa aaaaaaa 1557
<210>2
<211>23
<212>DNA
<213> Artificial Synthesis
<400>2
<210>3
<211>18
<212>DNA
<213> Artificial Synthesis
<400>3
<210>4
<211>24
<212>DNA
<213> Artificial Synthesis
<400>4
tgagcgtgaa atcgtaagag acat 24
<210>5
<211>20
<212>DNA
<213> Artificial Synthesis
<400>5
<210>6
<211>18
<212>DNA
<213> Artificial Synthesis
<400>6
<210>7
<211>21
<212>DNA
<213> Artificial Synthesis
<400>7
cggcttcagt gaactccatc t 21
<210>8
<211>18
<212>DNA
<213> Artificial Synthesis
<400>8
<210>9
<211>20
<212>DNA
<213> Artificial Synthesis
<400>9
<210>10
<211>20
<212>DNA
<213> Artificial Synthesis
<400>10
<210>11
<211>18
<212>DNA
<213> Artificial Synthesis
<400>11
<210>12
<211>19
<212>DNA
<213> Artificial Synthesis
<400>12
<210>13
<211>21
<212>DNA
<213> Artificial Synthesis
<400>13
ccaatctgta gagtggcttt c 21
<210>14
<211>18
<212>DNA
<213> Artificial Synthesis
<400>14
<210>15
<211>22
<212>DNA
<213> Artificial Synthesis
<400>15
gtccgaagac ctcactaaat ca 22
<210>16
<211>19
<212>DNA
<213> Artificial Synthesis
<400>16
<210>17
<211>17
<212>DNA
<213> Artificial Synthesis
<400>17
<210>18
<211>22
<212>DNA
<213> Artificial Synthesis
<400>18
gtttacggtg gtgcaatttt ca 22
<210>19
<211>26
<212>DNA
<213> Artificial Synthesis
<400>19
aggctttcct tcactaactt ctgact 26
Claims (1)
1. The application of the alpha-TUB gene as an internal reference gene in analyzing gene expression of different tissues of the Laodelphax striatellus by a fluorescent quantitative PCR method is characterized in that the nucleotide sequence of the alpha-TUB gene is SEQ ID NO. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911063516.XA CN110724746B (en) | 2019-11-01 | 2019-11-01 | Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911063516.XA CN110724746B (en) | 2019-11-01 | 2019-11-01 | Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110724746A CN110724746A (en) | 2020-01-24 |
| CN110724746B true CN110724746B (en) | 2022-08-30 |
Family
ID=69223700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911063516.XA Active CN110724746B (en) | 2019-11-01 | 2019-11-01 | Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110724746B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178564A (en) * | 2014-06-11 | 2014-12-03 | 广西壮族自治区农业科学院植物保护研究所 | Screening method and applications of brown planthopper reference genes under high temperature stress |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220340B (en) * | 2011-05-12 | 2013-02-20 | 南京农业大学 | Laodelphax striatellus lethal gene fragment |
| CN102220344B (en) * | 2011-05-12 | 2013-07-17 | 南京农业大学 | Gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and dsRNA thereof |
| CN103276076B (en) * | 2013-05-23 | 2015-03-11 | 中国农业科学院植物保护研究所 | Endogenous reference gene BM-alpha-TUB stably expressed in different development stages of bactrocera minax and application thereof |
| EP3087391B1 (en) * | 2013-12-23 | 2021-05-19 | Basf Se | Methods for determining modulators of insect transient receptor potential v (trpv) channel |
| CN104830997A (en) * | 2015-05-20 | 2015-08-12 | 安徽袁粮水稻产业有限公司 | Molecular identification method of rice black-streaked dwarf virus resistance |
| CN104975085A (en) * | 2015-06-09 | 2015-10-14 | 江苏省农业科学院 | UBQ10 and GAPDH as double reference genes for rice stripe virus (RSV)-infected plant gene function analysis and use thereof |
| CN104946756A (en) * | 2015-06-09 | 2015-09-30 | 江苏省农业科学院 | Double reference genes (UBC and Actinl) for gene function analysis on RBSDV (rice black-streaked dwarf virus) infected plant and application of double reference genes (UBC and Actinl) |
| KR101976808B1 (en) * | 2017-10-27 | 2019-05-09 | 대한민국(농촌진흥청장) | Primer set for loop-mediated isothermal amplification to detect Laodelphax striatellus and detection method for L. striatellus by using the same |
-
2019
- 2019-11-01 CN CN201911063516.XA patent/CN110724746B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178564A (en) * | 2014-06-11 | 2014-12-03 | 广西壮族自治区农业科学院植物保护研究所 | Screening method and applications of brown planthopper reference genes under high temperature stress |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110724746A (en) | 2020-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2010674A1 (en) | A sex-specific marker for shrimps and prawns | |
| KR102029016B1 (en) | SSR primer set for discriminating Agaricus bisporus strain and uses thereof | |
| CN113502333B (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| KR101912196B1 (en) | Molecular marker and primer set for discriminating Paeonia suffruticosa and Paeonia lactiflora and uses thereof | |
| KR101804120B1 (en) | Complete sequencing of chloroplast genome and nrDNA of Aloe vera, Aloe saponaria and Aloe Saengjang-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof | |
| CN113151292B (en) | Soybean cyst nematode Hg-flp-22 gene and application of dsRNA thereof in nematode control | |
| KR20130078111A (en) | Scar markers for discrimination of grape cultivars and use thereof | |
| CN110724746B (en) | Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof | |
| KR102332689B1 (en) | Molecular marker based on mitochondrial genome sequence for discriminating Panax ginseng 'GeumJin' and 'SeonHyang' cultivar and uses thereof | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| KR101783347B1 (en) | CAPS marker for discriminating presence or absence of pollen in pear and uses thereof | |
| CN110144410B (en) | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application | |
| CN116144697A (en) | GhKV3WRKY29 gene and application of protein thereof in improving verticillium dahliae verticillium resistance of plants | |
| CN115044693A (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) internal reference gene of black-drug parabagin and application thereof | |
| KR101391490B1 (en) | Specific primers for detection of ginseng pathogenic fungi and uses thereof | |
| CN106967830B (en) | Application of ZFP gene as internal reference gene in quantitative detection of gene expression level of trichogramma borer | |
| KR101687008B1 (en) | Primer set for detecting Peach yellow mottle closterovirus and uses thereof | |
| KR102629167B1 (en) | Primer sets for diagnosing five fungi infecting Capsicum annuum and diagnostic methods using thereof | |
| CN108220452A (en) | Anomala corpulenta reference gene and application | |
| KR20150050062A (en) | Specific primers for detection of greenhouse whitefly and uses thereof | |
| KR102215717B1 (en) | SSR markers for discriminating of foremost mugwort and use thereof | |
| KR102507555B1 (en) | Molecular marker for discriminating presence or absence of russet formation in pear and uses thereof | |
| KR102286875B1 (en) | Molecular marker for discriminating branchless watermelon cultivar and uses thereof | |
| KR101427103B1 (en) | Specific SSR primers for discriminating waxy corn cultivar 'Arichal', and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |