CN110144410B - Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application - Google Patents
Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application Download PDFInfo
- Publication number
- CN110144410B CN110144410B CN201910454516.6A CN201910454516A CN110144410B CN 110144410 B CN110144410 B CN 110144410B CN 201910454516 A CN201910454516 A CN 201910454516A CN 110144410 B CN110144410 B CN 110144410B
- Authority
- CN
- China
- Prior art keywords
- pink bollworm
- parasitism
- identifying
- dna
- eggs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a molecular detection method for identifying parasitism of a scale cocoon bee to a pink bollworm and application, the method comprises the steps of carrying out PCR amplification on DNA of a pink bollworm egg by utilizing a specific primer, and judging whether the pink bollworm egg is parasitized by the scale cocoon bee or not by detecting whether an expected amplification product is obtained or not, wherein the specific primer comprises PG-PL10-F2 (shown as SEQ ID NO: 1), PG-PL10-R2-1 (shown as SEQ ID NO: 2) and PG-PL10-R2-2 (shown as SEQ ID NO: 3). The invention can quickly and accurately detect whether the batocera formosana parasitizes from the red bell worm eggs in the field.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a specific primer, a molecular detection method for identifying parasitism of a scale braconid wasp on pink bollworms and application of the specific primer.
Background
The red bollworm beetle cocoon bee (Cushman) is a parasitic bee across egg-larval stage, and its host includes numerous lepidoptera pests such as the red bollworm Pectinophora gassipillaria (Saunders), dingdian Diamond-A (Walker), sugarcane Small cabbage moth Argyropomorpha schistacana (Snellen), cotton big leaf roller Sylepta derogata (Fabricius), soybean pod borer Leguminura voriconella (Matsumura), etc., besides the red bollworm Pectinophora gassipelliella (Saundersers), and is a very potential natural enemy insect. The parasitic wasp is distributed in Hubei, anhui, henan, sichuan, jiangsu, zhejiang, jiangxi and Taiwan in China.
In the artificial propagation of parasitic wasps, the parasitic rate and the hatching rate are very important indexes and are often used for evaluating the commodity value of the parasitic wasps. Usually, the bite quantity, the cocooning quantity or the bee output quantity of the offspring of the parasitic wasp is used as the judgment basis of the egg laying capacity. However, like most egg parasitic wasps, after the red bollworm batocera formosanus oviposits the intermediate host red bollworm, the hatched larva still needs to continue to take food in the intermediate host red bollworm body, and is only nibbled from the red bollworm host body after the larva grows to a certain stage, so as to further transform the cocoon. In the series of growth and development processes, the growth process of the offspring of the apocynum coccineum is greatly influenced by the conditions of the temperature, the humidity, the illumination, the food and the like of the environment where the intermediate host is located. Therefore, the meshing rate, the cocoon melting rate and the bee emergence rate of parasitic wasps are selected as the judgment basis of the parasitic capacity of the egg parasitic wasps, namely the red bollworm and the abdominal cocoon bee, and the real damage control capacity of the egg parasitic wasps cannot be truly reflected to a certain extent. In order to evaluate the damage control potential of the red bell worm batocera formosanus to the red bell worm, a molecular detection technology which is simple and convenient to operate, scientific and effective is selected for identifying the parasitic capacity of the egg parasitic wasp to the host, and the technology is necessary and practical.
Disclosure of Invention
In view of the defects of the prior art, the invention aims to provide a specific primer, a molecular detection method for rapidly identifying the parasitism of the scale flies to the pink bollworms and application of the specific primer.
In order to realize the purpose of the invention, the inventor firstly proposes that specific primers PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2 are designed for the DEAD-box family PL10 gene of the Anemone formosanus, and amplification detection is carried out on DNA samples of differently treated eggs of the pink bollworm, and the inventor finds that the target strip of the PL10 gene can be amplified only in the DNA samples of the pink bollworm parasitically treated by the Anemone formosanus. Specifically, the technical scheme of the invention is summarized as follows:
two pairs of specific primers, wherein the specific primers comprise PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-, the sequence of PG-PL10-F2 is shown as SEQ ID NO. 1, the sequence of PG-PL10-R2-1 is shown as SEQ ID NO. 2, and the sequence of PG-PL10-R2-3 is shown as SEQ ID NO. 3.
According to the research result of the invention, the PL10 gene is amplified by using the specific primer, so that the species identification of the red bollworm and the batrachia formosana can be realized, and the method is further used for judging the parasitism of the red bollworm eggs by the batrachia formosana in the field. In the aspect of counting the parasitic rate of the egg parasitic wasps, the situation that the counted wasp situation is inconsistent with the parasitic rate due to the fact that offspring of the egg parasitic wasps are influenced by the self condition of hosts, food and the like is avoided. Therefore, the invention further provides an application of the specific primer in detecting whether the red bell worms are parasitized by the helianthus corteus or/and the egg laying amount of the helianthus corteus.
In addition, the invention also provides a molecular detection method for identifying the parasitism of the apocynum venetum to the pink bollworm, which comprises the steps of carrying out PCR amplification on DNA of the red bollworm eggs by using the specific primers, and judging whether the red bollworm eggs are parasitized by the apocynum venetum by detecting whether amplification products are obtained or not.
Further preferably, the molecular detection method for identifying parasitism of the empoasca vitis on the pink bollworm as described above specifically comprises the following steps:
(1) Extracting all DNA in the eggs of the pink bollworm;
(2) Carrying out PCR amplification reaction by using the DNA obtained in the step (1) as a template and the specific primer;
(3) Taking a PCR reaction amplification product, and detecting through agarose gel electrophoresis;
(4) And judging whether the pink bollworm eggs are parasitized by the gloeosporioides operculella according to whether the characteristic strip of the gloeosporioides PL10 gene segment appears in the electrophoresis strip.
In a most preferred embodiment of the present invention, the molecular detection method for identifying the parasitism of the aequorea virens to the pink bollworm as described above is characterized in that the reaction conditions of the PCR reaction are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s; annealing at 60 deg.C for 30s; stretching at 72 ℃ for 30s; cycle 35, 72 ℃ extension 10min.
In a most preferred embodiment of the present invention, the molecular detection method for identifying the parasitism of the aequorea virens to the pink bollworm as described above is characterized in that the reaction system of the PCR reaction is as follows: 10 XEx taq buffer 2.5. Mu.L, 2.5mM dNTPs 2. Mu.L, ex taq enzyme 0.125. Mu.L, forward and reverse primers each 1. Mu.L, DNA 1.5. Mu.L or cDNA 1.5. Mu.L, and ddH supplement 2 O to 25. Mu.L.
The specific primer can be used for distinguishing the parasitism of the red bell worm eggs by the anthurium andraeanum in the field, so the invention also provides a kit for identifying the parasitism of the anthurium andraeanum to the red bell worm, and the kit contains the specific primer. Further preferably, the kit for identifying parasitism of the helianthus coruscus on the pink bollworm as described above further comprises dNTPs, taq DNA polymerase and PCR reaction buffer.
Compared with the prior art, the invention has the following advantages and remarkable progress:
(1) According to the invention, based on the sequence difference of PL10 fragments of the Abelmoschus manihot and the pink bollworm, a specific primer capable of quickly and accurately detecting the parasitism of the Abelmoschus manihot is designed, and a PCR detection system is established on the basis, so that whether the Abelmoschus manihot is parasitized or not can be quickly and accurately detected from the red bollworm eggs in the field.
(2) The invention firstly provides a method for identifying the species of red bell beetles and abdominal braconids by using the DNA bar codes of the PL10 gene of the abdominal braconids, and further the method is used for judging the parasitism of the red bell beetles and abdominal braconids on the eggs in the field.
(3) In the aspect of counting the parasitic rate of the egg parasitic wasps, the invention avoids the situation that the counted wasp situation is inconsistent with the parasitic rate due to the influence of host self conditions, food and other conditions on the offspring of the egg parasitic wasps, and is beneficial to realizing the fast and accurate counting of the parasitic rate of the parasitic wasp parasitic field red bell eggs. The detection method has the advantages of convenience, rapidness, economy, accuracy and the like.
Drawings
FIG. 1: combining the amplification conditions of primers Pg-V-F and Pg-V-R1 on the alpha-fetida cocoon bee template; wherein M: marker (DL 2000), 1-3: beetle cocoon bee DNA,4-6: corteula beetle cDNA,7-8: blank control.
FIG. 2 is a schematic diagram: merging primers Pg-V-F and Pg-V-R2 to amplify the methocoria formosa template; wherein M: marker (DL 2000), 1-3: beetle cocoon bee DNA,4-6: apocynum praecox cDNA,7-8: blank control.
FIG. 3: doubling the primer to the amplification condition of the pink bollworm template; wherein M: marker (DL 2000), 1-7 refers to the amplification condition of the degenerate primers Pg-V-F and Pg-V-R1 (1-3: pink bollworm DNA,4-6: pink bollworm cDNA,7: blank control), 8-14 refers to the amplification condition of the degenerate primers Pg-V-F and Pg-V-R2 (1-3: pink bollworm DNA,4-6: pink bollworm cDNA,7: blank control);
FIG. 4: screening conditions of specific primers for amplifying PL10 gene of the cocoon bee; wherein M: marker (DL 2000), 1-6: PG-PL10-F1 and PG-PL10-R1-1 (1-3 is a bombesi batryticatus, 4-6 is a pink bollworm, three holes are products at 52 ℃, 55 ℃ and 58 ℃ in sequence, the same is given below); 7- -12: PG-PL10-F1 and PG-PL10-R1-2 (7-9 is a scale cocoon bee, 10-12 is a pink bollworm); 13- -18: PG-PL10-F2 and PG-PL10-R2-1 (13-15 is a batocera formosana, 16-18 is a pink bollworm) 19-24: PG-PL10-F2 and PG-PL10-R2-2 (19-21 is a scale cocoon bee, 22-24 is a pink bollworm).
FIG. 5: detecting red bell worm eggs (the condition of amplification of an Action gene of the red bell worm eggs) subjected to parasitic treatment of the batocera formosanus; wherein M: marker (DL 2000), 1-4: single-head red bollworm egg parasitized by the beetle cocoon bee, 5-8: single-head red bell egg not parasitized by batocera formosanus, 9: blank control.
FIG. 6: specific primers PG-PL10-F2 and PG-PL10-R2-1 are used for amplifying the PL10 gene of the pink bollworm egg; wherein M: marker (DL 2000), 1-4: single-head red bell worm eggs parasitized by the beetle cocoon bees, 5-8: single-head red bell egg not parasitized by batocera formosanus, 9: blank control.
FIG. 7: specific primers PG-PL10-F2 and PG-PL10-R2-2 are used for amplifying the PL10 gene of the pink bollworm egg; wherein M: marker (DL 2000), 1-4: single-head red bollworm egg parasitized by the beetle cocoon bee, 5-8: single-head red bell egg not parasitized by batocera formosanus, 9: blank control.
Detailed Description
Advantages and features of the present invention will become more apparent to those skilled in the art from the following description taken in conjunction with the accompanying drawings and specific examples. It should be understood that the illustrated embodiments are exemplary only, and are not intended to limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit of the invention, and it is intended to cover all such changes and modifications as fall within the scope of the invention.
The first embodiment is as follows: molecule detection test of parasitism of Abelmoschus manihot to pink bollworm
1. Test materials
The pink bollworm Pectinophora gossypiella (Saunders) was collected from cotton fields in the city of the Yangtze river of Hubei province in 9 months of 2003 and was artificially subcultured in a laboratory until now.
In 2013, diapause red bollworm larvae are collected from 3 cotton areas of Tianmen, anxiang and Anhui Anqing in Hubei, hunan and Anxiang, the parasitic wasps are found, and the population is established in a laboratory. The adult is supplemented with 5% honey water, and the spawning conditions are temperature (28 +/-1) DEG C, relative humidity 60% -80%, photoperiod 13L.
2. Test method
2.1 amplification of the DEAD-box gene of Heliothis armigera and Abelmoschus manihot by using degenerate primers
2.1.1 extraction of DNA and RNA from Abies beetle and pink bollworm
DNA extraction was performed according to the instructions of blood/tissue/cell genome extraction kit (tiangen biochemical technology (beijing) ltd., DP 304).
Total RNA was extracted by TRIzol method using an extraction kit from Invitrogen. Reverse Transcription was performed with reference to the protocol of the Reverse Transcription System kit from Promega.
2.1.2 amplification of target fragment of Abelmoschus manihot
According to the reported DEAD-box family gene cDNA sequences of drosophila and other species, 2 pairs of degenerate primers are designed by selecting sites with high conservation, wherein the degenerate primers are Pg-V-F and Pg-V-R1, and the primer sequences are shown in Table 1.
Reaction system: 10 Xtaq buffer 2.5. Mu.L, dNTPmix (2.5 mmol. L-1 each) 2. Mu.L, taq enzyme 0.125. Mu.L, forward and reverse primers 1. Mu.L each, DNA 2. Mu.L or cDNA 1. Mu.L, supplemented with ddH 2 O to 25. Mu.L. The reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 45s, circulating for 35, extension at 72 ℃ for 10min, and storing at 4 ℃. The amplification products were detected by electrophoresis on a 1.5% agarose gel.
Table 1: DEAD-box family gene merging primer
The amplification results show that:
primers Pg-V-F and Pg-V-R1 are used for amplifying the DNA and cDNA of the Abelmoschus manihot, and gel electrophoresis detection shows that the cDNA (4, 5 and 6) of the Abelmoschus manihot DNA (1, 2 and 3) can amplify expected target bands, and the sizes of the fragments are basically consistent (about 400 bp) (figure 1).
Similarly, the DNA and cDNA of the Apocynum venetum are amplified by using the primers Pg-V-F and Pg-V-R2, and the products are detected by gel electrophoresis, so that the expected target bands can be amplified by the DNA (1, 2 and 3) cDNA (4, 5 and 6) of the Apocynum venetum, and the sizes of the fragments are basically consistent (about 400 bp) (figure 2).
And recovering the target band by using a GelExtraction Kit gel recovery Kit, connecting a purified product with a T-easy cloning vector, transferring the purified product into Dh5 alpha competent cells, and coating the cells on an LB solid culture medium containing Amp + resistance for overnight culture. White single colonies were picked and placed in the LB liquid medium containing Amp + resistance and cultured at 37 ℃ at 200r/min for 12h. And then carrying out PCR verification on the bacterial liquid, and sending a sample containing the target band to the company Limited in the biological engineering (Shanghai) for sequencing.
Sequence homology similarity was searched using the BLASTx program of the National Center for Biotechnology Information (NCBI) based on sequencing results as follows:
sequencing result 1: (not registered)
The comparison analysis shows that the fragment size is 398bp and the ATP-dependent RNA helicase PLl0 gene is obtained.
ATGGCATGCGCGCAAACAGGCTCAGGTAAAACAGCGGCATTTTTGGTGCCAATATTAAATCAGATTTATGAAAGCGGTCCACGTGCACCTCCACCACAAGCTGGTAGTGGAAGACGCAAACAATACCCTTTGGGCTTAGTTTTAGCTCCAACACGAGAATTAGCAACACAAATCTACGATGAAGCACGTAAATTTGCTTATCGATCTCGTATGCGACCTGCAGTTGTCTATGGTGGATCAAATATTGCCGATCAAATGCGTGAACTTGATCGTGGATGTCATTTATTGGTTGCTACACCTGGTCGACTTGTGGATATGCTTGGCCGTGGTAAAATAGGACTACACAATTGTCGATTTTTAGTTCTAGATGAGGCTGATCGGATGTTGGATATGGGTTT
Sequencing result 2: (not registered)
The comparison analysis shows that the gene is vasa, and the fragment size is 383bp.
AAGCCCATGTCCAGCATACTGTCCGCCTCGTCCAGCACGAAGAAGCGAATGGACGAGAACGTGACGCGACCTCGATTTACGAAATCGTTAAGCCGGCCAGGAGTGGCGACCAGAATATGGCAGCCTTTCATTAGCGTATTCGCCTGATGGAATGACGCCGTGCCTCCGTAAGCGATGCAGATCTTCAGTATGCTCCCATGAGCAAACTTCCGGGCCTCGTTGAAGATCTGAATAGCTAATTCTCGAGTAGGGCTGAGGATTATAACTTGCGGTTCAACACCGGATTCGTGTATGATGGCATCTTGAGGTTTGTCAAGAATTGTGTTGATCATAGGCACCAAAAAAGCAGCAGTTTTTCCTGATCCTGTTTGTGCGCAGGCCAT
Sequence comparison is carried out on the sequencing result, and the sequencing result of most of the DNA or cDNA of the Apocynum venetum is the sequencing result 1. This indicates that the distribution and expression level of PL10 gene (sequencing result 1) in the tissue are stable compared to the vasa gene (sequencing result 2). Thus, PL10 was initially selected as the target gene for the next experiment.
2.1.3 amplification of Gene fragments of Heliothis armigera
The doubling primers Pg-V-F and Pg-V-R1, pg-V-R2 are used for respectively carrying out PCR amplification on the DNA and cDNA templates of the pink bollworm under the same amplification condition of 2.1.2, and the result of the detection of the product by gel electrophoresis is shown in figure 3.
As can be seen from FIG. 3, the degenerate primers Pg-V-F and Pg-V-R1 can amplify the expected target bands on the DNA (1, 2, 3) and cDNA (4, 5, 6) templates of the pink bollworm, and the fragment size is about 400bp. Similarly, the Pg-V-F and Pg-V-R2 can be used for amplifying expected target bands of DNA (7, 8, 9) and cDNA (10, 11, 12) templates of the pink bollworm, and the fragment size of the expected target bands is about 400bp. And (3) recovering the corresponding target bands by using glue, and selecting target clones to send to a sequencing company for sequencing after connection and transformation. The sequencing result is as follows:
sequencing result 3: (not registered)
The alignment analysis shows ATP-dependent RNA helicase DDX53/DDX43, fragment size 371bp.
ATGGCATGCGCACAAACAGGCACTGGTAAGACATTAGCTTTTCTTCTTCCTGCATTGATTCACATTGAAGGGCAGACTGTCCCTCGAGATCAAAGAAAAGGTCCCACAGTGCTCATCTTGGCTCCAACAAGAGAACTGGCTTTGCAGATTGATAAAGAAGTATCCAAATACAGTTACAGAGGAATCACTTCTGTTTGCTTGTATGGAGGAGGAGACAGGAAGGAGCAGATTAAAGTTGTTTCCAAAGGTGTGGACATAGTCATTGCAACACCAGGAAGACTCAATGATTTAATTATGGCACGGCATCTTAACATAATCAACTTTTCCTACATTGTTCTTGATGAAGCAGATCGGATGTTGGACATGGGTTT
Sequencing result 4: (not registered)
The comparison analysis shows that the fragment size of the ATP-dependent RNA helicase PLl0 gene is 392bp.
ATGGCATGCGCGCAAACAGGCTCCGGGAAGACTGCCGCGTTCCTCGTCCCCATACTCAACCAGATGTACGAGGCTGGACCCGTTAAGCATATGGGGCCGTACAACCGACGCAAGCAGTACCCTCTGGGCTTGGTTCTAGCTCCGACACGCGAACTCGCCACCCAAATTTATGACGAGGCTAGGAAATTCGCCTACCGCTCCCGTGTGCGACCCTGTGTCGTGTACGGCGGCTCCCCGATACATGAACAATTCCGCGAACTGGAGTGCGGGTGCCACCTGCTGGTCGCGACGCCGGGCCGGCTCGTGGACATGCTGTCCCGCGGGCGCGTGGCGCTCGACCACTGCCGCCATCTTGTGCTCGACGAGGCCGATCGGATGCTAGACATGGGCTT
2.2 Abelmoschus manihot PL10 Gene specific primer screening
DNAMAN Version6 is utilized to carry out homologous comparison analysis on the nucleotide sequences of the APUS B.C.B.C.and the PL10 gene fragment, and a Primer 5.0 is utilized to design the specific Primer of the APUS B.C.B.C.B.C.PL 10 according to the sequence difference. Four groups of specific primers PG-PL10-F1, PG-PL10-R1-2, PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2 were designed respectively (Table 2). The designed primers are used for amplifying DNA samples of the batocera formosana and the pink bollworm respectively.
Table 2: specific primer for amplification of PL10 gene of Abelmoschus manihot
Reaction system: 2x Es Taq MasterMix (Dye) 10. Mu.L, each of the forward and reverse primers 1. Mu.L, DNA 1. Mu.L, ddH 2 O7. Mu.L. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s; annealing at 52 deg.C, 55 deg.C, and 58 deg.C for 30s; extension for 30s at 72 ℃; cycle 35, 72 ℃ extension 10min.
The detection result of gel electrophoresis of the amplification product shows that:
an electrophoretogram of PL10 gene amplified by PG-PL10-F1, PG-PL10-R1-1 and PG-PL10-R1-2 primers, and PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2 primers for Abelmoschus manihot and pink bollworm DNA respectively is shown in FIG. 4. As can be seen from FIG. 4, the PG-PL10-F1, PG-PL10-R1-1 and PG-PL10-R1-2 primers can amplify a single PL10 gene fragment of a Begonia aethiopica sample ( lanes 1, 2, 3 and 7, 8 and 9, three wells of which are sequentially amplified products at 52 ℃ and 55 ℃ and 58 ℃ and the same below) with the fragment size of 200bp, but the Begonia rubra sample ( lanes 4, 5 and 6 and lanes 10, 11 and 12) can also amplify a target band with the corresponding size and has a non-specific amplified band, so that the primers have poor specificity and cannot distinguish the Begonia aethiopica formosana DNA sample. Similarly, the amplification products of the samples of Anemostemma longissima ( lanes 13, 14, 15 and lanes 19, 20, 21) with primers PG-PL10-F2 and PG-PL10-R2-1, PG-PL10-R2-2 were single bands, while the samples of Helicoverpa armigera ( lanes 16, 17, 18 and lanes 22, 23, 24) failed to amplify a band of interest of corresponding size, with only one non-specific band, whose fragment size is significantly different from the size of the expected fragment of interest. The two pairs of primers are proved to have better specificity when amplifying the Abelmoschus manihot PL10 gene, and can be selected as the Abelmoschus manihot DNA bar code detection.
2.3 detection of Heliothis armigera eggs parasitically treated
2.3.1 extraction of Toosendan ovum DNA
Eggs of pink bollworms: according to the operation of an Animal Direct PCR Kit (American biogen Biotech) instruction, single eggs of the pink bollworm which are parasitized and not parasitized by the Animalia formosana are picked, the eggs are crushed by a sterile white gun head, 27ul of lysis solution A is sucked to dissolve tissue substances of the pink bollworm eggs, the eggs are sucked and placed in a 0.2ml PCR tube to be treated for 15min at 95 ℃, 3ul of solution B is added, and the mixture is uniformly mixed by a vortex machine and kept at-20 ℃ for later use.
2.3.2 PL10 Gene detection on Heliothis armigera eggs
The pink bollworm Action is taken as a housekeeping gene, and ACS1 and ACR1 primers are designed according to the nucleic acid sequence of the pink bollworm Action. The primer conditions are shown in Table 3.
Table 3: related primer for detecting PL10 gene of Abelmoschus manihot
2.3.3 detection of Heliothis virescens eggs parasitized on Abelmoschus manihot
4 eggs of red bell worms parasitized by the red bell worm beetles and 4 eggs of red bell worms not parasitized are taken randomly and DNA extraction is carried out according to the method of 2.3.1. The Action gene and PL10 gene amplification are carried out on the eggs of the pink bollworm respectively, and the gel electrophoresis images of the amplification products are shown in figure 5, figure 6 and figure 7. The detection result of fig. 5 shows that the parasitic and non-parasitic pink bollworm egg DNA extraction effect is good, and the pink bollworm Action internal standard gene can be amplified. As can be seen from FIG. 6, specific primers PG-PL10-F2 and PG-PL10-R2-1 can well distinguish whether the pink bollworm egg is parasitized by the gloeosporioides formosanus, wherein, the expected PL10 gene fragment can be amplified by the sample of the pink bollworm egg parasitized by the gloeosporioides formosanus (1, 2, 3, 4), while the expected fragment can not be amplified by the sample of the red bollworm egg which is not parasitized (5, 6, 7, 8). Similarly, as can be seen from fig. 7, specific primers PG-PL10-F2 and PG-PL10-R2-2 can distinguish well whether a pink bollworm egg is parasitized by the scale flies, wherein the expected PL10 gene fragment can be amplified from samples of pink bollworm eggs (1, 2, 3, 4) parasitized by the scale flies, and the expected fragment cannot be amplified from parasitized pink bollworm eggs (5, 6, 7, 8). The expected target fragment of the PL10 gene amplified by the specific primers PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2 is recovered, and is sent to a sequencing company for sequence analysis after being connected and transformed. Sequencing results show that the sizes of the gene fragments are 142bp and 234bp, the sequences are searched for sequence homology similarity by a BLASTx program of the National Center for Biotechnology Information (NCBI), and the results are all shown as PL10 genes.
In conclusion, the two pairs of specific primers PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2 are designed for the DEAD-box family PL10 gene of the Apocynum venetum, and amplification detection is respectively carried out on the DNA samples of the red bollworm eggs treated by different treatments, so that the expected target fragment of the PL10 gene can be amplified only by the DNA sample of the red bollworm eggs treated by parasitism of the Apocynum venetum. From the research results, the DNA bar code of the PL10 gene can be used for identifying the species of the red bell beetle and the cocoon bee, and further used for judging the parasitism of the red bell beetle eggs by the cocoon bee. In the aspect of counting the parasitic rate of the egg parasitic wasps, the situation that the counted wasp situation is inconsistent with the parasitic rate due to the fact that offspring of the egg parasitic wasps are influenced by the self condition of the intermediate host, food and other environmental conditions is avoided. The detection method has the advantages of convenience, rapidness, economy, preparation and the like, and has certain feasibility.
Sequence listing
<110> institute of soil and fertilizer for plant protection of academy of agricultural sciences of Hubei province
<120> molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctggtagtg gaagacgcaa ac 22
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttgatccacc atagacaact gc 22
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Claims (8)
1. A specific primer is characterized by comprising PG-PL10-F2, PG-PL10-R2-1 and PG-PL10-R2-2, wherein the sequence of PG-PL10-F2 is shown as SEQ ID NO. 1, the sequence of PG-PL10-R2-1 is shown as SEQ ID NO. 2, and the sequence of PL10-R2-2 is shown as SEQ ID NO. 3.
2. Use of the specific primer according to claim 1 for detecting whether an egg of Heliothis virescens is parasitized by Anoectochilus formosanus.
3. A molecular detection method for identifying the parasitism of Anemoncius formosanus to pink bollworm is characterized in that the method comprises the steps of carrying out PCR amplification on DNA of the eggs of the pink bollworm by using the specific primers in claim 1, and judging whether the eggs of the pink bollworm are parasitized by the Anemoncius formosanus by detecting whether amplification products are obtained or not.
4. The molecular detection method for identifying parasitism of Anemolococcus mexicana to pink bollworm according to claim 3, characterized in that the method specifically comprises the following steps:
(1) Extracting all DNA in the eggs of the pink bollworm;
(2) Carrying out PCR amplification reaction by using the DNA obtained in the step (1) as a template and using the specific primer of claim 1;
(3) Taking a PCR reaction amplification product, and detecting through agarose gel electrophoresis;
(4) And judging whether the pink bollworm eggs are parasitized by the Apocynum venetum based on whether characteristic bands of the Apocynum venetum PL10 gene segments appear in the electrophoresis bands.
5. The molecular detection method for identifying parasitism of Anoectochilus formosanus on pink bollworm according to claim 3 or 4, characterized in that the reaction conditions of the PCR reaction are as follows: 95. pre-denaturation at deg.C for 5min; 95. the temperature is controlled, and the denaturation is carried out for 30s; annealing at 60 deg.C for 30s; 72. at the temperature of 30s, extending; the cycle was 35 and the extension was 10min at 72 ℃.
6. The molecular detection method for identifying the parasitism of Anemorrhena aethiopica to Heliothis virens as claimed in claim 3 or 4, wherein the reaction system of the PCR reaction comprises: 10 XEx taq buffer 2.5. Mu.L, 2.5mM dNTPs 2. Mu.L, ex taq enzyme 0.125. Mu.L, forward and reverse primers 1. Mu.L each, DNA 1.5. Mu.L or cDNA 1.5. Mu.L, supplemented with ddH 2 O to 25. Mu.L.
7. A kit for identifying parasitism of a cocoon bee to a pink bollworm, which comprises the specific primer of claim 1.
8. The kit for identifying parasitism of Anemostemona to Heliothis armigera according to claim 7, wherein the kit further comprises dNTPs, taq DNA polymerase and PCR reaction buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454516.6A CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454516.6A CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110144410A CN110144410A (en) | 2019-08-20 |
| CN110144410B true CN110144410B (en) | 2023-02-07 |
Family
ID=67593515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910454516.6A Active CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110144410B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628958A (en) * | 2019-11-11 | 2019-12-31 | 苏州大学 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782579A (en) * | 2015-04-21 | 2015-07-22 | 湖北省农业科学院植保土肥研究所 | Artificial breeding method of chelonus pectinophorae cushman |
-
2019
- 2019-05-29 CN CN201910454516.6A patent/CN110144410B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782579A (en) * | 2015-04-21 | 2015-07-22 | 湖北省农业科学院植保土肥研究所 | Artificial breeding method of chelonus pectinophorae cushman |
Non-Patent Citations (4)
| Title |
|---|
| 棉红铃虫的产卵规律与最佳施药时间和部位的研究;李先奎;《中国棉花》;19950820(第08期);第11-12页 * |
| 海南桑螟寄生蜂种类及优势种的寄生特性研究;王娜玉等;《热带作物学报》;20190522(第05期);第953-959页 * |
| 温度对红铃虫甲腹茧蜂生长发育与繁殖的影响;丛胜波等;《中国生物防治学报》;20190430;第35卷(第2期);第180-184页 * |
| 红铃虫性信息素合成激活肽基因克隆、序列特征及在不同发育阶段的表达分析;许冬等;《中国农业科学》;20181231;第51卷(第23期);第4449-4458页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110144410A (en) | 2019-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107326077A (en) | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application | |
| Rejili et al. | A PCR-based diagnostic assay for detecting DNA of the olive fruit fly, Bactrocera oleae, in the gut of soil-living arthropods | |
| JP5522820B2 (en) | Method for detecting pathogens of strawberry important diseases and primers for detection | |
| CN110144410B (en) | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application | |
| CN100415884C (en) | DNA molecular marking method for researching fish genetic relation | |
| Asokan et al. | Molecular identification and diversity of Helopeltis antonii and Helopeltis theivora (Hemiptera: Miridae) in India | |
| CN108486121B (en) | Specific DNA sequence of Cuicoides spinuloides and molecular identification method thereof | |
| Arratia-Castro et al. | Detection and quantification of ‘Candidatus Phytoplasma asterisʼ and ‘Candidatus Liberibacter asiaticusʼ at early and late stages of Huanglongbing disease development | |
| Madani et al. | The ribosomal intergenic spacer (IGS) in the potato and tobacco cyst nematodes, Globodera pallida, G. rostochiensis and G. tabacum | |
| KR101131510B1 (en) | Method for Identification of Mealybug Found on Korean Pears Using Polymerase Chain Reaction | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN105567827A (en) | PCR method for simultaneously detecting various parasitic myxosporeans of carassius auratus gibelio | |
| Aguirre et al. | An Efficient Duplex PCR Method for Sex Identification of the European Grapevine Moth Lobesia botrana (Lepidoptera: Tortricidae) at Any Developmental Stage | |
| Li et al. | Species identification and phylogenetic relationships among five species of psocids from Chinese herbal medicines | |
| Koca et al. | Determination of the genetic variation within the egg parasitoid, trichogramma brassicae, bezdenko (Hymenoptera: Trichogrammatidae) populations in Düzce province, Turkey | |
| CN116769927B (en) | Introgression gene, primer, method and application for identifying silver carp in Changfeng | |
| CN114277158B (en) | Detection kit for Onchidium chensinensis and application thereof | |
| CN110724746B (en) | Reference gene stably expressed by different tissues of Laodelphax striatellus, and screening method and application thereof | |
| CN113789370B (en) | Identification method for fertilization mode of channel catfish culture pond | |
| CN112795660B (en) | Reference gene for stable expression of lygus lucorum under different factors and application thereof | |
| CN112522419B (en) | Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata | |
| HAROON | Genetic fingerprinting of root knot nematode as important pest in EGYPT | |
| Hu et al. | The carp–goldfish nucleocytoplasmic hybrid has mitochondria from the carp as the nuclear donor species | |
| CN108342492B (en) | Primer for rapidly identifying lugworm bugs, tea-wing bugs and stinkbug and identification method thereof | |
| CN109811060B (en) | Method for detecting resistance of plutella xylostella to Bt insecticidal protein Cry1Ac based on ABCB1 gene and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |