CN110628958A - Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus - Google Patents
Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus Download PDFInfo
- Publication number
- CN110628958A CN110628958A CN201911095969.0A CN201911095969A CN110628958A CN 110628958 A CN110628958 A CN 110628958A CN 201911095969 A CN201911095969 A CN 201911095969A CN 110628958 A CN110628958 A CN 110628958A
- Authority
- CN
- China
- Prior art keywords
- virus
- eriocheir sinensis
- pcr
- primer pair
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer pair and a kit for PCR detection of Eriocheir sinensis hornet virus. The invention provides a primer pair for PCR detection of Eriocheir sinensis swarm virus, which is designed according to a specific sequence of the Eriocheir sinensis swarm virus shown as SEQ ID NO.3, and PCR detection of the Eriocheir sinensis swarm virus is realized. The invention realizes the rapid detection of the Eriocheir sinensis swarm virus, the electrophoresis detection from the template preparation to the PCR product is usually completed within about 5 hours, and the PCR technology is very popular, so the method can be realized in general biological laboratories and can be widely applied to the detection of the Eriocheir sinensis swarm virus in the culture production. Compared with the detection of the metagenome and the macrotranscriptome, the method has the advantages of high speed, low cost, strong pertinence and good applicability.
Description
Technical Field
The invention relates to a primer pair and a kit for PCR detection of Eriocheir sinensis hornet virus, belonging to the technical field of biological detection.
Background
The braconidae virus (Bracovirus) is a member of the genus Begonia of the family Multiplex DNA Virus, virions of the genus Begonia Virus are in the shape of incomplete cylinders, nucleocapsid cylinders, diameter of about 40nm, length of 30-150 nm, the virus has a cyst membrane, one or more nucleocapsids can be contained in the cyst membrane, and the virus has a double-stranded circular polydisperse DNA genome. The virus and the hornet are mutually beneficial to symbiosis, and the genome of the virus can be integrated in the genome of the hornet. The cocoon bee virus mainly exists in parasitic wasps of hymenoptera braconidae and plays an important role in successfully parasitizing hosts by the parasitic wasps.
Chinese mitten crabs (Eriocheir sinensis), which are called river crabs, are traditional aquatic products precious products in China. Various diseases are frequently generated in the cultivation process of the eriocheir sinensis, but research on related aspects is very lacking. Bacterial diseases of Eriocheir sinensis are various, and mainly comprise gill rot, edema disease, vibriosis, enteritis, etc. The reported pathogenic bacteria mainly comprise bacterial pathogens such as aeromonas, pseudomonas, vibrio mimicus, vibrio parahaemolyticus and the like, the aeromonas is common, but the corresponding relation between the pathogens and symptoms is still unclear.
The research on the viral diseases of the Eriocheir sinensis is less, and the viruses which are currently separated, identified or observed from the Eriocheir sinensis mainly comprise Reovirus (Reovirus), Reovirus-like virus (Reo-like virus), small RNA virus (Picornavirus), herpes virus (herpes virus), bunyavirus-like virus (Bunya-like virus) and crab blast virus (Cholera-like virus). However, the pathogenicity of the viruses on river crabs and the degree of harm to the breeding industry are still unclear. The river crab flutter disease (ringleg disease, shaky disease) is a disease which is researched and reported mostly, but the etiology of the disease is still unclear from the aspect of etiology, and the main reported pathogenic virus and Spiroplasma (spiroplama) are reoviruses, wherein the reported viruses are reoviruses, and the strain ERV 905 is formally named as a crab twelve-segment reovirus by the International Commission on viral classifications and is a new genus of the reoviridae, namely, the genus of the crab twelve-segment reovirus (Cardoreovirus). White spot syndrome virus (White spot syndrome virus) of prawns is the largest pathogen causing the breeding loss of prawns, and it is clear that White spot syndrome virus can infect river crabs to cause death.
The hepatopancreas necrosis of eriocheir sinensis is a disease which once caused great loss in the breeding industry in recent years, and microsporidian is detected in hepatopancreas of river crabs with the hepatopancreas necrosis, and the microsporidian is considered to be a pathogen of the hepatopancreas necrosis once, but the isolated microsporidian fails to reproduce the hepatopancreas necrosis of eriocheir sinensis, so that the view that the microsporidian is a pathogen of the hepatopancreas necrosis is denied. However, the cause of hepatopancreas necrosis of Eriocheir sinensis has not been known so far.
In addition to the diseases and pathogens of Eriocheir sinensis as described above, some fungi have been reported, for example: mycosis caused by parasitism of fungi such as blue crab chain chytrid, sea chytrid, saprolegnia, cotton mold, etc., and parasitism caused by parasitism of ciliate, pseudoamoeba, trematode cysticercus, micro fasciola, neospora, crab Nurse, etc.
In conclusion, the research on the disease of the eriocheir sinensis is very limited, in particular to the research on the viral disease. Diseases with unknown etiology or pathogeny frequently occur in breeding production, so that viruses in the eriocheir sinensis tissues are separated and identified, and relevant viruses are detected, and the possible damage of the viruses is determined to be important for preventing and treating the diseases. However, since viruses are of various types and cannot be cultured extracellularly as bacteria do, it is difficult to detect them by a conventional method when the classification status of the viruses and the basic biological properties of the viruses are unknown. The detection by histopathology and an electron microscope has the advantages of long time consumption, complex operation, low sensitivity, easy omission and unsuitability for detecting a large number of samples. The 7 families of viruses, Potyviridae, Phycodnaviridae, Nodavidiadae, Nimaviridae, Myoviridae, Herpesviridae, were detected by Huaishun Shen et al in the hepatopancreata of the hepatopancreatic necrosis syndrome by means of macrotranscriptomics. However, the technical method is difficult to be used for detection in cultivation production due to high detection cost, long detection period and complex bioinformatics analysis. With the popularization and application of molecular detection technology, PCR detection becomes one of the most conventional technologies for virus identification and detection due to good specificity, high sensitivity, good repeatability, quick and simple method, low cost and capability of being carried out in a common laboratory, but no report is provided about the detection of the Eriocheir sinensis swarm virus.
Disclosure of Invention
In order to solve the technical problems, the invention provides a method for detecting and identifying white spot virus of eriocheir sinensis.
The first purpose of the invention is to provide a primer pair for PCR detection of Eriocheir sinensis swarm virus, wherein the primer pair is designed according to a specific sequence of the Eriocheir sinensis swarm virus.
Further, the nucleotide sequence of the eriocheir sinensis hornet virus specific sequence is shown in SEQ ID NO. 3.
Further, the primer pair comprises:
forward primer (SEQ ID No. 1): 5'-CACCCACTACAAGGATGTGC-3', respectively;
reverse primer (SEQ ID NO. 2): 5'-CCTCCATCAAACCTGAAGAACC-3' are provided.
Furthermore, the primer pair also comprises a primer pair obtained by mismatch of 1-3 bases in the sequence without changing the 3' end base of the primer pair.
The second purpose of the invention is to provide a kit, which comprises the primer pair for PCR detection of the Eriocheir sinensis Walker virus.
Further, the kit also comprises a freeze-dried DNA extraction reagent, a freeze-dried PCR detection reagent and a control plasmid.
Further, the DNA extraction reagent is 1000mmol of Tris-HCl, 250mmol of EDTA, 5000mmol of NaCl, 10% SDS, 10% NP40 and 10000. mu.g/ml proteinase K.
Further, the PCR detection reagent is 10 XPCR buffer solution, 4dNTPs Mix, 250pmol/L primer pair and 25mM MgCl25U/. mu.L Taq DNA polymerase.
Further, the control plasmid contains a specific sequence of the Eriocheir sinensis hornet virus shown in SEQ ID NO. 3.
The third purpose of the invention is to provide a method for detecting the eriocheir sinensis hornet virus by using the kit, which comprises the following steps:
(1) dissolving in 0.5-1mL double distilled water in a tissue total DNA extraction tube to prepare a tissue total DNA extracting solution, mixing with 0.1g of tissue to be detected, keeping the temperature at 55 ℃ for 0.5-1 h, heating in a boiling water bath for 5 min, centrifuging at 12000 rpm for 10 min, and taking the supernatant as a DNA template;
(2) adding 24 mu L of double distilled water into a PCR tube of a sample to be detected, and adding 1 mu L of DNA template after dissolving;
(3) dissolving in 25 μ L double distilled water in a positive control PCR tube;
(4) and (3) carrying out PCR amplification on the PCR tubes obtained in the steps 2 and 3, wherein the amplification conditions are as follows: pre-denaturing at 93-95 ℃ for 3 min, annealing at 94 ℃ for 30 sec, annealing at 50-60 ℃ for 30 sec, extending at 72 ℃ for 15-25 sec, performing amplification for 25-35 cycles, and finally extending at 72 ℃ for 10 min;
(5) after the PCR reaction is finished, separating the PCR reaction product by 0.8% agarose gel electrophoresis, recovering the PCR product of 0.3kb, cloning into a vector and sequencing; when the consistency between the detected sequence and the sequence SEQ ID NO.3 reaches more than 98 percent, the detected sample can be judged to contain the Eriocheir sinensis Coccidae virus.
The invention has the beneficial effects that:
(1) at present, no report about the Eriocheir sinensis swarm virus exists, and no report about the virus detection method exists, so that the conventional histopathology observation and electron microscope detection cannot be used for correctly judging whether the tissue sample contains the Eriocheir sinensis swarm virus. The invention realizes the PCR detection of the Eriocheir sinensis hornet virus.
(2) The invention realizes the rapid detection of the Eriocheir sinensis swarm virus, the electrophoresis detection from the template preparation to the PCR product is usually completed within about 5 hours, and the PCR technology is very popular, so the method can be realized in general biological laboratories and can be widely applied to the detection of the Eriocheir sinensis swarm virus in the culture production. Compared with the detection of the metagenome and the macrotranscriptome, the method has the advantages of high speed, low cost, strong pertinence and good applicability.
(3) Compared with the conventional PCR template, the preparation of the DNA template of the invention does not need to extract and purify complex impurity DNA, and only needs to homogenize the detected tissue by the total DNA extracting solution of the eriocheir sinensis tissue, then heat-preserving at 55 ℃ for 0.5-1 hour, heating at 95-100 ℃ for 3-10 minutes, and performing simple centrifugation, thereby greatly shortening the preparation time of the template DNA and reducing the pollution caused by phenol and chloroform in the conventional DNA extraction.
Drawings
FIG. 1 is a diagram of the detection of the Begonia sinensis virus in the hepatopancreas of Eriocheir sinensis. Lane M: a standard molecular weight DNA Marker; lanes 1-6: electrophoresis of PCR products of the liver pancreatic tissue sample; specific bands corresponding to the theoretical molecular weight (301bp) were observed in the tissue samples corresponding to lanes 1-3, and no specific bands were observed in the tissue samples corresponding to lanes 4-6.
FIG. 2 corresponds to the alignment of the sequence of PCR products of Eriocheir sinensis hepatopancreas total DNA in lane 1 of example 2 with the sequence of SEQ ID NO. 3.
FIG. 3 is a diagram showing the detection of the virus of the cocoon bee in the branchia of the Eriocheir sinensis. Lane M: a standard molecular weight DNA Marker; lanes 1-5: PCR products of gill tissue samples are electrophoresed, and specific bands with theoretical molecular weight (301bp) can be observed.
FIG. 4 corresponds to the alignment of the PCR product sequence of the Eriocheir sinensis gill total DNA in lane 5 of example 3 with the sequence of SEQ ID NO. 3.
FIG. 54 detection of Choicerus carinatus virus in muscle, hepatopancreas, and digestive tract of Eriocheir sinensis. Lane M: a standard molecular weight DNA Marker; lanes 1-3, PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No.1, respectively; lanes 4-6, PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No.2, respectively; lanes 7-9, PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No.3, respectively; lanes 10-12 are PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No. 4, respectively.
Detailed Description
The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.
Example 1: macrotranscriptome method for screening and identifying Eriocheir sinensis swarm virus
1. Collecting river crabs with inactive ingestion, slow action, slow reaction and weakness of limbs, and dissecting to obtain hepatopancreas;
2. total RNA was extracted using the RNeasy R Plus Mini Kit (Qiagen, Valencia, CA, USA);
3. the DNA was removed by digestion with RNase-free DNase (Qiagen, Valencia, Calif., USA);
4. after removal of ribosomal RNA using the Ribo-ZeroTM Magnetic Kit (Epicenter, Charlotte, NC, USA), commercial companies were entrusted with Illumina Hiseq 2500(Illumina, Inc., San Diego, Calif., USA) for macrotranscriptome sequencing;
5. with fastQC toolkit
(http:// www.bioinformatics.babraham.ac.uk/projects/fastqc /) software the quality of sequencing was assessed according to Phred score;
6. removing the linker sequence with SeqPrep software (https:// githu. com/jstjohn/SeqPrep), removing the low-mass sequence of Phred score <20, removing the less than 50bp sequence with Sickle software (https:// githu. com/najoshi/Sickle), aligning the detected sequence with the SILVA SSU (16S/18S) and SILVA LSU (23S/28S) databases with SortMeRNA software, removing the rRNA sequences, thereby obtaining high-mass sequences;
7. de novo assembly is carried out on the obtained high-quality sequence by using Trinity software (http:// trinityareq. github. io/; (version trinityareq-r 2013-02-25) and selecting default parameters;
8. non-redundant gene categories were constructed using CD-HIT software (http:// www.bioinformiscs.org/CD-HIT /);
9. and setting the comparison expected value of the obtained sequence and the NCBI NR database as 1e-5, and obtaining the species classification information represented by the sequence according to the species classification information in the NR database.
10. Finding that a gene sequence has no similarity with the sequences of bacteria, fungi, archaea and river crabs; the sequence is subjected to BLASTX alignment, and the amino acid sequence coded by the sequence is found to have higher homology with the corresponding region of the hypothetical protein CsmBV13.10 of the Diolcogaster facetosa brachovirus disclosed in GenBank, and the amino acid consistency reaches 43.94 percent. Therefore, the found gene sequence represents a new cocoon bee virus sequence, and the new cocoon bee virus is named as Eriocheir sinensis swarm virus according to the host from which the novel cocoon bee virus is derived; the gene sequence is shown as SEQ ID NO. 3.
Example 2: detection of Eriocheir sinensis Coccidae virus in hepatopancreas tissue
Designing a primer pair SEQ ID NO.1 and SEQ ID NO.2 for PCR detection of the Eriocheir sinensis swarm virus according to the specific sequence SEQ ID NO. 3:
SEQ ID NO1：
CACCCACTACAAGGATGTGC
SEQ ID NO2:
CCTCCATCAAACCTGAAGAACC
the specific operation process is as follows:
(1) sampling: weighing about 0.1g of hepatopancreas by using an electronic balance, and transferring the hepatopancreas into a centrifugal tube of 1.5 mL;
(2) preparing a eriocheir sinensis tissue total DNA extracting solution: the prepared extract contained 100mmol of Tris-HCl (pH8.0), 25mmol of EDTA (pH8.0), 500mmol of NaCl, 1% SDS, 0.1% NP40, and 100. mu.g/ml proteinase K.
(3) Preparation of DNA template: weighing 0.5mL of Eriocheir sinensis tissue total DNA extracting solution, adding into a centrifuge tube containing hepatopancreas tissue, grinding the tissue with a micro grinding rod, keeping the temperature at 55 ℃ for 0.8 h, heating in boiling water bath for 5 min, centrifuging at 12000 rpm for 10 min, carefully sucking the supernatant with a pipette, transferring into a new centrifuge tube as a DNA template.
(4) Synthesizing and preparing primers: primers were synthesized by the commercial company according to the sequences of SEQ ID NO1 and SEQ ID NO2, and a primer stock solution was prepared by dissolving the primers synthesized by the commercial company in double distilled water to a final concentration of 250 pmol/L.
(5) Preparing a 25-mu-L PCR reaction system:
TABLE 1
The components are mixed in proportion in a PCR tube and are slightly centrifuged.
(6) And (3) PCR amplification: and (3) placing the PCR tube in the step (5) in a PCR instrument, pre-denaturing at 94 ℃ for 3 minutes, denaturing at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extending at 72 ℃ for 20 seconds, amplifying for 30 cycles, and finally extending at 72 ℃ for 10 minutes to set PCR reaction.
(7) And (3) electrophoresis detection: after the PCR reaction, 8. mu.L of the reaction product was separated by electrophoresis on a 1% agarose gel. In order to estimate the molecular weight of the PCR product, a standard molecular weight DNA Marker was run on another lane. After the electrophoresis was completed, a DNA band having a theoretical molecular weight of 301bp was observed under an ultraviolet viewer (FIG. 1). Specific bands consistent with the theoretical molecular weight (301bp) were observed in the tissue samples corresponding to lanes 1-3, and no specific bands were observed in the tissue samples corresponding to lanes 4-6.
(8) Cloning and sequencing of the PCR products: the PCR-specific band of lane 1 (FIG. 1) was recovered by tapping under an ultraviolet viewer, and the PCR product was purified using a DNA gel recovery kit, and then cloned into a T-vector sold by commercial companies for DNA sequencing of the PCR product.
(9) DNA sequence analysis of PCR products: the sequence is compared with the SEQ ID NO.3 by Global alignment online software (https:// blast.ncbi.nlm.nih.gov/blast.cgi), the consistency of the detected DNA sequence and the SEQ ID NO.3 reaches 100%, and therefore, the detected sample can be considered to contain the Eriocheir sinensis cocoon bee virus (figure 2).
Example 3: detection of Eriocheir sinensis hornet virus in gill tissue
The specific operation process is as follows:
(1) sampling: rinsing gills of crabs to be detected for 3 times by using double distilled water, absorbing excessive water drops by using clean absorbent paper, weighing about 0.1g of gills by using an electronic balance, transferring the gills into a centrifugal tube of 1.5mL, and shearing the gills.
(2) Preparing a eriocheir sinensis tissue total DNA extracting solution: the same procedure as in example 2, step (2).
(3) Preparation of DNA template: measuring 1mL of eriocheir sinensis tissue total DNA extracting solution, adding the extracting solution into a centrifuge tube containing gill tissues, grinding the tissues by using a micro grinding rod, preserving heat at 55 ℃ for 1 hour, heating in a boiling water bath for 5 minutes, centrifuging at 12000 rpm for 10 minutes, carefully sucking supernatant by using a pipette, transferring the supernatant into a new centrifuge tube to serve as a DNA template.
(4) Synthesizing and preparing primers: same as step (4) in example 2.
(5) Preparing 25 mu L of premixed solution freeze-dried powder of PCR reaction system
TABLE 2
The components are mixed in proportion in a PCR tube and are slightly centrifuged. After freeze-drying, sealing and storing at-20 ℃. Before use, the mixture is taken out of a refrigerator, 19 mu L of double distilled water is added, and after the double distilled water is completely dissolved, a 1 mu LDNA template is added and mixed evenly.
(6) And (3) PCR amplification: and (3) placing the PCR tube in the step (5) in a PCR instrument, pre-denaturing at 94 ℃ for 3 minutes, denaturing at 94 ℃ for 30 seconds, annealing at 57 ℃ for 30 seconds, extending at 72 ℃ for 25 seconds, amplifying for 40 cycles, and finally extending at 72 ℃ for 10 minutes to set PCR reaction.
(7) And (3) electrophoresis detection: after the PCR reaction, 8. mu.L of the reaction product was separated by electrophoresis on a 1% agarose gel. In order to estimate the molecular weight of the PCR product, a standard molecular weight DNA Marker was run on another lane. After the electrophoresis was completed, a DNA band having a theoretical molecular weight of 301bp was observed under an ultraviolet viewer (FIG. 3). A specific band consistent with the theoretical molecular weight (301bp) was observed in the tissue samples corresponding to lanes 1-5.
(8) Cloning and sequencing of the PCR products: the PCR-specific band from lane 5 (FIG. 3) was recovered by tapping under UV-viewer, and the PCR product was cloned and sequenced as in step (8) of example 2.
(9) DNA sequence analysis of PCR products: when the sequence alignment was performed according to the protocol of step (8) in example 2, the identity of the detected DNA sequence and SEQ ID NO.3 reached 99%, and thus it was considered that the detected sample contained the Eriocheir sinensis Coccida virus (FIG. 4).
Example 4: detection of Eriocheir sinensis Coccidae virus in different tissues by using different annealing temperatures
The specific operation process is as follows:
(1) sampling: taking muscles, hepatopancreas and digestive tract of the crab to be detected, rinsing the digestive tract with double distilled water for 3 times, removing intestinal contents by washing, removing redundant water drops by using clean absorbent paper, weighing about 0.1g of tissues by using an electronic balance, and respectively transferring the tissues to a centrifugal tube of 1.5 mL.
(2) Preparing a eriocheir sinensis tissue total DNA extracting solution: the same procedure as in example 2, step (2).
(3) Preparation of DNA template: weighing 0.75mL of the total DNA extract of the eriocheir sinensis tissue, adding the extract into each centrifuge tube containing the tissue, grinding the tissue by using a micro grinding rod, preserving the heat at 55 ℃ for 0.5 hour, heating in a boiling water bath for 3 minutes, centrifuging at 12000 rpm for 10 minutes, carefully sucking the supernatant by using a pipette, and transferring the supernatant into a new centrifuge tube to serve as a DNA template.
(4) Synthesizing and preparing primers: same as step (4) in example 2.
(5) Preparing 25 mu L of premixed solution freeze-dried powder of a PCR reaction system: the same procedure as in step (6) in example 2 was repeated.
(6) And (3) PCR amplification: and (3) placing the PCR tube in the step (5) in a PCR instrument, pre-denaturing at 94 ℃ for 3 minutes, denaturing at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, extending at 72 ℃ for 15 seconds, amplifying for 25 cycles, and finally extending at 72 ℃ for 10 minutes to set PCR reaction.
(7) And (3) electrophoresis detection: after the PCR reaction, 8. mu.L of the reaction product was separated by electrophoresis on a 1% agarose gel. In order to estimate the molecular weight of the PCR product, a standard molecular weight DNA Marker was run on another lane. After the electrophoresis was completed, a DNA band having a theoretical molecular weight of 301bp was observed under an ultraviolet viewer (FIG. 5). Lane M: standard molecular weight DNAMarker; lanes 1-3, PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No.1, respectively; lanes 4-6, PCR products of DNA of the muscle, hepatopancreas, digestive tract of Eriocheir sinensis sample No.2, respectively; lanes 7-9: PCR products of DNA of muscle, liver pancreas and digestive tract of the eriocheir sinensis No.3 sample respectively; lanes 10-12: PCR products of DNA of muscle, liver pancreas and digestive tract of the eriocheir sinensis No. 4 sample are respectively. PCR products with the same molecular weight as the theoretical molecular weight can be amplified from the DNA of the muscle, the hepatopancreas and the digestive tract of 4 Chinese mitten crabs.
(8) Cloning and sequencing of the PCR products: PCR-specific bands from lanes 7, 8, 11, 12 (FIG. 5) were recovered by tapping under UV-viewer, and the PCR products were cloned and sequenced as in step (8) of example 2.
(9) DNA sequence analysis of PCR products: the DNA sequence was compared with SEQ ID NO.3 by the protocol of step 8 of example 2, and it was found that the detected sample also contained the Eriocheir sinensis Coccida virus, because the identity of the DNA sequence was 100%.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.
Sequence listing
<110> Suzhou university
<120> primer pair and kit for PCR detection of Eriocheir sinensis hornet virus
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> (Artificial sequence)
<400> 1
cacccactac aaggatgtgc 20
<210> 2
<211> 22
<212> DNA
<213> (Artificial sequence)
<400> 2
cctccatcaa acctgaagaa cc 22
<210> 3
<211> 301
<212> DNA
<213> (Artificial sequence)
<400> 3
cacccactac aaggatgtgc taatgaaaac acctgacgat aatggaattc tggacgtttc 60
tgtctcgtac gatggcacat ggcataaaag agggtttatg tcgcagtttg gtgttggagc 120
ggtgattgaa ttggaaactg gattgattgt tgactttgaa gtgatgagca agtattgcag 180
caagtgtgca atccagaata acaagaagaa gctatctcaa gtcaagaaca tgatgcatgg 240
aagaagaaac attcacctga ctgccacatc aaccacgaag gttcttcagg tttgatggag 300
g 301
Claims (10)
1. A primer pair for PCR detection of Eriocheir sinensis swarm virus is characterized in that the primer pair is designed according to a specific sequence of the Eriocheir sinensis swarm virus.
2. The primer pair for PCR detection of Eriocheir sinensis swarm virus according to claim 1, wherein the nucleotide sequence of the specific sequence of Eriocheir sinensis swarm virus is shown as SEQ ID No. 3.
3. The primer pair for PCR detection of Eriocheir sinensis Cochlid virus according to claim 2, wherein the primer pair comprises:
forward primer (SEQ ID No. 1): 5'-CACCCACTACAAGGATGTGC-3', respectively;
reverse primer (SEQ ID NO. 2): 5'-CCTCCATCAAACCTGAAGAACC-3' are provided.
4. The primer pair for PCR detection of Eriocheir sinensis Cochlid virus according to claim 1, wherein the primer pair further comprises a primer pair obtained by mismatch of 1-3 bases in the sequence without changing the bases at the 3' end of the primer pair.
5. A kit, which is characterized by comprising the primer pair for PCR detection of the Eriocheir sinensis Walker virus according to any one of claims 1 to 4.
6. The kit of claim 5, wherein the kit further comprises lyophilized DNA extraction reagents, lyophilized PCR detection reagents, and a control plasmid.
7. The kit of claim 6, wherein the DNA extraction reagent is 800-1200mmol Tris-HCl, 200-300mmol EDTA, 4500-5500mmol NaCl, 8-12% SDS, 8-12% NP40, and 8000-12000 μ g/ml proteinase K.
8. The kit of claim 6, wherein the PCR detection reagent is 10 XPCR buffer, 4dNTPs Mix, 200-300pmol/L primer pair, 20-30mM MgCl23-8U/. mu.L Taq DNA polymerase.
9. The kit of claim 6, wherein the control plasmid comprises a Eriocheir sinensis Begonia virus-specific sequence as set forth in SEQ ID NO. 3.
10. The method for detecting the eriocheir sinensis hornet virus by using the kit of claim 5, which is characterized by comprising the following steps of:
(1) dissolving in 0.5-1mL double distilled water in a tissue total DNA extraction tube to prepare a tissue total DNA extracting solution, mixing with 0.08-0.12g of tissue to be detected, keeping the temperature at 50-60 ℃ for 0.5-1 h, heating in a boiling water bath for 4-6 min, centrifuging for 8-12 min, and taking the supernatant as a DNA template;
(2) adding 20-30 mu L of double distilled water into a PCR tube of a sample to be detected, and adding 0.8-1.2 mu L of DNA template after dissolving;
(3) adding 20-30 mu L of double distilled water into a positive control PCR tube for dissolving;
(4) carrying out PCR amplification on the PCR tubes obtained in the steps 2 and 3;
(5) after the PCR reaction is finished, 8-10 microliter of reaction product is separated by agarose gel electrophoresis, 0.3kb of PCR product is recovered and cloned into a vector for sequencing; when the consistency between the detected sequence and the sequence SEQ ID NO.3 reaches more than 98 percent, the detected sample can be judged to contain the Eriocheir sinensis Coccidae virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911095969.0A CN110628958A (en) | 2019-11-11 | 2019-11-11 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911095969.0A CN110628958A (en) | 2019-11-11 | 2019-11-11 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110628958A true CN110628958A (en) | 2019-12-31 |
Family
ID=68979467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911095969.0A Pending CN110628958A (en) | 2019-11-11 | 2019-11-11 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110628958A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861512A (en) * | 2015-01-22 | 2016-08-17 | 中国农业科学院植物保护研究所 | Microplitis mediator MmedCO I gene and application thereof |
| CN110144410A (en) * | 2019-05-29 | 2019-08-20 | 湖北省农业科学院植保土肥研究所 | A kind of molecular detecting method and application for identifying Chelonus to pink bollworm sneak case |
-
2019
- 2019-11-11 CN CN201911095969.0A patent/CN110628958A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861512A (en) * | 2015-01-22 | 2016-08-17 | 中国农业科学院植物保护研究所 | Microplitis mediator MmedCO I gene and application thereof |
| CN110144410A (en) * | 2019-05-29 | 2019-08-20 | 湖北省农业科学院植保土肥研究所 | A kind of molecular detecting method and application for identifying Chelonus to pink bollworm sneak case |
Non-Patent Citations (1)
| Title |
|---|
| 吕鸿声著: "《昆虫病毒分子生物学》", 31 January 1998, 北京农业科技出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Forgia et al. | Virome characterization of Cryphonectria parasitica isolates from Azerbaijan unveiled a new mymonavirus and a putative new RNA virus unrelated to described viral sequences | |
| AU2019100992A4 (en) | Primer set, kit, and method for detecting porcine epidemic diarrhea virus | |
| Ling et al. | Viral metagenomics reveals significant viruses in the genital tract of apparently healthy dairy cows | |
| CN110714087B (en) | Primer, kit and identification method for simultaneously and rapidly identifying 4 taenia solium larvae | |
| CN111471776A (en) | Shrimp liver enterocytozoon detection kit and detection method thereof | |
| CN112322789B (en) | Nested PCR (polymerase chain reaction) kit and method for detecting double RNA (ribonucleic acid) viruses of micropterus salmoides | |
| CN111850153B (en) | Primer group for detecting prawn acute hepatopancreatic necrosis disease-vibrio parahaemolyticus and kit containing primer group | |
| CN107653230A (en) | A kind of II type pseudoabies poison strain and its application | |
| CN110628958A (en) | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus | |
| CN105969907B (en) | Kit for detecting ST251 type pathogenic aeromonas hydrophila and application thereof | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| EP1329522B2 (en) | Method of detecting norwalk-like virus (gi) | |
| AU2020103434A4 (en) | Primers and kit for detecting four kiwifruit viruses of acva, acvb, cmv and accrav | |
| CN110628957A (en) | Primer pair and kit for PCR detection of white spot syndrome virus of Eriocheir sinensis | |
| CN110982941B (en) | RT-RPA detection primer of carp coronavirus HL39 and application | |
| JP2019013169A (en) | Diagnostic methods for virus | |
| CN110863067A (en) | Primer pair and kit for detecting eel herpes virus | |
| Filipa-Silva et al. | Virological screening of wild and farmed fish species: Application of innovative Taqman multiplex real-time PCR protocols | |
| CN111218526B (en) | PCR primer pair and probe for rapidly identifying I subgroup serum 11 type avian adenovirus and application thereof | |
| CN114717359B (en) | Lily virus LCrV-1 specific detection target sequence, kit and detection method | |
| CN114561479B (en) | Primer for identifying iron-shell shrimp individuals in macrobrachium rosenbergii and application of primer | |
| KR101653161B1 (en) | Method for concentrating and detecting hepatitis E virus in food stuff | |
| CN108796130B (en) | GII.2 type norovirus genome amplification primer and amplification method | |
| Guo et al. | First Report of Sugarcane Mosaic Virus Infecting Goose Grass in Shandong Province, China |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |