CN112522419B - Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata - Google Patents
Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata Download PDFInfo
- Publication number
- CN112522419B CN112522419B CN202011067344.6A CN202011067344A CN112522419B CN 112522419 B CN112522419 B CN 112522419B CN 202011067344 A CN202011067344 A CN 202011067344A CN 112522419 B CN112522419 B CN 112522419B
- Authority
- CN
- China
- Prior art keywords
- primer
- strain
- pcr
- strains
- mul
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a rapid PCR detection method for two strains of Brazilian cudweed and a specific COI primer used by the method. According to the method, specific primers are designed through specific sites according to two mitochondrial DNA specific sequences of the Brazilian gypsophila wasp, and finally a pair of specificity detection COI primers of the Brazilian gypsophila wasp is established. The primer pair comprises primers DWAlgdCF: 5'-TTTGGTTTAAT CTCTCAC-3', respectively; and DWlgdCR: 5'-ATGTAAAACAATATC AATTGAAGA-3' are provided. The one-step double PCR primer is a universal primer COISF, a specific primer DWAlgdCF and a specific primer DWlgdCR. The successfully established double PCR system can also have good detection effect on DNA of eggs, larvae, pupae, female imagoes and male imagoes of the amphimorphous strains of the Hyriomyza fasciatus and mixed DNA of the two strains in the same insect state as a template. The method can quickly and effectively identify one strain under the background that two strains are difficult to accurately identify from the form, greatly saves time and money and can obtain reliable results.
Description
Technical Field
The invention relates to the field of insect molecular biology identification, in particular to a dual PCR specificity detection technology for two strains of a plutella xylostella and a apis cerana.
Technical Field
In 2015, 7 months, we found a dominant parasitic wasp on pea color fly on open-air planted peas in Xinning city of Qinghai province, and compared with the traditional morphological taxonomy and molecular identification method, the dominant parasitic wasp was determined to be a new species and named as Vibrio vannamei, and the wasp was verified to have parthenogenetic Female characteristics (Female-producing parthenogenesis) and 3 host lethal (host-killing) behaviors: parasitism death, host feeding death, direct sting death (Ye et al, 2018). The field survey results show that the host species of the bees include Liriomyza trifoliae, Liriomyza sativae, L.sativa, L.huidobrensis, L.bryoniae of tomato, Coleomyza hortorum, and L.chinensis, among others, which are pests on vegetables and flowers important in China, especially the invasion of 4 species of Exopatrochezia californica (the first 4 species) seriously threaten the normal production and international trade or transport of agricultural products in China (Chen X., Lang F Y., Xu Z.H., the International. the Ocurrence of women and the third party on vehicles and trees, and the invasion of Hane in handbucho area, Hesout Na J. 527, biological, 2003,48, (5. ang J. 3. 12. about. Chen et J., III. about. Chenopodium, III. about. J. about. 7. about. Chenopodium, J. about. 9. about. Chenopodium, 7. about. The insect pest control property and application of parasitic wasps of the Brachymyia Brachypoda to the leaf miner are reported in the insect bulletin 2013(4) 427 an one 437; cheng X Q, Cao F Q, Zhang Y B, et al, Life history and life table of the host-fed parasitized Hemiparatenseus varicornis (Hymenoptera: Eulophatrae). Applied Entomology and Zoology,2017,52(2): 287-293; gao Y, Reitz S, Xing, Z, et al.A decade of a leaf inverter in China, lessons left in pest Management Science,2017,73(9) 1775-1779; ye F Y., Zhu C D., Yefremova Z., et al, Life history and biocontrol potential of the first, great-producing, and specific protocols of Diglyphus (Hymenoptera: Eulophidae) against academic indexes collectors, 2018,8(1): 3222.).
In 2017, we found an amphiprotic reproduction parasitic bee with a shape very similar to that of D.wani in Kunming city in Yunnan province, and the bee was identified by a classification expert Zoya Yefremova and is an amphiprotic line corresponding to the parthenogenetic line, but not a new species. According to our investigation, these two lines are dominant parasitic species on field vegetable leaf miner and have three host lethal behaviors: oviposition death, sting death and feeding death. In addition, parthenogenetic female parasitic wasps can produce female offspring without mating, so that compared with parasitic wasps produced by amphoterism, the parthenogenetic female parasitic wasps can save cost by half in feeding and prevention and control, and can quickly establish population in a host low-density environment, and the application of the parthenogenetic female parasitic wasps can become an important biocontrol agent.
The two strains of the great-scale snerias venomous apis have microscopic differences in morphology, and the rapid identification difficulty is high. On one hand, the slight morphological difference between strains is easily changed by the change of external environment, so that the phenotype which is originally identified is difficult to conform in the identification process. On the other hand, since the adult parasitic wasps are small in size, many key morphological features are difficult to distinguish between the two lines simply by microscopy. Therefore, it is very difficult for non-professional taxonomists to morphologically distinguish different strains of the smaller individual Liriomyza incertulas Germingiensis.
Disclosure of Invention
Because the shapes of the two strains of the Brazilian gypsophila vanda are similar, the result of combining the shapes and molecules is needed when determining which strain is determined at present, and the process is labor-consuming and time-consuming. The invention establishes a rapid, accurate and specific dual PCR detection primer and system for distinguishing the parthenogenetic female strain and the amphoteric strain.
During the research process, we also tried to distinguish the two strains of the Brazilian warrio vannamei by using a mitochondrial gene marker (COI gene) and a nuclear gene marker (ITS1, ITS2 and 28S). As a result, the COI gene is found to have more variation sites, so that the two lines can be better distinguished, namely ITS1 and ITS2 times. However, the method still has defects, and the method can finally determine whether the strain is the solitary female strain of the Brachymyza meretrix or the amphichrous strain through sequencing and database comparison analysis, so that the identification process is time-consuming and labor-consuming. In order to accurately judge different strains of the Brachymyza virgata, a set of rapid and accurate molecular detection method needs to be established. Therefore, the invention develops a detection method based on one-step double PCR rapid molecular recognition of mtDNA COI gene, utilizes the designed and screened specific primers to perform PCR amplification, judges the detection result according to the existence of the expected DNA band, does not need sequencing and sequence comparison, and has the advantages of strong specificity, high sensitivity, good reproducibility, stability, rapidness, simplicity and convenience and the like.
The present invention utilizes the common primers COISF (5 '-TAAGATTTGATTATT(AG) CC (TA) CC-3') (Sha Z L., Zhu C D., Murphy R W., et al. Mitochondrial graphics of a LEAfminer Parasitid, Diglyphus isaea (Hymenoptera: Eulophenae) in China biological Control,2006,38(3):0-389.) and COI2613(5'-ATTGCAAATACTGCACCTAT-3') (Chen Y., Xiao H., Fu J., et al. A. molecular graphics of eukaryotic fashion induced from DNA sequence data of 28S,18S,16S, and COI genes et al. molecular diagnostics, 300, 307 (1. M.S. 31, 307).
) Mitochondrial fragments were amplified, with a fragment size of approximately 900 bp. The COI gene sequences of multiple populations were then aligned using Mega 7.0 software (Kumar S., Stecher G., Tamura K. MEGA7: molecular Evolution genetics analysis version 7.0for bigger databases, molecular Biology and Evolution,2016,33(7): 1870-1874.). According to the difference of COI gene sequences of the Brachymyza virginiana solitary female strain and the amphichrous strain, double PCR primers are designed by adopting Primer Premier 5.0 software, parameters such as G + C content, secondary structure, mismatching, free energy and the like are analyzed, and finally, an amphichrous strain specific forward Primer DWAlgdCF and a specific downstream Primer DWlgdCR for the two strains are screened. Finally, the primers used for the one-step double PCR were COISF (Universal primer), specific primers DWAlgdCF and DWlgdCR, and the primers were sent to Beijing Optimalaceae Biotech Ltd for synthesis.
Therefore, the invention provides a specific SS-COI primer for detecting parthenogenetic female types of the Brachymyza virgata and corresponding amphoteric strains, which is characterized by comprising the following primer sequences:
DWAlgdCF: 5'-TTTGGTTTAATCTCTCAC-3', and
DWlgdCR：5’-ATGTAAAACAATATCAATTGAAGA-3’。
the invention further provides a primer combination for detecting the parthenogenetic female type of the Brachymyza virginiana and the corresponding two strains of the amphoteric strains by double PCR, which comprises a common primer COISF, a DWAlgdCF and a DWlgdCR; wherein each primer sequence is as follows:
COISF degenerate primers: 5'-TAAGATTTGATTATT(AG) CC (TA) CC-3'
DWAlgdCF: 5'-TTTGGTTTAATCTCTCAC-3', and
DWlgdCR：5’-ATGTAAAACAATATCAATTGAAGA-3’。
meanwhile, the invention provides a method for rapidly identifying two strains of the female parthenogenesis type and the corresponding amphoteric strain of the cupflies lurus vannamei by utilizing double PCR, which is characterized by comprising the steps of carrying out PCR amplification on a sample genome by using the primer combination of claim 2 and detecting an amplification product, wherein a DNA sample is amplified by PCR, if an amplification band of 800bp is a cupflies vannamei parthenogenesis strain, and if an amplification band of 354bp is an amphoteric strain of the cupflies vannamei.
The invention further provides a method for identifying the plutella xylostella wasps, which comprises the steps of carrying out PCR amplification on a sample genome by using the primer combination and detecting an amplification product, wherein the DNA sample is amplified by PCR, and the amplification band is 800bp or 354bp, namely the plutella xylostella wasps, or the amplification band is not the plutella xylostella wasps.
Preferably, the PCR reaction system is as follows: based on 25. mu.L of the amplification system, the addition ratio (10. mu.M) of 10 XPCR Buffer (containing Mg2+) 2.5. mu. L, dNTPs (10mM) 1. mu. L, COISF/DWAlgdCF/DWlgdCR was 0.5/0.5/1. mu.L, 0.2. mu.L of Taq polymerase (2.5U/. mu.L), 1.0. mu.L of template DNA, and 25. mu.L of ultrapure water were added.
Preferably, the PCR reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; 35 cycles (94 ℃ 30sec, 52 ℃ 30sec, 72 ℃ 45 sec); finally, extension was carried out at 72 ℃ for 7 min.
In a specific embodiment, the step of detecting the amplification product is agarose gel electrophoresis. The sample is an egg, larva, pupa, or female adult of a parasitic peak.
In addition, the invention also provides a kit which comprises the primer combination and a reagent for extracting a sample genome, wherein the kit is used for rapidly identifying two strains, namely the parthenogenetic female type and the corresponding amphoteric strain of the cupflies lurus wangesii or whether the sample is the cupflies wangesii.
The invention takes two strains of the Brazilian fly and the apis cerana as materials, adopts the Polymerase Chain Reaction (PCR) technology, and designs and screens specific primers according to specific sites among the strains after amplifying and growing segments by mitochondria universal primers COISF and COI 2613. Finally, line specific upstream primers aiming at the parthenogenetic line and the amphoteric line and specific downstream primers aiming at the two lines are successfully designed. Through a one-step multiple PCR detection program, the parthenogenetic strain can be amplified to 800bp, the amphoteric strain can be amplified to 354bp, and other parasitic wasps in the same life have no electrophoresis bands, so that the specific primers designed and used in the invention are feasible. The invention provides great convenience for non-professional classification scholars for the rapid molecular recognition of two strains of the plutella xylostella and the apis cerana, and also provides an auxiliary means for the biological prevention and control of the Chinese liriomyza pests, particularly the invasive liriomyza sativae.
Drawings
FIG. 1: amplification results with mitochondrial Universal primers COISF and COI2613
Note: m: molecular weight Standard Trans 2K TM The sizes of the bands are respectively 2000bp, 1000bp, 750bp, 500bp, 200bp and 100 bp; 1-7 are respectively Diglyhus minoeus, Ocharea scholaris Oceanus Ocharea Oceanus, Haliotica cirulus gordonus, Diglyhus isaea, Neotropha neochrysalis Formosa amphoteric strain, Neophyrocharis neochrysalis Formosa solitary strain, Diglyhus crassipes crassiensis crassivier strain; 8-11 are eggs and larvae of the Diglyhus wani parthenogenetic strain of the Scutellaria vannamei,Pupa and female adult; 12-16 are eggs, larvae, pupae, female imagoes and male imagoes of the Diglyphus wani amphiprotic strain of the wallichia myrioris.
FIG. 2: optimization of concentration proportioning condition of specific primers of apis vannamei
Note: molecular weight Standard Trans 2K TM The sizes of the bands are respectively 2000bp, 1000bp, 750bp, 500bp, 200bp and 100 bp; 1-11 is the addition ratio of COISF/DWAlgdCF/DWlgdCR: 0/1/1, 0.1/0.9/1, 0.2/0.8/1, 0.3/0.7/1, 0.4/0.6/1, 0.5/0.5/1, 0.6/0.4/1, 0.7/0.3/1, 0.8/0.2/1, 0.9/0.1/1 and 1/0/1 mu L, wherein the DNA template is Diglyhupus wani parthenous strain of the Brazilian fly Brazil; 12-22 is the addition ratio of COISF/DWAlgdCF/DWlgdCR: 0/1/1, 0.1/0.9/1, 0.2/0.8/1,. 0.3/0.7/1, 0.4/0.6/1, 0.5/0.5/1, 0.6/0.4/1, 0.7/0.3/1, 0.8/0.2/1, 0.9/0.1/1 and 1/0/1 mu L, wherein the DNA template is a Diplyphus wanii amphi strain of the Nephila vannamei; 23: negative control (ultrapure water).
FIG. 3: optimization of annealing temperature condition of specific primer of cuprea virens
Note: molecular weight Standard Trans 2K TM The sizes of the bands are respectively 2000bp, 1000bp, 750bp, 500bp, 200bp and 100 bp; 1-10 is DNA template is Diglyhus wani parthenogenetic strain of the Brachymyza virginiana, and the annealing temperature is 44, 46, 48, 50, 52, 54, 56, 58, 62 and 64 ℃ in sequence; 12-21 is a DNA template which is a amphisarca virgifera amphoteric strain D.wani (Ar), and the annealing temperature is 44, 46, 48, 50, 52, 54, 56, 58, 62 and 64 ℃ in sequence; 11 and 22: negative control (ultrapure water).
FIG. 4: PCR amplification result of specific primers on two different insect states of Brazilian wasps
Note: m represents a 2K Marker, and the sizes of the bands are 2000bp, 1000bp, 750bp, 500bp, 200bp and 100bp respectively; 1-4 are eggs, larvae, pupae and female imagoes of the swarming wasp solitary female strain D.wani (Th) of the Pandalus pluvialis; 5-9 are eggs, larvae, pupae, female imagoes and male imagoes of the amphisarca variegata amphoteric strain D.wani (Ar); 10-14 is mixed egg DNA, mixed larva DNA, mixed pupa DNA, mixed DNA of parthenogenetic strain female worms and amphoteric strain female worms, and mixed DNA of parthenogenetic strain female worms and amphoteric strain male worms of two strains of D.wani of the larvas miner.
FIG. 5: the designed specific primers have amplification effects in parasitic wasps obtained in two strains and in the same habitat:
note: m: molecular weight Standard Trans 2K TM The sizes of the bands are respectively 2000bp, 1000bp, 750bp, 500bp, 200bp and 100 bp; 1-9 are respectively Haliotropoides cirrhosa, Ochrix basilicus Ochros Ochar, Diphyllia microphylla Diglyhus, Mineus, Diphyllia macrophylla Diglyhus, Crassinivirus, Pisum sativum Diglyhus, Anagrus microphylla Diglyhus, Anethria microphylla Diglyhus formis amphoteric strain, Anethria microphylla Neurospora formis amphoteric strain, Anethria microphylla Neglythus formis solitary strain, Angelaria myrica Diglyhus wani solitary strain, and Angelaria myrica trila Diglyhus wanii wani amphoteric strain, 10: negative control (ultrapure water).
FIG. 6: sensitivity of specific primer of gleichaea vanda
Note: m represents a 2K Marker, and the sizes of the bands are 2000bp, 1000bp, 750bp, 500bp, 200bp and 100bp respectively; 1-9 are the dilution of the template to 2 -1 、2 -2 、2 -3 、2 -4 、2 -5 、2 -6 、2 -7 、2 -8 And 2 -9 Doubling, wherein the DNA template is a brood solitary female strain D.wani of the great fly larvae; 10-18 are the dilution of the template to 2 -1 、2 -2 、2 -3 、2 -4 、2 -5 、2 -6 、、2 -7 、2 -8 And 2 -9 Doubling, wherein the DNA template is the amphisarca variegata strain D.wani; 19 is a negative control.
FIG. 7: detection of dual PCR primers on different geographical populations
Note: m represents a 2K Marker, and the sizes of the bands are 2000bp, 1000bp, 750bp, 500bp, 200bp and 100bp respectively; a and B are both double PCR amplifications of the Germinella vannamei in different geographical areas. A: 1-5 from Lasa city of autonomous region in Tibet, 6-10 from Xining city of Qinghai province, 11-14 from Shijiazhuang city of Hebei province, 15-18 from Qizihal city of Heilongjiang province, and 19-22 from Turpan city of autonomous region in Xinjiang; b: 1-8 from Kunming City, 9-15 from Guiyang City, and 16-20 from Sichang City, Yunnan province.
Detailed Description
Example 1: results of amplification of parasitic wasps by mitochondrial common primers COISF and COI2613
1) Mitochondria universal primers COISF and COI2613
The mitochondrial gene is taken as a target sequence, and the sequence of the universal primer is as follows:
COISF: 5'-TAAGATTTGATTATT(AG) CC (TA) CC-3' (SEQ ID No:1) and
COI2613：5'-ATTGCAAATACTGCACCTAT-3'(SEQ ID No:2)。
the primer was synthesized by Beijing Openkogaceae Biotechnology, Inc.
2) Extraction of genome
The method for extracting the genome DNA comprises the following steps: salting out method. The method comprises the following specific steps:
(1) placing a single-headed insect source at the bottom of a 200-microliter PCR tube, burning and melting the tip of the tip by using a lighter or an alcohol lamp, then forcibly pressing the ground insect source by using the tip to form a crushed powder, and then flushing the tip twice by using 150-microliter lysis solution (50mmol/L Tris-Cl, pH7.5, 400mmol/L NaCl, 20mmol/L EDTA, 0.5% SDS);
(2) adding 5 μ L proteinase K (20mg/mL), shaking gently, mixing, and water bath at 60 deg.C for 1 hr or more (taking out the middle, shaking and mixing for 1 time);
(3) adding 80 μ L of 5M NaCl, shaking vigorously to mix well, centrifuging at 14000rpm at 4 deg.C for 10min to precipitate protein, and transferring supernatant to another centrifuge tube;
(4) adding 440 μ L of precooled anhydrous ethanol, gently mixing, and standing at-20 deg.C for 30min or more;
(5) centrifuging at 14000rpm at 4 ℃ for 12min, and removing the supernatant; adding 440 μ L of precooled 75% ethanol for washing, centrifuging at 14000rpm at 4 ℃ for 10min, and removing the supernatant;
(6) after drying at room temperature or in a 37 ℃ oven, 30. mu.L of ddH2O were dissolved, and the concentration of template was measured, labeled on the tube wall, and finally stored at-20 ℃ until use.
3) PCR amplification reaction system and program
The amplification system was 25. mu.L, of which 10 XPCR Buffer 2.5. mu.L (containing Mg) 2+ ) 0.4. mu.L of each of dNTPs (10mM) 0.4. mu. L, COISF and COI2613 (10. mu.M), 0.2. mu.L of Taq polymerase (2.5U/. mu.L), 1.0. mu.L of template DNA, and 25. mu.L of ultrapure water were supplemented. And (3) amplification procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles (94 ℃ 30sec, 48 ℃ 30sec, 72 ℃ 45 sec); finally, extension was carried out at 72 ℃ for 7 min.
4) Agarose gel electrophoresis detection
3-5 μ L of PCR product was separated by electrophoresis on a 1.0% agarose gel containing Gold view, and the results were examined on a gel imaging system.
The implementation result is that by utilizing the mitochondria universal primers COISF and COI2613, the gene segment of about 900bp (shown in figure 1) can be successfully amplified under different insect states of two strains of the plutella xylostella, the quadrastia microphylla, the sububes, the curtis rotundus, the quadrastia pisifolia, the bisexual strain of the funeoichneumoniae, the solitary female strain of the fuberiberi bee, the quadrastia macrophylla and the like, namely the genome template extraction effect of the parasitic bees is good, and the gene segment can be used for the next experiment.
Example 2: design of specific primers aiming at two strains of Brachymyza virgata and optimization of reaction conditions
1) Design and synthesis of specific primers of two strains of Brachymyza virgata
Mitochondrial genes of two strains of the Brachymyza virgata are taken as target sequences, sequence differences among the strains, between other parasitic wasps and between hosts are compared, and primer primer 5.0 software is adopted to design primers according to specific difference sites, wherein the sequences are as follows:
DWAlgdCF：5’-TTTGGTTTAATCTCTCAC-3’(SEQ ID No:3)
DWlgdCR：5’-ATGTAAAACAATATCAATTGAAGA-3’(SEQ ID No:4)。
general citation employs primer COISF: 5'-TAAGATTTGATTATTGCCTCC-3' is added.
The primer was synthesized by Beijing Openkogaceae Biotechnology, Inc.
Wherein, the sequence of the 800bp fragment of the myriapotheca cunea solitary-female strain of the exserous vannamei is specifically amplified (SEQ ID No: 5): primer segments are marked as underlined
TAAGATTTTGATTATTGCCTCCAAGATTAATGTTATTAATTTCTAGGATGTTTATTGGTACTGGGACAGGTACGGGGTGGACTGTTTATCCTCCTTTATCTTCAAATTTAGGTCATAGAGGGCCTTCAGTAGATTTATCAATTTTTTCTTTACATATTGCTGGTGCATCTTCGATTATAGGTTCAATTAATTTTATTAGAACTATTATTAATATAAAAAATTATAAAGTTGAAAATATTTCTTTATTTTCTTGGGCTATATTATTAACAGCAATTTTATTATTATTATCTCTTCCAGTATTAGCAGGGGCAATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCTTCAGGGGGAGGGGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTGTATATTTTAATTCTTCCTGGTTTTGGTTTAATTTCTCATATAATTTGTAATGAAAGATTGAAGAAAGAAGTATTTGGTTCAATAGGAATAATTTACGCAATAATTTCTATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATGTTTACAGTAGGAATAGATGTAGACACTCGTGCTTATTTTACGTCTGCAACTATAATTATTGCTATCCCCACTGGGATTAAGATTTTTAGATGATTAGCATCAATAAATGGGATAAAAATTAAATTTACAGTTTCAAATTTATGGTTATTAGGGTTTATTTTTTTATTTACTGTCGGGGGTTTAACAGGAATTATTTTATCTAACTCTTCAATTGATATTGTTTTACAT。
The sequence of the 354bp fragment of the amphisarca variegata amphibian strain is specifically amplified (SEQ ID No: 6): primer segments are marked as underlined
TTTGGTTTAATCTCTCACATAATTTGTAATGAAAGATTAAAAAAAGAAGTATTTGGTTCTATAGGAATAATTTATGCCATAATTTCTATTGGATTACTAGGTTTTATTGTTTGGGCTCATCACATGTTTACAGTAGGAATAGATGTAGATACTCGTGCCTATTTTACGTCTGCAACTATAATTATTGCTATTCCCACTGGGATTAAGATTTTTAGGTGATTAGCATCAATAAATGGAATAAAAATTAAATTTACAGTTTCAAATCTATGGTTATTAGGGTTTATTTTTTTATTTACTGTTGGGGGTTTAACCGGAATTATTTTATCTAATTCTTCAATTGATATTGTTTTACAT。
2) Extraction of genomes of two strains of Brachymyza virgata
The specific steps of the genomic DNA extraction method are described in example 1.
3) PCR amplification reaction system and program
In order to determine the optimal amplification conditions and the optimal reaction procedures of the primer pairs, a plurality of groups of treatments such as the addition proportion of the primer pairs and the annealing temperature of the primer pairs are sequentially set.
Optimizing different primer proportioning conditions: in a 25 mu L reaction system, the amphimorphic strain and the parthenogenetic strain of the Brachymyza virgata are respectively taken as DNA templates, and primer combinations with different proportions, namely 10 are respectively arrangedμmol·L -1 The addition ratio of the primers COISF/DWAlgdCF/DWlgdCR is respectively as follows: 0/1/1, 0.1/0.9/1, 0.2/0.8/1,. 0.3/0.7/1, 0.4/0.6/1, 0.5/0.5/1, 0.6/0.4/1, 0.7/0.3/1, 0.8/0.2/1, 0.9/0.1/1, 1/0/1 μ L, 2.5 mmol/mL - 1 dNTPs 1. mu.L, 10 XPCR Buffer 2.5. mu.L, Taq DNA polymerase 0.2. mu.L, ddH2O to 25. mu.L. Amplification conditions: 3min at 95 ℃; 30sec at 94 ℃, 45sec at 52 ℃, 45sec at 72 ℃, 34 cycles; extension at 72 ℃ for 5 min.
Optimizing annealing temperature of the primer pair: the amphibian strain of the Brachymyza haematocephala and the solitary-female strain of the Brachymyza haematocephala are respectively used as templates, and the annealing temperature gradient is 44 ℃, 46 ℃,48 ℃, 50, 52, 54, 56, 58, 60 and 62 ℃. Reaction system: DNA template 1. mu.L, 10. mu. mol. L -1 Primers COISF and DWAlgdCF 0.5. mu.L each, DWlgdCR 1. mu.L, 2.5 mmol. multidot.mL -1 dNTPs 1. mu.L, 10 XPCR Buffer 2.5. mu.L, Taq DNA polymerase 0.2. mu.L, ddH2O to 25. mu.L. Amplification conditions: 3min at 95 ℃; 30sec at 94 ℃, 45sec at 44-62 ℃, 45sec at 72 ℃ and 34 cycles; extension at 72 ℃ for 5 min.
4) Agarose gel electrophoresis detection
3-5 μ L of PCR product is separated by 1.0% agarose gel containing Gold view, and then the electrophoresis result is checked in a gel imaging system, and the optimal reaction condition of the primer pair is determined according to the amplified band.
The implementation result is that PCR amplification with an addition proportion and an annealing temperature gradient is respectively set for each primer combination by taking two strains of the Brazilian gypsophila wasp as template DNA, so as to determine the optimal amplification condition of each primer pair. By setting the addition ratio of the primer COISF/DWAlgdCF/DWlgdCR to 0.5/0.5/1, bright bands can be amplified in both the Liriomyza vannamei solitary female strain and the amphichrous strain, and the sizes of the bands are 800bp and 354bp respectively (figure 2); the brightest band was obtained by amplification with the primer annealing temperature gradient set at 52 ℃ (fig. 3). Therefore, the next validation experiment should be performed with the addition ratio of the primers COISF/DWAlgdCF/DWlgdCR being 0.5/0.5/1 and the annealing temperature at 52 ℃.
Example 3: detection of specific primers on two strains of Brachymyza virgata in different insect states and other parasitic wasps in the same habitat
In this example, two different insect forms of the Liriomyza pancrea, and parasitic wasps such as Liriomyza cunea, Docosphaera leucotricha, Ceratomyza rotundifolia, Liriomyza pisifolia, Liriomyza pomonella amphotericus, Liriomyza pomonella solitary female strain, Liriomyza megacephalica, etc. were subjected to PCR amplification.
1) Specific primers of two strains of Brazilian fly and Meristotheca wangii
The primers of example 2 were used.
2) Extraction of genome of two strains of Brachymyza virgata and other parasitic wasps
The specific steps of the genomic DNA extraction method are described in example 1.
3) PCR amplification reaction system and program
The amplification system was 25. mu.L, 10 XPCR Buffer (containing Mg) 2+ ) 2.5. mu. L, dNTPs (10mM) 1. mu. L, COISF/DWAlgdCF/DWlgdCR was added at a ratio (10. mu.M) of 0.5/0.5/1. mu.L, 0.2. mu.L of Taq polymerase (2.5U/. mu.L), 1.0. mu.L of template DNA, and 25. mu.L of ultrapure water were added.
And (3) amplification procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles (94 ℃ 30sec, 52 ℃ 30sec, 72 ℃ 45 sec); finally, extension was carried out at 72 ℃ for 7 min.
4) Agarose gel electrophoresis detection
3-5 μ L of PCR product is separated by 1.0% agarose gel containing Gold view, and then the electrophoresis result is checked in a gel imaging system, and the optimal reaction condition of the primer pair is determined according to the amplified band.
The implementation result is that the primers COISF/DWAlgdCF/DWlgdCR are used for carrying out PCR amplification on parasitic wasps such as two strains of the Brachymyza venomoea, namely different insect forms of the Brachymyza punctifolia, the Brachypodium leptospermum, the Brachypodium cyromum, the Brachypodium niveum amphoteric strain, the Brachypodium niveum solitary female strain, the Brachypodium macranthum and the like. The primers COISF/DWAlgdCF/DWlgdCR were able to specifically recognize both strains of Nephelus vannamei in different insect states, and both strains of Nephelus vannamei could be detected in the mixed template (FIG. 4). No target amplification products were found in the other 7 parasitic wasps and the negative control, and 800bp (parthenogenetic strain) and 354bp (ampholytic strain) of the Oncomelania vannamei were amplified in the 8-lane and 9-lane Nephila vannamei (FIG. 5). The result shows that the primer COISF/DWAlgdCF/DWlgdCR has better specificity and can specifically detect two strains of the Brachymyza vannamei.
Example 4: determination of detection threshold of primer combination COISF/DWAlgdCF/DWlgdCR on two strains of Brachymyza virescens
1) The genome DNA extraction method comprises the following steps: see example 1 for specific procedures.
2) PCR amplification reaction system and program
From 30 mu L of template of extracted two Vancae strains, 1 mu L of template is respectively taken and diluted to 2 by two-fold gradient -1 、2 -2 、2 -3 、2 -4 、2 -5 、2 -6 、、2 -7 、2 -8 And 2 -9 And (4) doubling. Reaction system: DNA template 1. mu.L, 10. mu. mol. L -1 Primer COISF/DWAlgdCF/DWlgdCR (10. mu.M) addition amount is 0.5/0.5/1. mu.L, 2.5 mmol. multidot.mL -1 dNTPs 1. mu.L, 10 XPCR Buffer 2.5. mu.L, Taq DNA polymerase 0.2. mu.L, ddH 2 Make up to 25. mu.L of O.
And (3) amplification procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles (94 ℃ 30sec, 52 ℃ 30sec, 72 ℃ 45 sec); finally, extension was carried out at 72 ℃ for 7 min.
3) Agarose gel electrophoresis detection
3-5 μ L of PCR product is separated by 1.0% agarose gel containing Gold view, and then the electrophoresis result is checked in a gel imaging system, and the optimal reaction condition of the primer pair is determined according to the amplified band.
The implementation result shows that the initial concentration of the DNA template of the brood wasp parthenogerial strain of the liriomyza vannamei is 23.1 ng.mu.L -1 (A260/A280-2.067, A260/A230-1.824), the initial concentration of the amphiprotic strain DNA template is 26.8 ng. mu.L -1 (A260/A280-2.053, A260/A230-1.114), when the DNA template is gradually diluted to 2 by two-fold gradient respectively -1 、2 -2 、2 -3 、2 -4 、2 -5 、2 -6 、2 -7 、2 -8 And 2 -9 At double time, the sensitivity of the specific primer gradually decreased, and the specific primer was diluted to 2 -7 Doubling time, the target band disappearsLoss (fig. 6), indicating that the detection sensitivity of the double PCR on the swainsonus vannamei solitary female strain and the amphoteric strain is: 0.181 ng/. mu.L -1 And 0.205 ng. mu.L -1 。
Example 5: dual PCR detection of Neurospora vannamei in different geographical regions
1) And (5) insect source collection. The information is shown in table 2.
Table 2 information collected from two species of the swainsoni vanda and the vespid in different geographical areas
Note: ar represents an amphisarca wangchiana amphisarca strain; th represents the solitary female strain of the Brachymyza virgata.
2) The method for extracting the genome DNA comprises the following steps: see the procedure in example 1.
3) PCR amplification reaction system and program
Reaction system: DNA template 1. mu.L, 10. mu. mol. L -1 Primer COISF/DWAlgdCF/DWlgdCR (10. mu.M) addition amount is 0.5/0.5/1. mu.L, 2.5 mmol. multidot.mL -1 dNTPs 1. mu.L, 10 XPCR Buffer 2.5. mu.L, Taq DNA polymerase 0.2. mu.L, ddH2O to 25. mu.L.
And (3) amplification procedure: pre-denaturation at 95 ℃ for 5 min; 35 cycles (94 ℃ 30sec, 52 ℃ 30sec, 72 ℃ 45 sec); finally, extension was carried out at 72 ℃ for 7 min.
4) Agarose gel electrophoresis detection
3-5 μ L of PCR product is separated by 1.0% agarose gel containing Gold view, and then the electrophoresis result is checked in a gel imaging system, and the optimal reaction condition of the primer pair is determined according to the amplified band.
The implementation results are as follows: the optimized double PCR system is utilized to detect 8 Liriomyza cunea bees in different geographical areas, and the results show that the Liriomyza cunea bees collected from the autonomous region Lasa city of Tibet, the West Ning city of Qinghai province, the Shijiazhuang city of Hebei province, the Qiqi Hal city of Black dragon river province and the Tunu city of Xinjiang autonomous region are all parthenogenetic strains and have bright electrophoresis bands (800 bp); the Liriomyza venomosa, collected from Kunming City, Guizhou, Guiyang City, and West Chang City, Yunnan province, was an amphoteric strain with a bright electrophoretic band (354bp) (FIG. 7).
<110> institute of plant protection of Chinese academy of agricultural sciences
Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza megacephala
<160> 6
<210> 1
<211>23
<212> DNA
<400> 1
TAAGATTTGATTATT(AG)CC(TA)CC
<210> 2
<211>20
<212> DNA
<400> 2
ATTGCAAATACTGCACCTAT
<210> 3
<211>18
<212> DNA
<400> 3
TTTGGTTTAATCTCTCAC
<210> 4
<211>24
<212> DNA
<400> 4
ATGTAAAACAATATCAATTGAAGA
<210> 5
<211>800
<212> DNA
<400> 5
TAAGATTTTGATTATTGCCTCCAAGATTAATGTTATTAATTTCTAGGATGTTTATTGGTACTGGGACAGGTACGGGGTGGACTGTTTATCCTCCTTTATCTTCAAATTTAGGTCATAGAGGGCCTTCAGTAGATTTATCAATTTTTTCTTTACATATTGCTGGTGCATCTTCGATTATAGGTTCAATTAATTTTATTAGAACTATTATTAATATAAAAAATTATAAAGTTGAAAATATTTCTTTATTTTCTTGGGCTATATTATTAACAGCAATTTTATTATTATTATCTCTTCCAGTATTAGCAGGGGCAATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCTTCAGGGGGAGGGGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTGTATATTTTAATTCTTCCTGGTTTTGGTTTAATTTCTCATATAATTTGTAATGAAAGATTGAAGAAAGAAGTATTTGGTTCAATAGGAATAATTTACGCAATAATTTCTATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATGTTTACAGTAGGAATAGATGTAGACACTCGTGCTTATTTTACGTCTGCAACTATAATTATTGCTATCCCCACTGGGATTAAGATTTTTAGATGATTAGCATCAATAAATGGGATAAAAATTAAATTTACAGTTTCAAATTTATGGTTATTAGGGTTTATTTTTTTATTTACTGTCGGGGGTTTAACAGGAATTATTTTATCTAACTCTTCAATTGATATTGTTTTACAT
<210> 6
<211>354
<212> DNA
<400> 6
TTTGGTTTAATCTCTCACATAATTTGTAATGAAAGATTAAAAAAAGAAGTATTTGGTTCTATAGGAATAATTTATGCCATAATTTCTATTGGATTACTAGGTTTTATTGTTTGGGCTCATCACATGTTTACAGTAGGAATAGATGTAGATACTCGTGCCTATTTTACGTCTGCAACTATAATTATTGCTATTCCCACTGGGATTAAGATTTTTAGGTGATTAGCATCAATAAATGGAATAAAAATTAAATTTACAGTTTCAAATCTATGGTTATTAGGGTTTATTTTTTTATTTACTGTTGGGGGTTTAACCGGAATTATTTTATCTAATTCTTCAATTGATATTGTTTTACAT
Claims (6)
1. A method for rapidly identifying two strains of a brood wasp solitary female parthenogenesis female type and a corresponding amphoteric strain of the brood wasp, which is characterized by comprising the steps of carrying out PCR amplification on a sample genome by using a primer combination of double PCR and detecting an amplification product, wherein a DNA sample is amplified by PCR, if an amplification strip of 800bp is determined as the brood wasp solitary female strain of the brood wasp, and if an amplification strip of 354bp is determined as the amphoteric strain of the brood wasp solitary female type;
the nucleotide sequence of each primer of the primer combination is as follows:
COISF primer degenerate sequences: 5'-TAAGATTTGATTATT(AG) CC (TA) CC-3'
DWAlgdCF: 5'-TTTGGTTTAATCTCTCAC-3', and
DWlgdCR：5’- ATGTAAAACAATATCAATTGAAGA -3’。
2. a method for identifying a drone of miners fly, comprising a step of PCR-amplifying a genome of a sample using a primer combination of a double PCR, wherein a DNA sample is amplified by PCR, if an amplified band of 800bp or 354bp is a drone of miners fly, and if no amplified band is present, the drone is not a drone of miners fly;
the nucleotide sequence of each primer of the primer combination is as follows:
COISF primer degenerate sequences: 5'-TAAGATTTGATTATT(AG) CC (TA) CC-3'
DWAlgdCF: 5'-TTTGGTTTAATCTCTCAC-3', and
DWlgdCR：5’- ATGTAAAACAATATCAATTGAAGA -3’。
3. the method of claim 1 or 2, wherein the PCR reaction is as follows:
according to an amplification system of 25 muL, wherein Mg is contained 2+ The addition amount ratio of 10 multiplied PCR Buffer 2.5 muL, 10mM dNTPs1 muL, and COISF/DWAlgdCF/DWlgdCR which are both 10 muM is 0.5/0.5/1 muL and 2.5U/muL TaqPolymerase 0.2 muL, template DNA1.0 muL and ultrapure water are supplemented to 25 muL.
4. The method of claim 1 or 2, wherein the PCR reaction procedure is as follows:
pre-denaturation at 95 ℃ for 5 min;
35 cycles: 94 ℃ 30sec, 52 ℃ 30sec, 72 ℃ 45 sec;
finally, extension was carried out at 72 ℃ for 7 min.
5. The method of claim 1 or 2, wherein the step of detecting the amplification product is agarose gel electrophoresis.
6. The method of claim 1 or 2, wherein the sample is a parasitic peak egg, larva, pupa, or female adult.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011067344.6A CN112522419B (en) | 2020-10-06 | 2020-10-06 | Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011067344.6A CN112522419B (en) | 2020-10-06 | 2020-10-06 | Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112522419A CN112522419A (en) | 2021-03-19 |
| CN112522419B true CN112522419B (en) | 2022-09-02 |
Family
ID=74980564
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011067344.6A Active CN112522419B (en) | 2020-10-06 | 2020-10-06 | Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112522419B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146449A (en) * | 2011-01-24 | 2011-08-10 | 中国农业科学院植物保护研究所 | Specific rapid PCR (Polymerase Chain Reaction) detecting method for Liriomyza sativae Blanchard as well as SS-COI (Som Somatostatin-Cytochrome Oxidase I) primer and kit thereby |
| CN102181542A (en) * | 2011-04-08 | 2011-09-14 | 厦门出入境检验检疫局检验检疫技术中心 | Anselmella miltoni girault molecular detection primer, detection method and application thereof |
| CN103131699A (en) * | 2013-02-25 | 2013-06-05 | 中国农业科学院植物保护研究所 | Pair of tuta absoluta specific SS-COI primers, and rapid PCR detection method and kit |
| CN109706252A (en) * | 2019-03-13 | 2019-05-03 | 中国农业科学院植物保护研究所 | One step dual specificity SS-COI primer of Frankliniella occidentalis strain combines and its application |
-
2020
- 2020-10-06 CN CN202011067344.6A patent/CN112522419B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146449A (en) * | 2011-01-24 | 2011-08-10 | 中国农业科学院植物保护研究所 | Specific rapid PCR (Polymerase Chain Reaction) detecting method for Liriomyza sativae Blanchard as well as SS-COI (Som Somatostatin-Cytochrome Oxidase I) primer and kit thereby |
| CN102181542A (en) * | 2011-04-08 | 2011-09-14 | 厦门出入境检验检疫局检验检疫技术中心 | Anselmella miltoni girault molecular detection primer, detection method and application thereof |
| CN103131699A (en) * | 2013-02-25 | 2013-06-05 | 中国农业科学院植物保护研究所 | Pair of tuta absoluta specific SS-COI primers, and rapid PCR detection method and kit |
| CN109706252A (en) * | 2019-03-13 | 2019-05-03 | 中国农业科学院植物保护研究所 | One step dual specificity SS-COI primer of Frankliniella occidentalis strain combines and its application |
Non-Patent Citations (5)
| Title |
|---|
| GenBank: MF590062.1;NCBI;《NCBI GenBank》;20180303;序列信息 * |
| Mitochondrial phylogeography of a leafminer parasitoid, Diglyphus isaea (Hymenoptera: Eulophidae) in China;Sha ZL等;《Biological Control》;20061231;380-389 * |
| Morphological and molecular identification of arrhenotokous strain of Diglyphus wani (Hymenoptera,Eulophidae) found in China as a control agent against agromyzid leafminers;Su-Jie Du等;《ZooKeys》;20211117;109-126 * |
| NCBI.GenBank: MF590062.1.《NCBI GenBank》.2018, * |
| 中国新发现芙新姬小蜂孤雌产雌品系的分子鉴定及其内共生菌Ｒickettsia 的检测;杨月梅等;《昆虫学报》;20170531;582-593 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112522419A (en) | 2021-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chistiakov et al. | Microsatellites and their genomic distribution, evolution, function and applications: a review with special reference to fish genetics | |
| Bourgeois et al. | Genetic detection and quantification of Nosema apis and N. ceranae in the honey bee | |
| Hurtado et al. | Genetic and cytological evidence of hybridization between native Ruditapes decussatus and introduced Ruditapes philippinarum (Mollusca, Bivalvia, Veneridae) in NW Spain | |
| Cunha et al. | Diagnostic methods for identification of root-knot nematodes species from Brazil | |
| CN107326077A (en) | A kind of molecular labeling for differentiating spotted maigre genetic sex and its application | |
| Ferretti et al. | High dynamism for neo-sex chromosomes: satellite DNAs reveal complex evolution in a grasshopper | |
| Sharakhova et al. | Imaginal discs–a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti | |
| JP6877680B2 (en) | Method for identifying Lycodon rufozonus with growth genetic traits | |
| CN109694906B (en) | Specific molecular marker for identifying sex of eriocheir sinensis | |
| Boštjančić et al. | The Pontastacus leptodactylus (Astacidae) repeatome provides insight into genome evolution and reveals remarkable diversity of satellite DNA | |
| CN103409516B (en) | Identification method of channel catfish species | |
| CN100415884C (en) | DNA molecular marking method for researching fish genetic relation | |
| Han et al. | PCR-RFLP identification of three major Meloidogyne species in Korea | |
| Hua et al. | Inter-and intra-specific differentiation of Trichogramma (Hymenoptera: Trichogrammatidae) species using PCR–RFLP targeting COI | |
| Makkonen et al. | Genetic variation in the ribosomal internal transcribed spacers of Aphanomyces astaci Schikora from Finland | |
| CN112522419B (en) | Double PCR detection method for parthenogenetic female strain and amphoteric strain of Brachymyza virgata | |
| CN104988240B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs16287910 | |
| Moniruzzaman et al. | Development of microsatellites: a powerful genetic marker. | |
| Dutta et al. | Identification of RAPD and SCAR markers associated with yield traits in the Indian tropical tasar silkworm Antheraea mylitta drury | |
| Maya-Soriano et al. | Biobanked amphibian samples confirmed to species level using 16S rRNA DNA barcodes | |
| Thünen et al. | Epichloë scottii sp. nov., a new endophyte isolated from Melica uniflora is the missing ancestor of Epichloë disjuncta | |
| CN110144410B (en) | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application | |
| Skantar et al. | Multiple displacement amplification (MDA) of total genomic DNA from Meloidogyne spp. and comparison to crude DNA extracts in PCR of ITS1, 28S D2-D3 rDNA and Hsp90 | |
| Yarmohammadi et al. | Identification of bester hybrids (female Huso huso Linnaeus, 1758 and male sterlet Acipenser ruthenus Linnaeus, 1758) using AFLP molecular technique | |
| KR100532592B1 (en) | Detection method of DNA marker associated to average daily gain(ADG), backfat thickness(BFT) , and loin muscle area(LMA) in pig. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |