CN110144410A - A kind of molecular detecting method and application for identifying Chelonus to pink bollworm sneak case - Google Patents
A kind of molecular detecting method and application for identifying Chelonus to pink bollworm sneak case Download PDFInfo
- Publication number
- CN110144410A CN110144410A CN201910454516.6A CN201910454516A CN110144410A CN 110144410 A CN110144410 A CN 110144410A CN 201910454516 A CN201910454516 A CN 201910454516A CN 110144410 A CN110144410 A CN 110144410A
- Authority
- CN
- China
- Prior art keywords
- chelonus
- pink bollworm
- ovum
- dna
- specific primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Molecular detecting method and application the present invention provides a kind of identification Chelonus to pink bollworm sneak case, this method carries out PCR amplification to pink bollworm ovum DNA including the use of specific primer, by detecting whether to obtain expected amplified production, whether judge pink bollworm ovum by Chelonus parasitism, the specific primer includes PG-PL10-F2 (as shown in SEQ ID NO:1) and PG-PL10-R2-1 (as shown in SEQ ID NO:2), PG-PL10-R2-2 (as shown in SEQ ID NO:3).The present invention can quickly and accurately detect whether Chelonus is parasitic from field pink bollworm ovum.
Description
Technical field
The invention belongs to technical field of molecular biology, in particular to a species-specific primer and identification first abdomen cocoon
Molecular detecting method and application of the bee to pink bollworm sneak case.
Background technique
Pink bollworm Chelonus Chelonus pectinophorae (Cushman) is a kind of across ovum-larval phase parasitic wasp,
Its host further includes ancient cooking vessel point spark Earias in addition to pink bollworm Pectinophora gassypiella (Saunders)
Cupreoviridis (Walker), sugar cane shoot borer Argyroploce schistaceana (Snellen), cotton leafroller
Sylepta derogata (Fabricius), eating-core bean worm Leguminivora glycinivorella (Matsumura)
It is that one kind has potential natural enemy insect very much etc. a large amount of lepidoptera pests.The parasitic wasp is in China Hubei, Anhui, Henan, four
The area such as river, Jiangsu, Zhejiang, Jiangxi and Taiwan is distributed.
In parasitic wasp artificial propagation, parasitic rate and hatching rate are highly important indexs, are usually used to evaluate this and post
The height of raw bee commodity value.In general, can using the parasitic wasp offspring nibble out quantity, cocoon or out bee quantity as its oviposition
The judging basis of ability.But as most egg parasitoids, after pink bollworm Chelonus lays eggs to vector pink bollworm,
Its larva hatched also needs to continue to carry out feeding in vector pink bollworm body, and development to certain phase is just from pink bollworm host
It nibbles out in vivo, then changes cocoon.In this array of growth growth course, Chelonus offspring growth course is by where vector
The conditions such as environment temperature, humidity, illumination and food be affected.Therefore, parasitic wasp is selected to nibble extracting rate, change cocoon rate and bee hatching rate
As the judging basis of egg parasitoids pink bollworm Chelonus parasitic ability, it can not really reflect that it is true to a certain extent
Pest controlling ability.In order to evaluate pink bollworm Chelonus to the controlling potency of pink bollworm, select a kind of easy to operate, scientific and effective
Molecular detection technology for identifying that egg parasitoids then seem necessary and practical to the parasitic ability of host.
Summary of the invention
In view of the deficiencies in the prior art, the purpose of the present invention is to provide a species-specific primers, and provide a kind of fast
Molecular detecting method and application of the speed identification Chelonus to pink bollworm sneak case.
In order to achieve the object of the present invention, inventor is put forward for the first time for Chelonus DEAD-box family PL10 gene,
Specific primer PG-PL10-F2 and PG-PL10-R2-1, PG-PL10-R2-2 are devised, to the pink bollworm ovum DNA of different disposal
Sample carries out augmentation detection, and discovery only can just amplify in by the parasitic processed pink bollworm DNA sample of Chelonus
The purpose band of PL10 gene.Specifically, technical solution of the present invention is summarized as follows:
Two pairs of specific primers, the specific primer include PG-PL10-F2 and PG-PL10-R2-1, PG-PL10-
R2-, wherein the sequence of PG-PL10-F2 is as shown in SEQ ID NO:1, the sequence of PG-PL10-R2-1 such as SEQ ID NO:2 institute
Show, the sequence of PG-PL10-R2-3 is as shown in SEQ ID NO:3.
From the point of view of result of study of the invention, using above-mentioned primer amplified PL10 gene, it can be achieved that pink bollworm
Chelonus carries out Identification of Species, and then is used to differentiate field pink bollworm ovum by Chelonus sneak case.It is parasitic in statistics ovum
In terms of bee parasitic rate, avoid egg parasitoids offspring is influenced by conditions such as host's self-condition, foods, causes to count bee situation
Not the case where not being inconsistent with parasitic rate.Therefore further, the present invention also provides above-mentioned specific primers to detect red bell
Whether worm is by the application in the egg laying amount of Chelonus parasitism or/and Chelonus.
In addition, identifying that Chelonus, should to the molecular detecting method of pink bollworm sneak case the present invention also provides a kind of
Method carries out PCR amplification to pink bollworm ovum DNA including the use of above-mentioned specific primer, obtains amplification production by detecting whether
Whether object judges pink bollworm ovum by Chelonus parasitism.
It is further preferred that identification Chelonus has the molecular detecting method of pink bollworm sneak case as described above
Body includes the following steps:
(1) all DNA in pink bollworm ovum tissue is extracted；
(2) using DNA obtained by step (1) as template, using above-mentioned specific primer, pcr amplification reaction is carried out；
(3) it takes PCR to react amplified production, is detected by agarose gel electrophoresis；
(4) according to whether occurring the characteristic bands of Chelonus PL10 genetic fragment in electrophoretic band, judge pink bollworm ovum
Whether by Chelonus parasitism.
In very particularly preferred embodiment of the invention, identify Chelonus to the molecule of pink bollworm sneak case as described above
Detection method, which is characterized in that the reaction condition of the PCR reaction are as follows: 95 DEG C, initial denaturation 5min；95 DEG C, it is denaturalized 30s；Respectively
At 60 DEG C, anneal 30s；72 DEG C, extend 30s；Circulation 35,72 DEG C of extension 10min.
In very particularly preferred embodiment of the invention, identify Chelonus to the molecule of pink bollworm sneak case as described above
Detection method, which is characterized in that the reaction system of the PCR reaction: 10 × Ex taq buffer, 2.5 μ L, 2.5mM dNTPs
1.5 1.5 μ L of μ L or cDNA of 2 μ L, Ex taq enzyme 0.125 μ L, positive anti-primer each 1 μ L, DNA, supplements ddH2O to 25 μ L.
Differentiate field pink bollworm ovum by Chelonus sneak case, sheet due to that can realize using above-mentioned specific primer
Invention additionally provides a kind of identification Chelonus to the kit of pink bollworm sneak case, which contains above-mentioned specificity
Primer.It is further preferred that as described above identification Chelonus to the kit of pink bollworm sneak case, further include dNTPs,
Taq archaeal dna polymerase, PCR reaction buffer.
Compared with prior art, the invention has the advantages that and significant progress:
(1) the present invention is based on the PL10 fragment sequence difference of Chelonus and pink bollworm, designing quickly, accurately to be detected
The specific primer of Chelonus parasitism, and establish PCR detection architecture on this basis, can from field pink bollworm ovum quickly,
Accurately detect whether Chelonus is parasitic.
(2) present invention firstly provides using Chelonus PL10 gene DNA bar coding to pink bollworm Chelonus into
Row Identification of Species, and then be used to differentiate field pink bollworm ovum by Chelonus sneak case.
(3) present invention avoids egg parasitoids offspring by host's self-condition, food in terms of counting egg parasitoids parasitic rate
The conditions such as object influence, and cause to count the case where bee situation is not inconsistent with parasitic rate, are advantageously implemented quick and precisely statistics and post
The parasitic rate of raw bee parasitism field pink bollworm ovum.This detection method has many advantages, such as convenient, fast, economical, accurate.
Detailed description of the invention
Fig. 1: degenerate primer Pg-V-F, Pg-V-R1 are to Chelonus template amplification situation；Wherein M:Marker
(DL2000), 1-3: Chelonus DNA, 4-6: Chelonus cDNA, 7-8: blank control.
Fig. 2: degenerate primer Pg-V-F, Pg-V-R2 are to Chelonus template amplification situation；Wherein M:Marker
(DL2000), 1-3: Chelonus DNA, 4-6: Chelonus cDNA, 7-8: blank control.
Fig. 3: degenerate primer is to pink bollworm template amplification situation；Wherein M:Marker (DL2000), 1-7 are to be drawn using merger
The amplification situation (1-3: pink bollworm DNA, 4-6: pink bollworm cDNA, 7: blank control) of object Pg-V-F, Pg-V-R1,8-14 is benefit
With the amplification situation of degenerate primer Pg-V-F, Pg-V-R2 (1-3: pink bollworm DNA, 4-6: pink bollworm cDNA, 7: blank control)；
Fig. 4: Chelonus PL10 gene magnification specific primer screens situation；Wherein M:Marker (DL2000), 1--6:
(1-3 is Chelonus, and 4--6 is pink bollworm, and three holes are followed successively by 52 DEG C, 55 DEG C, 58 by PG-PL10-F1 and PG-PL10-R1-1
Product at DEG C, similarly hereinafter)；7--12:PG-PL10-F1 and PG-PL10-R1-2 (7-9 is Chelonus, and 10--12 is pink bollworm)；
13--18:PG-PL10-F2 and PG-PL10-R2-1 (13-15 is Chelonus, and 16--18 is pink bollworm) 19--24:PG-
PL10-F2 and PG-PL10-R2-2 (19-21 is Chelonus, and 22--24 is pink bollworm).
Fig. 5: (pink bollworm ovum Action gene magnification situation) is detected to the pink bollworm ovum of Chelonus parasitism processing；
Wherein M:Marker (DL2000), 1-4: the single head pink bollworm ovum of Chelonus parasitism, 5-8: the not parasitic single head of Chelonus
Pink bollworm ovum, 9: blank control.
Fig. 6: specific primer PG-PL10-F2 and PG-PL10-R2-1 to pink bollworm ovum PL10 gene magnification situation；Wherein
M:Marker (DL2000), 1-4: the single head pink bollworm ovum of Chelonus parasitism, 5-8: the not parasitic red bell of single head of Chelonus
Worm's ovum, 9: blank control.
Fig. 7: specific primer PG-PL10-F2 and PG-PL10-R2-2 to pink bollworm ovum PL10 gene magnification situation；Wherein
M:Marker (DL2000), 1-4: the single head pink bollworm ovum of Chelonus parasitism, 5-8: the not parasitic red bell of single head of Chelonus
Worm's ovum, 9: blank control.
Specific embodiment
Technical solution in order to enable those skilled in the art to better understand the present invention, in the following with reference to the drawings and specific embodiments
It further describes, advantages and features of the present invention will be more clear with the description.It should be understood that the embodiment is only
It is exemplary, any restrictions are not constituted to protection scope of the present invention.It will be understood by those skilled in the art that without departing from
Under spirit of the invention can details to technical solution and form modify or replace, but these modifications or substitutions are each fallen within
Protection scope of the present invention.
Embodiment one: Chelonus tests the Molecular Detection of pink bollworm sneak case
1, test material
Pink bollworm Pectinophora gossypiella (Saunders) picks up from Hubei Province Qianjiang in by the end of September, 2003
Indoors artificial continuously rearing is being tested so far in city cotton field.
Pink bollworm Chelonus acquired the red bell of diapause from 3 Hubei Tianmen, Hunan Anxiang, Anqing cotton regions in 2013
Worm larva finds this kind of parasitic wasp, and establishes population in laboratory.Adult is supplemented the nutrients with 5% hydromel, and enviromental conditions for spawning is
Temperature (28 ± 1) DEG C, relative humidity 60%~80%, photoperiod 13L:11D.
2, test method
2.1 use degenerate primer to pink bollworm, Chelonus DEAD-box gene magnification
2.1.1 Chelonus and pink bollworm DNA, RNA are extracted
DNA extract according to blood/tissue/cellular genome extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.,
DP304) specification carries out.
Total RNAs extraction uses TRIzol method, and extracts kit is purchased from Invitrogen.Reverse transcription refers to Promega company
Reverse Transcription System kit specification carry out.
2.1.2 Chelonus target fragment expands
According to the DEAD-box family gene cDNA sequence of the species such as the drosophila registered, the site for selecting conservative high is set
2 pairs of degenerate primers are counted, respectively Pg-V-F and Pg-V-R1, Pg-V-F and Pg-V-R2, primer sequence are shown in Table 1.
Reaction system: 2 μ L, taq enzyme 0.125 of 10 × taq buffer2.5 μ L, dNTPMix (2.5mmolL-1 each)
μ L, positive each 1 μ L of 1 μ L, DNA2 μ L or cDNA of anti-primer supplement ddH2O to 25 μ L.Reaction condition: 95 DEG C of initial denaturation 5min, 95
DEG C denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extensions 45s, circulation 35, last 72 DEG C of extensions 10min, 4 DEG C save.Amplified production
It is detected with 1.5% agarose gel electrophoresis.
Table 1:DEAD-box family gene degenerate primer
Amplification is shown:
Chelonus DNA and cDNA are expanded using primer Pg-V-F, Pg-V-R1, product is examined through gel electrophoresis
Display is surveyed, Chelonus DNA (1,2,3) cDNA (4,5,6) can amplify expected purpose band, and clip size is almost the same
(400bp or so) (Fig. 1).
Equally, Chelonus DNA and cDNA are expanded using primer Pg-V-F and Pg-V-R2, product is through gel
Electrophoresis detection shows that Chelonus DNA (1,2,3) cDNA (4,5,6) can also amplify expected purpose band, and segment is big
Small almost the same (400bp or so) (Fig. 2).
Purpose band is recycled using GelExtraction Kit gel reclaims kit, purified product connects T-
Easy cloning vector is transferred to Dh5 α competent cell, is applied to the LB solid medium containing Amp+ resistance and cultivates overnight.Picking
White single colonie is put into the LB liquid medium containing Amp+ resistance, 37 DEG C, and 200r/min cultivates 12h.Bacterium solution is carried out again
PCR verifying, will test the sample containing purpose band and Sangon Biotech (Shanghai) Co., Ltd. is sent to be sequenced.
It is same using the BLASTx program search sequence of National Center for Biotechnology Information (NCBI) according to sequencing result
Source similitude, result are as follows:
Sequencing result 1:(is not logged in)
Comparing analysis is ATP-dependent RNA helicase PLl0 gene, clip size 398bp.
ATGGCATGCGCGCAAACAGGCTCAGGTAAAACAGCGGCATTTTTGGTGCCAATATTAAATCAGATTTAT
GAAAGCGGTCCACGTGCACCTCCACCACAAGCTGGTAGTGGAAGACGCAAACAATACCCTTTGGGCTTAGTTTTAGC
TCCAACACGAGAATTAGCAACACAAATCTACGATGAAGCACGTAAATTTGCTTATCGATCTCGTATGCGACCTGCAG
TTGTCTATGGTGGATCAAATATTGCCGATCAAATGCGTGAACTTGATCGTGGATGTCATTTATTGGTTGCTACACCT
GGTCGACTTGTGGATATGCTTGGCCGTGGTAAAATAGGACTACACAATTGTCGATTTTTAGTTCTAGATGAGGCTGA
TCGGATGTTGGATATGGGTTT
Sequencing result 2:(is not logged in)
Comparing analysis is vasa gene, clip size 383bp.
AAGCCCATGTCCAGCATACTGTCCGCCTCGTCCAGCACGAAGAAGCGAATGGACGAGAACGTGACGCGA
CCTCGATTTACGAAATCGTTAAGCCGGCCAGGAGTGGCGACCAGAATATGGCAGCCTTTCATTAGCGTATTCGCCTG
ATGGAATGACGCCGTGCCTCCGTAAGCGATGCAGATCTTCAGTATGCTCCCATGAGCAAACTTCCGGGCCTCGTTGA
AGATCTGAATAGCTAATTCTCGAGTAGGGCTGAGGATTATAACTTGCGGTTCAACACCGGATTCGTGTATGATGGCA
TCTTGAGGTTTGTCAAGAATTGTGTTGATCATAGGCACCAAAAAAGCAGCAGTTTTTCCTGATCCTGTTTGTGCGCA
GGCCAT
Sequence alignment discovery, either Chelonus DNA or cDNA, sequencing result major part are carried out to sequencing result
For sequencing result 1.This illustrates to a certain extent, with respect to vasa gene (sequencing result 2), PL10 gene (sequencing result 1) institute
Distribution and expression quantity in the tissue is relatively stable.Therefore target gene of the initial option PL10 as next step test.
2.1.3 expanding pink bollworm target gene fragment
PCR expansion is carried out to pink bollworm DNA, cDNA template respectively using degenerate primer Pg-V-F and Pg-V-R1, Pg-V-R2
Increase, the same 2.1.2 of amplification condition, product is shown in Fig. 3 through the result of detected through gel electrophoresis.
It can be found that degenerate primer Pg-V-F and Pg-V-R1 is to pink bollworm DNA (1,2,3), cDNA (4,5,6) from Fig. 3
Template can amplify expected purpose band, and clip size is about 400bp.Equally, Pg-V-F and Pg-V-R2 couples are utilized
Pink bollworm DNA (7,8,9), cDNA (10,11,12) template can also amplify expected purpose band, and clip size is about
400bp.Glue recycling is carried out to corresponding purpose band, then after connection conversion, picking purpose clone send to be sequenced in sequencing company.
Its sequencing result are as follows:
Sequencing result 3:(is not logged in)
Comparing analysis is ATP-dependent RNA helicase DDX53/DDX43, clip size 371bp.
ATGGCATGCGCACAAACAGGCACTGGTAAGACATTAGCTTTTCTTCTTCCTGCATTGATTCACATTGAA
GGGCAGACTGTCCCTCGAGATCAAAGAAAAGGTCCCACAGTGCTCATCTTGGCTCCAACAAGAGAACTGGCTTTGCA
GATTGATAAAGAAGTATCCAAATACAGTTACAGAGGAATCACTTCTGTTTGCTTGTATGGAGGAGGAGACAGGAAGG
AGCAGATTAAAGTTGTTTCCAAAGGTGTGGACATAGTCATTGCAACACCAGGAAGACTCAATGATTTAATTATGGCA
CGGCATCTTAACATAATCAACTTTTCCTACATTGTTCTTGATGAAGCAGATCGGATGTTGGACATGGGTTT
Sequencing result 4:(is not logged in)
Comparing analysis is ATP-dependent RNA helicase PLl0 gene, clip size 392bp.
ATGGCATGCGCGCAAACAGGCTCCGGGAAGACTGCCGCGTTCCTCGTCCCCATACTCAACCAGATGTAC
GAGGCTGGACCCGTTAAGCATATGGGGCCGTACAACCGACGCAAGCAGTACCCTCTGGGCTTGGTTCTAGCTCCGAC
ACGCGAACTCGCCACCCAAATTTATGACGAGGCTAGGAAATTCGCCTACCGCTCCCGTGTGCGACCCTGTGTCGTGT
ACGGCGGCTCCCCGATACATGAACAATTCCGCGAACTGGAGTGCGGGTGCCACCTGCTGGTCGCGACGCCGGGCCGG
CTCGTGGACATGCTGTCCCGCGGGCGCGTGGCGCTCGACCACTGCCGCCATCTTGTGCTCGACGAGGCCGATCGGAT
GCTAGACATGGGCTT
The screening of 2.2 Chelonus PL10 gene-specific primers
Using DNAMAN Version6, homologous ratio is carried out to Chelonus, pink bollworm PL10 nucleotide sequencing
To analysis, according to its sequence difference, Chelonus PL10 specific primer is designed using Primer 5.0.Four groups are separately designed
Specific primer PG-PL10-F1, PG-PL10-R1-1, PG-PL10-R1-2 and PG-PL10-F2, PG-PL10-R2-1, PG-
PL10-R2-2 (table 2).Chelonus, pink bollworm DNA sample are expanded respectively using the above-mentioned primer of design.
Table 2: Chelonus PL10 gene magnification specific primer
Reaction system: 2x Es Taq MasterMix (Dye) 10 μ L, positive and negative primer each 1 μ L, DNA 1 μ L, ddH2O 7μ
L.Reaction condition: 95 DEG C, initial denaturation 5min；95 DEG C, it is denaturalized 30s；Respectively at 52 DEG C, 55 DEG C, 58 DEG C, anneal 30s；72 DEG C,
Extend 30s；Circulation 35,72 DEG C of extension 10min.
Its amplified production detected through gel electrophoresis is as the result is shown:
Utilize PG-PL10-F1 and PG-PL10-R1-1, PG-PL10-R1-2 primer and PG-PL10-F2 and PG-PL10-
R2-1, PG-PL10-R2-2 primer are shown in Fig. 4 to the electrophoretogram of Chelonus, pink bollworm DNA cloning PL10 gene respectively.From Fig. 4
In as can be seen that PG-PL10-F1 and PG-PL10-R1-1, PG-PL10-R1-2 primer pair Chelonus sample (swimming lane 1,2,3
With 7,8,9, three holes are followed successively by amplified production at 52 DEG C, 55 DEG C, 58 DEG C, similarly hereinafter) single PL10 gene piece can be amplified
Section, clip size is respectively 200bp, but pink bollworm sample (swimming lane 4,5,6 and swimming lane 10,11,12) can also be amplified and be corresponded to greatly
Small purpose band, and have non-specific amplification band, therefore the primer specificity is not strong, and the red earworm of Chelonus cannot be distinguished
DNA sample.Equally, PG-PL10-F2 and PG-PL10-R2-1, PG-PL10-R2-2 primer pair Chelonus sample (swimming lane are utilized
13,14,15 and swimming lane 19,20,21) amplified production be single band, and pink bollworm sample (swimming lane 16,17,18 and swimming lane
22,23,24) fail to amplify the purpose band of corresponding size, only a non-specific band, clip size and expected mesh
Clip size differ greatly.Illustrate that these two pair primer specificity when expanding Chelonus PL10 gene preferably, can choose
It is detected as Chelonus DNA bar code.
The pink bollworm ovum detection of 2.3 pairs of Chelonus parasitism processing
2.3.1 pink bollworm ovum DNA is extracted
Pink bollworm ovum: according to Animal Direct PCR Kit kit (Herogen biotech company, the U.S.) explanation
Book operation, the picking simple grain pink bollworm ovum parasitic and not parasitic by Chelonus draw 27ul after being crushed with sterile white pipette tips
The pink bollworm ovum suck tissue of lysate A dissolution process, suction are placed in 0.2ml PCR pipe, and 15min is handled in 95 DEG C, and 3ul is added
Solution B, vortex device mix, and -20 DEG C spare.
2.3.2 PL10 genetic test is carried out to pink bollworm ovum
Using pink bollworm Action as house-keeping gene, and ACS1 and ACR1 primer is designed according to its nucleic acid sequence.Primer feelings
Condition is specifically shown in Table 3.
Table 3: Chelonus PL10 genetic test relevant primer
2.3.3 the pink bollworm ovum of Chelonus parasitism is detected
Each 4, pink bollworm ovum of the parasitic processed pink bollworm ovum of pink bollworm Chelonus and not parasitic processing are taken at random,
DNA extraction is carried out according to 2.3.1 method.Action gene, PL10 gene magnification, amplified production are carried out to pink bollworm ovum respectively
Gel electrophoresis figure is shown in Fig. 5, Fig. 6 and Fig. 7.The testing result of Fig. 5 shows, parasitic and not parasitic pink bollworm ovum DNA extraction effect
Preferably, pink bollworm Action internal standard gene can be amplified.From fig. 6 it can be seen that specific primer PG-PL10-F2 and
Whether PG-PL10-R2-1 can distinguish pink bollworm ovum by Chelonus parasitism well, wherein be crossed by Chelonus parasitism
Pink bollworm ovum (1,2,3,4) sample can amplify expected PL10 genetic fragment, and parasitic pink bollworm ovum (5,6,7,8) is not then
Expected segment cannot be amplified.Equally, it can be seen from figure 7 that specific primer PG-PL10-F2 and PG-PL10-R2-2
Can distinguish well pink bollworm ovum whether by Chelonus parasitism, wherein crossed by Chelonus parasitism pink bollworm ovum (1,2,
3,4) sample can amplify expected PL10 genetic fragment, and parasitic pink bollworm ovum (5,6,7,8) cannot then not amplify pre-
The segment of phase.The PL10 gene expanded to specific primer PG-PL10-F2 and PG-PL10-R2-1, PG-PL10-R2-2 is expected
Target fragment is recycled, and is sent after connection conversion and is carried out sequence analysis in sequencing company.Sequencing result shows its genetic fragment
Size is 142bp and 234bp, and sequence is same through the BLASTx program search sequence of National Center for Biotechnology Information (NCBI)
Source similitude, result are illustrated as PL10 gene.
To sum up, this research is directed to Chelonus DEAD-box family PL10 gene, devises two couples of specific primer PG-
PL10-F2 and PG-PL10-R2-1, PG-PL10-R2-2 carry out amplification inspection to the pink bollworm ovum DNA sample of different disposal respectively
It surveys, discovery only can just amplify mesh expected from PL10 gene by the parasitic processed pink bollworm ovum DNA sample of Chelonus
Segment.From the point of view of the result of research, type can be carried out to pink bollworm Chelonus using the DNA bar coding of PL10 gene
Identification, and then be used to differentiate field pink bollworm ovum by Chelonus sneak case.In terms of counting egg parasitoids parasitic rate, avoid
Egg parasitoids offspring is caused to count bee situation and parasitic rate not by environmental influences such as vector self-condition, foods
The case where symbol, occurs.This detection method has many advantages, such as convenient, fast, economic, preparation, has certain feasibility.
Sequence table
<110>Hubei Academy of Agricultural Science, Plant Protection and Soil Fertilizer Inst
<120>molecular detecting method and application of a kind of identification Chelonus to pink bollworm sneak case
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gctggtagtg gaagacgcaa ac 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ttgatccacc atagacaact gc 22
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tttaccacgg ccaagcatat 20
Claims (8)
1. a species-specific primer, which is characterized in that the specific primer include PG-PL10-F2 and PG-PL10-R2-1,
PG-PL10-R2-2, wherein the sequence of PG-PL10-F2 is as shown in SEQ ID NO:1, the sequence of PG-PL10-R2-1 such as SEQ ID
Shown in NO:2, the sequence of PL10-R2-2 is as shown in SEQ ID NO:3.
2. whether specific primer described in claim 1 is in detection pink bollworm ovum by Chelonus parasitism or/and Chelonus
Egg laying amount in application.
3. a kind of identification Chelonus is to the molecular detecting method of pink bollworm sneak case, which is characterized in that this method includes benefit
PCR amplification is carried out to pink bollworm ovum DNA with specific primer described in claim 1, obtains amplified production by detecting whether,
Judge pink bollworm ovum whether by Chelonus parasitism.
4. molecular detecting method of the identification Chelonus to pink bollworm sneak case according to claim 3, which is characterized in that
The method specifically comprises the following steps:
(1) all DNA in pink bollworm ovum tissue is extracted；
(2) using DNA obtained by step (1) as template, using specific primer described in claim 1, pcr amplification reaction is carried out；
(3) it takes PCR to react amplified production, is detected by agarose gel electrophoresis；
(4) according to whether occurring the characteristic bands of Chelonus PL10 genetic fragment in electrophoretic band, whether judge pink bollworm ovum
By Chelonus parasitism.
5. according to the identification Chelonus of claim 3 or 4 to the molecular detecting method of pink bollworm sneak case, feature exists
In the reaction condition of the PCR reaction are as follows: 95 DEG C, initial denaturation 5min；95 DEG C, it is denaturalized 30s；Respectively at 60 DEG C, anneal 30s；
72 DEG C, extend 30s；Circulation 35,72 DEG C of extension 10min.
6. according to the identification Chelonus of claim 3 or 4 to the molecular detecting method of pink bollworm sneak case, feature exists
In the reaction system of the PCR reaction: 10 × Ex taq buffer, 2.5 μ L, 2.5mM dNTPs, 2 μ L, Ex taq enzyme
1.5 1.5 μ L of μ L or cDNA of 0.125 μ L, positive anti-primer each 1 μ L, DNA, supplements ddH2O to 25 μ L.
7. a kind of identification Chelonus is to the kit of pink bollworm sneak case, which is characterized in that the kit, which contains, has the right to want
Specific primer described in asking 1.
8. kit of the identification Chelonus to pink bollworm sneak case according to claim 7, which is characterized in that the examination
Agent box further includes dNTPs, Taq archaeal dna polymerase, PCR reaction buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454516.6A CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454516.6A CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110144410A true CN110144410A (en) | 2019-08-20 |
| CN110144410B CN110144410B (en) | 2023-02-07 |
Family
ID=67593515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910454516.6A Active CN110144410B (en) | 2019-05-29 | 2019-05-29 | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110144410B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628958A (en) * | 2019-11-11 | 2019-12-31 | 苏州大学 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782579A (en) * | 2015-04-21 | 2015-07-22 | 湖北省农业科学院植保土肥研究所 | Artificial breeding method of chelonus pectinophorae cushman |
-
2019
- 2019-05-29 CN CN201910454516.6A patent/CN110144410B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104782579A (en) * | 2015-04-21 | 2015-07-22 | 湖北省农业科学院植保土肥研究所 | Artificial breeding method of chelonus pectinophorae cushman |
Non-Patent Citations (4)
| Title |
|---|
| 丛胜波等: "温度对红铃虫甲腹茧蜂生长发育与繁殖的影响", 《中国生物防治学报》 * |
| 李先奎: "棉红铃虫的产卵规律与最佳施药时间和部位的研究", 《中国棉花》 * |
| 王娜玉等: "海南桑螟寄生蜂种类及优势种的寄生特性研究", 《热带作物学报》 * |
| 许冬等: "红铃虫性信息素合成激活肽基因克隆、序列特征及在不同发育阶段的表达分析", 《中国农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628958A (en) * | 2019-11-11 | 2019-12-31 | 苏州大学 | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110144410B (en) | 2023-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Go et al. | The molecular epidemiology of iridovirus in Murray cod (Maccullochella peelii peelii) and dwarf gourami (Colisa lalia) from distant biogeographical regions suggests a link between trade in ornamental fish and emerging iridoviral diseases | |
| CN105316412B (en) | A kind of method and its dedicated kit for identifying or assisting identification pig to reach 100kg weight age in days | |
| CN110951838B (en) | Primer, probe and kit for detecting meloidogyne incognita based on RPA-LFD technology and application | |
| CN104498599B (en) | One group of microsporidian molecule universal detector primer and kit thereof | |
| CN106103715A (en) | The noncoding RNA of salmonella and qualification thereof and application | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| CN101225435A (en) | Method for quickly detecting transgenic soybean | |
| CN105803092A (en) | Transgenic alfalfa KK179-2 strain specific real-time fluorescence PCR detecting primer, probe, detecting kit and detecting method | |
| JP5522820B2 (en) | Method for detecting pathogens of strawberry important diseases and primers for detection | |
| CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN104195253A (en) | Method for detecting resistance of diamondback moth to Bt insecticidal protein Cry1Ac based on ABCC1 gene and kit thereof | |
| CN117004701B (en) | Molecular marker for sex identification of apostichopus japonicus and application | |
| CN110144410A (en) | A kind of molecular detecting method and application for identifying Chelonus to pink bollworm sneak case | |
| KR101392305B1 (en) | Multiplex primer set for simultaneous diagnosing WSSV and HPV and uses thereof | |
| CN108796106A (en) | Giardia bovis, Cryptosporidium multiple PCR detection kit and its method | |
| CN107190103A (en) | Multiple PCR primer group, kit and the method for three kinds of fishes virus are detected simultaneously | |
| CN104178577A (en) | Method and kit for detecting resistance of plutella xylostella (L.) to insecticidal protein Cry1Ac generated by Bt (bacillus thuringiensis) based on ABCC2 (ATP-binding cassette C2) gene | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN109055587A (en) | Detect kit, specific primer and probe and the application of E. CoIi content | |
| CN104498593A (en) | Primer pair and kit for identification or assisted identification of stored bean weevils | |
| CN104178575B (en) | Method and the kit of a kind of quick discriminating campylobacter fetus and venereal disease subspecies | |
| CN110468216A (en) | Digital pcr detects the primer and probe of long oyster interleukins 17-5 gene expression amount |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |