KR102629167B1 - Primer sets for diagnosing five fungi infecting Capsicum annuum and diagnostic methods using thereof - Google Patents

Abstract

Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 pair, and at least one primer pair selected from the group consisting of primer pairs represented by SEQ ID NO: 9 and SEQ ID NO: 10. Sclerotinia sclerotiorum , Pythium sp. ), Sclerotium rolfsii ( Sclerotium rolfsii ), Phytophthora capsici ( Phytophthora capsici ) and Fusarium oxysporum ( Fusarium oxysporum ), one or more pepper fungus diagnostic primer sets selected from the group consisting of; A composition for diagnosing pepper mold comprising the primer pair; A kit for diagnosing pepper mold containing the composition; and a method for diagnosing pepper mold.
The present invention isolated and identified five major types of fungi collected from various pepper samples, and designed primer pairs that can selectively and specifically bind to each of the five directly obtained pepper fungi, thereby improving the speed and accuracy of fungal diagnosis. As such, it can be useful for diagnosing pepper fungi, producing pepper disease-free seedlings, and preventing damage to peppers.

Description

Primer sets and diagnostic methods for diagnosing five types of fungi occurring in peppers {Primer sets for diagnosing five fungi infecting Capsicum annuum and diagnostic methods using thereof}

Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 pair, and at least one primer pair selected from the group consisting of primer pairs represented by SEQ ID NO: 9 and SEQ ID NO: 10. Sclerotinia sclerotiorum , Pythium sp. ), Sclerotium rolfsii ( Sclerotium rolfsii ), Phytophthora capsici ( Phytophthora capsici ) and Fusarium oxysporum ( Fusarium oxysporum ), one or more pepper fungus diagnostic primer sets selected from the group consisting of; A composition for diagnosing pepper mold comprising the primer pair; A kit for diagnosing pepper mold containing the composition; and a method for diagnosing pepper mold.

Pepper ( Capsicum annuum (L.)) is one of the important spice crops belonging to the family Solanaceae . The main producing countries of pepper include Korea, China, Mexico, Turkey, Indonesia, India, Spain, and the United States (2018 United Nations World Food and Agriculture Organization (FAO)). However, infection with various pathogenic plant microorganisms such as bacteria, molds, and viruses has a significant impact on reducing the production and quality of peppers. Accordingly, in Korea, the reality is that various pesticides are periodically sprayed on the pepper crops grown to produce high-quality peppers. Most peppers are planted in the open field around May and cultivated and produced throughout the summer, with pepper crops removed before winter. However, various microorganisms proliferate in pepper crops left in the field or in greenhouses without being removed, and many types of molds produce spores that can overwinter and survive for several years.

In Korea, various pathogenic fungal diseases are spreading due to the humid and hot summer climate. Representative fungal diseases that infect peppers include Sclerotinia sclerotiorum , which causes white mold disease, Pythium sp., which causes seedling disease, Sclerotium rolfsii , pepper blight fungus ( Phytophthora capsici ), and wilt fungus. ( Fusarium oxysporum ), etc.

Recently, due to the rapid development of next-generation sequencing (NGS) technology, it has become possible to easily secure genome and transcriptome information and identify microorganisms of various microorganisms, including fungi. In particular, accurate identification of newly isolated fungi is possible through NGS and bioinformatics analysis, and related genetic information can be easily obtained.

Accurate mold identification is very important in preventing fungal diseases. The most common way to diagnose fungal diseases is through fungal culture. In this method, DNA is extracted from mold growing on a specific medium and then PCR amplified using fungus-specific internal-transcribed-space (ITS) primers. The base sequence of the amplified PCR product is determined through cloning and Sanger-sequencing, and the newly determined ITS base sequence is compared to the existing fungal ITS database using BLAST to identify the newly identified fungal species. decide However, in the case of the method using ITS primers, it takes a lot of time to identify fungal species, and sometimes the ITS gene portion is amplified in plant hosts, making fungal diagnosis difficult. Therefore, in order to effectively diagnose mold, it is essential to develop a diagnostic method using fungal species-specific genes.

Accordingly, the inventors of the present invention isolated and identified five types of fungi from peppers collected from various regions in order to diagnose and monitor pepper-infecting fungi, furthermore, produce disease-free seedlings of peppers and prevent damage to peppers, and identify each of the five types of pepper fungi. The present invention was completed by designing a primer pair capable of selectively and specifically binding to.

One object of the present invention is Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici And to provide a set of primers for diagnosing pepper mold at least one selected from the group consisting of Fusarium oxysporum .

Another object of the present invention is to provide a composition for diagnosing pepper mold containing the above primer pair.

Another object of the present invention is to provide a kit for diagnosing pepper mold containing the above composition.

Another object of the present invention is Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , and Phytophthora capsici ) and Fusarium oxysporum ( Fusarium oxysporum ) It is to provide a method for diagnosing one or more pepper molds selected from the group consisting of.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

One aspect of the present invention for achieving the above object is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, and a primer represented by SEQ ID NO: 5 and SEQ ID NO: 6. Sclerotinia sclerotio, comprising at least one primer pair selected from the group consisting of a pair, a primer pair represented by SEQ ID NO: 7 and SEQ ID NO: 8, and a primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10. Selected from the group consisting of Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici and Fusarium oxysporum Provided is one or more primer sets for diagnosing pepper mold.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the conditions under which the primer is used, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target desired.

In the present invention, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, or May contain an intercalating agent. Additionally, primers may incorporate additional features that do not change the basic nature of the primer serving as the starting point for DNA synthesis. The primer sequence of the present invention may, if necessary, contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horse radish peroxidase (HRP), alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (e.g., biotin), etc. there is.

In the present invention, the term "pepper mold" is a general term for fungi that cause diseases that appear in peppers, such as Sclerotinia sclerotiorum , Pythium sp., and Scleroti. It may include Sclerotium rolfsii , Phytophthora capsici , and Fusarium oxysporum , but is not particularly limited thereto.

Specifically, in the present invention, five types of pepper fungi, Sclerotinia sclerotiorum , Pythium sp., and Sclerotium rolfsi, were extracted from peppers collected from various regions. rolfsii ), Phytophthora capsici, and Fusarium oxysporum were identified. Specifically, the beta-tubulin gene of the identified fungus was obtained, and a primer set for pepper fungus diagnosis was created based on this.

In the present invention, diagnosis of pepper mold refers to detection of pepper mold.

In the present invention, the primer for diagnosing pepper mold refers to a primer pair for PCR. The primer pair of the present invention includes a forward primer and a reverse primer, and specifically, the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, which can diagnose Sclerotinia sclerotiorum , pi Primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 4 for diagnosing Pythium sp., and SEQ ID NO: 5 and SEQ ID NO: 6 for diagnosing Sclerotium rolfsii A primer pair, a primer pair represented by SEQ ID NO: 7 and SEQ ID NO: 8 that can diagnose Phytophthora capsici , and SEQ ID NO: 9 and a sequence that can diagnose Fusarium oxysporum It may refer to a primer pair that can diagnose number 10. In one embodiment of the present invention, beta-tubulin gene information is secured from each of the five types of pepper fungi identified in peppers, and based on this, each fungus can be specifically and accurately diagnosed using the PCR method. A primer set that can be used was designed.

Specifically, the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2 is a primer pair capable of specifically binding to the beta-tubulin gene of Sclerotinia sclerotiorum , SEQ ID NO: 3 And the primer pair represented by SEQ ID NO: 4 is a primer pair capable of specifically binding to the beta-tubulin gene of Pythium sp., and the primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6 is a primer pair capable of binding specifically to the beta-tubulin gene of Pythium sp. It is a primer pair that can specifically bind to the beta-tubulin gene of Sclerotium rolfsii , and the primer pair represented by SEQ ID NO: 7 and SEQ ID NO: 8 is of Phytophthora capsici . It is a primer pair that can specifically bind to the beta-tubulin gene, and the primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10 specifically binds to the beta-tubulin gene of Fusarium oxysporum. It is a pair of primers that can be used.

Another aspect of the present invention for achieving the above object is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, and a primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6. Sclerotinia sclero, comprising one or more primer pairs selected from the group consisting of primer pairs, primer pairs represented by SEQ ID NO: 7 and SEQ ID NO: 8, and primer pairs represented by SEQ ID NO: 9 and SEQ ID NO: 10. From the group consisting of Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici and Fusarium oxysporum . Provided are one or more selected compositions for diagnosing pepper mold and a kit for diagnosing pepper mold containing the same.

The kit includes a reverse transcription PCR kit, polymerase chain reaction (PCR) kit, real-time polymerase chain reaction (real-time PCR) kit, and real-time polymerase chain reaction quantitative test (RQ-PCR). It may be one or more selected from the group consisting of a kit, an inverse PCR kit, and a multiplex PCR kit. Specifically, it may be a multiplex PCR kit. , but is not particularly limited thereto. When using the multiplex PCR kit, five types of pepper fungi present in a sample can be diagnosed at once even when performed under one-time PCR reaction conditions.

The compositions and kits include primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: It may include one or more primer pairs selected from the group consisting of the primer pair represented by 8 and the primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10, and a reagent for further performing an amplification reaction. For the purpose of the present invention, reagents for performing an amplification reaction in the kit may include DNA polymerase, dNTPs, Taq polymerase, and PCR buffer, and electrophoresis may be used to confirm whether or not the PCR product is amplified. Components necessary for performing electrophoresis may be additionally included in the kit of the present invention. Furthermore, if necessary, RNase inhibitors, DEPC-water, and sterilized water may be included.

Another aspect of the present invention for achieving the above object is (a) isolating pepper fungal nucleic acid from a sample; (b) amplifying a target nucleic acid using the primer pair of claim 1 using the nucleic acid isolated in step (a) as a template; And (c) detecting the target nucleic acid amplified in step (b), Sclerotinia sclerotiorum , Pythium sp., A method for diagnosing one or more pepper molds selected from the group consisting of Sclerotium rolfsii , Phytophthora capsici and Fusarium oxysporum is provided.

The sample in step (a) refers to an unknown substance for extracting nucleic acid, specifically DNA, required to confirm the presence of the pepper fungus of the present invention, such as leaves of pepper or pepper trees infected with the virus, It may include stems, roots, etc., and may also include food, natural products (e.g., water), or biological samples, but is not limited thereto.

The step (b) of amplifying the target nucleic acid includes a reverse transcription PCR kit, polymerase chain reaction (PCR) kit, real-time polymerase chain reaction (real-time PCR) kit, and real-time polymerase chain reaction. It can be performed using one or more selected from the group consisting of reaction quantitative test (RQ-PCR) kit, inverse PCR kit, and multiplex PCR, and specifically, multiplex polymerase. It can be performed using chain reaction (multiplex PCR), but is not limited to this. In one embodiment of the invention, PCR conditions are 94°C for 3 minutes, followed by 35 cycles of 94°C for 20 seconds, 60°C for 40 seconds (annealing temperature is the same for all primers), and 72°C for 40 seconds. and final extension was performed at 72°C for 5 minutes.

Detection of the target nucleic acid amplified in step (c) uses one or more methods selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, and phosphorescence measurement. It can be performed as follows, and is not particularly limited thereto. In one embodiment of the present invention, the amplified PCR product was confirmed by gel electrophoresis followed by EtBr staining, and further, the amplified PCR product was cloned in pGEM-T-Easy Vector (Promega, Wisconsin, US) and then subjected to Sanger sequencing. The sequence of the amplified PCR product was confirmed.

The present invention isolated and identified five types of fungi from peppers collected from various regions, and designed primer pairs that can selectively and specifically bind to each of the five directly obtained pepper fungi to increase the speed and accuracy of diagnosis. It can be useful for diagnosing pepper mold, producing pepper disease-free seedlings, and preventing pepper damage.

Figure 1 shows the results of confirmation of amplified PCR products obtained using DNA extracted from five types of pepper fungi, template, and designed fungus-specific primers through 1% agarose gel electrophoresis. M represents a 100 bp DNA marker, and lanes 1 to 5 are Sclerotinia sclerotiorum , Pythium sp., and Sclerotium rolfsii , respectively. , Phytophthora capsici and Fusarium oxysporum , and arrows indicate PCR products amplified from fungus-specific primers.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1: Sample collection and fungal isolation identification for pepper mold research

To identify the fungus that infects peppers, peppers showing symptoms of sclerotia, sclerotia, blight, late blight, or root rot were collected from four regions (Taean, Wanju, Miryang, and Gwangju). A total of five species of fungi were identified in the collected samples: Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici , and Fusa. Fusarium oxysporum was isolated and identified (Table 1), and the identified fungi were used for DNA extraction.

Strain number host plant Separated area mold symptoms 14-253 pepper Taean Sclerotinia sclerotiorum drop 16-306 pepper Completed Pythium sp. constriction disease 17-453 pepper Completed Sclerotium rolfsii white silk disease 18-488 pepper Miryang Phytophthora capsici plague 19-019 pepper gwangju Fusarium oxysporum root rot disease

Example 2: DNA extraction and library production

Each fungus isolated and identified from the pepper sample was cultured and maintained at 28°C on potato dextrose agar (PDA) medium, and fungal mycelia were harvested and genomic DNA was analyzed using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). was extracted. The extracted DNA was created into a library using Illumina's TruSeq DNA Library Prep Kit v2. The produced library was subjected to paired-end (100bp

Example 3: Transcriptome assembly and fungal identification

The raw sequence data obtained from each fungus was used to assemble the fungal genome using the Spades program. To identify contigs assembled for each fungus, BLAST was performed on NCBI's non-redundant (NR) protein database using the DIAMOND program. By analyzing the BLAST results using the MEGAN6 program, the exact species of the five fungi were confirmed.

Example 4: Identification of beta-tubulin gene of pepper fungus

Beta-tubulin genes were identified for each fungus using BLAST results. As a result, Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici and Fusarium oxy The beta-tubulin genes of Fusarium oxysporum were confirmed to have SEQ ID NOs: 11 to 15, respectively. The size of the beta-tubulin partial gene identified from each fungal transcript ranged from 100 bp to 1,665 bp, and BLASTN was performed on the NCBI nucleotide database with each beta-tubulin gene sequence (Table 2).

Strain number Size (bp) Description Query Cover E value Identity Accession No. 14-253 400 Sclerotinia sclerotiorum
isolate HA61 100.00% 0 99.00% MH796665.1 16-306 300 No match 17-453 200 Vanderbylia sp. CLZ-2013a voucher Dai6891 100.00% 0 100.00% KF482779.1 18-488 100 Phytophthora capsici strain DNA2086 100.00% 0 100.00% MN456840.1 19-019 1,665 Fusarium oxysporum f. sp. lycopersici 4287 99.00% 0 99.00% XM_018384790.1

As a result, Sclerotinia sclerotiorum strain 14-253 also showed high similarity to the existing Sclerotinia sclerotiorum isolate HA61 (MH796665.1) with 100% coverage and 99% identity. Pythium sp. In the case of strain 16-306, BLAST results showed no similarity to any other existing gene sequence, so it was expected to be a new fungal species belonging to the Pythium genus. For Sclerotium rolfsii strain 17-453, Vanderbylia sp. CLZ-2013a voucher Dai6891 (KF482779.1) showed 100% coverage and 100% nucleotide identity. In the case of Phytophthora capsici strain 18-488, it showed 100% coverage and 100% nucleotide identity with the existing Phytophthora capsici strain DNA2086 (MN456840.1). In the case of Fusarium oxysporum strain 19-019, it has a high coverage of 99% and 99% nucleotide identity, compared to the existing Fusarium oxysporum f. sp. It showed high similarity to lycopersici 4287 (XM_018384790.1). Considering these results, among the newly isolated and identified fungi, Pythium sp. In the case of strain 16-306, it was confirmed to be a new fungal species.

Example 5: Development of PCR primers for specific diagnosis of five types of pepper fungi

Through transcriptome analysis of five types of pepper fungi, beta-tubulin genes were identified for each fungus and gene sequences were obtained. Based on the obtained beta-tubulin gene sequence, PCR primers that could specifically diagnose each fungus were designed. For Multiplex PCR, which can diagnose five types of fungi through a single PCR reaction, various primers were designed by varying the length of the PCR product to be amplified.

PCR was performed on DNA extracted from the fungus using a template and the designed primers. Based on the PCR results, primers that amplified specifically for each fungus were finally selected.

To perform a PCR reaction, add 1 μL of DNA template, 1 μL of forward primer (10 pmol/ul), 1 μL of reverse primer (10 pmol/ul), 3 μL of 10 4 μL and 0.5 μL of EX-Taq were added, and the final volume was adjusted to 30 μL with distilled water.

For genomic DNA, DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used. PCR was performed using the Solg 2X Multiplex PCR Series (SolGent, Daejeon, Korea). Fungal PCR conditions were 94°C for 3 min, followed by 35 cycles of 94°C for 20 s, 60°C for 40 s (annealing temperature was the same for all primers), and 72°C for 40 s, followed by 72°C for 5 min. Final extension was performed.

The amplified PCR products were confirmed through electrophoresis and EtBr staining (Figure 1). As a result of PCR, each fungus-specific primer showed PCR amplicon only in the target fungus. In addition, the amplified PCR product size was Sclerotinia sclerotiorum 400 bp, Pythium sp. 300 bp, Sclerotium rolfsii 200 bp, Phytophthora Phytophthora capsici 100 bp and Fusarium oxysporum 500 bp were used to enable multiplexing. Additionally, all amplified PCR products were cloned in pGEM-T-Easy Vector (Promega, Wisconsin, US) and then Sanger sequenced to confirm the sequences of the amplified PCR products. The partial base sequence of the beta-tubulin gene amplified with fungus-specific primers is shown in SEQ ID NOs: 16 to 20.

Finally, the pepper fungus-specific primers selected based on the PCR results are shown in Table 3 below.

mold primer name 5'-primer sequence-3' PCR product size sequence number Sclerotinia sclerotiorum 14-253-tub-F4 ACACTGAGGTGCTGAGCTT 400 One 14-253-tub-R4 CAGGTGGTAACACCGGACA 2 Pythium sp. 16-306-tub-F3 ATGCCCCACAGACTTGGTTA 300 3 16-306-tub-R3 GTCCACAATCGCTTGGATTC 4 Sclerotium rolfsii 17-453-tub-F12 AGGAGGTCGAAGAGCAGATG 200 5 17-453-tub-R12 CTTGAACATGGCCGTGAACT 6 Phytophthora capsici 18-488-tub-F4 CTCTTCCGTCCCGACAACT 600 7 18-488-tub-R4 GCACCGAGTCAATAAGCTCAG 8 Fusarium oxysporum 19-019-tub-F4 TGACAAGCCATGTGCTATCC 500 9 19-019-tub-R4 GATGACAGGCTCTGATTTTCG 10

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

<110> Seoul National University R&DB Foundation <120> Primer sets for diagnosing five fungi infecting Capsicum annuum and diagnostic methods using it <130> KPA2021-202 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 14-253-tub-F4 <400> 1 acactgaggg tgctgagctt 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 14-253-tub-R4 <400> 2 caggtggtaa caccggaca 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16-306-tub-F3 <400> 3 atgccccaca gacttggtta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16-306-tub-R3 <400> 4 gtccacaatc gcttggattc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 17-453-tub-F12 <400> 5 aggaggtcga agagcagatg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 17-453-tub-R12 <400> 6 cttgaacatg gccgtgaact 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 18-488-tub-F4 <400> 7 ctcttccgtc ccgacaact 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 18-488-tub-R4 <400> 8 gcaccgagtc aataagctca g 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-019-tub-F4 <400> 9 tgacaagcca tgtgctatcc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 19-019-tub-R4 <400> 10 gatgacaggc tctgattttc g 21 <210> 11 <211> 400 <212> DNA <213> Unknown <220> <223> Sclerotinia sclerotiorum_14-253_beta-tubulin <400> 11 acactgaggg tgctgagctt gtcgaccaag ttcttgatgt cgttcgtcgt gaggctgagg 60 gctgtgactg ccttcaaggt ttccaaatca cccactctct cggtggtgga actggtgccg 120 gtatgggtac gcctttgatt tccaagatcc gtgaggagtt cccagatcgt atgatggcta 180 ccttctccgt cgtcccatcg ccaaaggttt ccgataccgt cgtcgagcca tataacgcta 240 ctctctctgt tcatcaattg gtcgagaact ctgacgagac cttctgtatc gacaacgagg 300 ctctctacga catttgcatg agaaccttga agctcagcca cccatcctac ggagatctta 360 accacttggt ctccgctgtc atgtccggtg ttaccacctg 400 <210> 12 <211> 300 <212> DNA <213> Unknown <220> <223> Pythium sp_16-306_beta-tubulin <400> 12 atgccccaca gacttggtta cgatgataat ctcccgtgtg cacgagaccg ataccacgtc 60 gccttcgcca tcaagaccga gttcccgaac agctgtctcc cattttccga ctttagcggc 120 tactgctgtg gcaaacaatg cccctgtctg cgtcattcgt gtacctgcgg aacgtgcctc 180 ctactcacct tttcgttcca cgttctttca tgaccctgtt gtgaacccac gactacgagg 240 agatggtggc gagccagatt actatgggac aatggatcgt gaatccaagc gattgtggac 300 300 <210> 13 <211> 200 <212> DNA <213> Unknown <220> <223> Sclerotium rolfsii_17-453_beta-tubulin <400> 13 aggaggtcga agagcagatg cagaacgtgc agaacaagaa ctctgcctac tttgttgagt 60 ggatccccaa caacgtgctc tcggcacagt gcgacattgc tcctcgtggt ctcaagatgg 120 ccgtcacatt catcggtaac tcgaccgcca tccaggagct cttcaagcgt gtgtcggacc 180 agttcacggc catgttcaag 200 <210> 14 <211> 100 <212> DNA <213> Unknown <220> <223> Phytophthora capsici_18-488_beta-tubulin <400> 14 ctcttccgtc ccgacaactt cgtgttcggc caaacaggcg ccggtaacaa ctgggccaag 60 ggacactaca cagagggtgc tgagcttatt gactcggtgc 100 <210> 15 <211> 1665 <212> DNA <213> Unknown <220> <223> Fusarium oxysporum_19-019_beta-tubulin <400> 15 tttttttttt acaatagtac tcttggaatt ttattcggct catacaacta tagtgtactg 60 ccactattga ggatatctta accccagaat tacaacaact acactcgaaa agaagttgca 120 ggccggctat acgacaaaca taacatagcg gccagttatt tcagcacatt gtggagcatg 180 tttactcctc gccctcaggg agctcctcct cgtactcctc ttcctcctca tcaataccag 240 catcctggta ctgctggtat tcggagacaa gatcattcat gttagactcg gcctcagtga 300 actccatctc gtccataccc tcaccagtat accaatgcaa gaaagccttg cgtcggaaca 360 tggcagtgaa ctgctcacca acacgcttga agagctcctg gatagaggtg gagtttccga 420 tgaaggtcga ggacatcgta agtcctcggg gagggatggc acaaagggct gtttggatgt 480 tgttgggaat ccattcaacg aagtaagaag agttcttgtt ctggacgttg cgcatctggt 540 cctcgacctc cttcatagcg acacggccac ggaaaatggc cgagcaggtc aggtagcgac 600 cgttgcggaa gtccgaagcg gccatcatgt tcttggggtc gaacatctgt tgggtcaact 660 caggaacgct gactgcgcgg aaagagtgag caccacggct ggtcagagga gcaaagccaa 720 ccatgaagaa gtgtaggcga gggaaaggca ccatgttgac ggcgagcttt cggaggtcgg 780 agttcagctg accggggaaa cggagacagg tggtgacacc ggacatgaca gcagaaacga 840 ggtagttgag gtcaccgtag gaggggttgg acagcttcag ggtgcgcatg cagatatcgt 900 agagggcctc gttatcgata cagaaggtct catcggagtt ctcgaccagc tggtggacgg 960 agagggtagc attgtagggc tcaacgacgg tgtcagagac cttgggggag ggaacgacgg 1020 agaaggtggc catcattcgg tcgggaaatt cctcgcggat ctttgaaatg agcagagtac 1080 ccataccggc accggtacca ccaccgagag agtgggtgat ctggaaaccc tggaggcaat 1140 cgcagccctc ggcctcacgg cggacgacgt cgaggacctg gtcgacaagt tcggcaccct 1200 cagtgtagtg gcccttggcc cagttgtttc cagcaccgga ctgaccgaaa acgaagttgt 1260 cgggacggaa gagctgaccg aagggaccag cacggacggc gtccatggta ccaggctcaa 1320 gatcgacgag gacggctcgg ggaacatact tgttgccaga ggcctcgttg aagtagacac 1380 tcatgcgctc gagctggagc tcggaggtac cgttgtagac accattgctg tcgaggccgt 1440 gctcgccaga gatggtttgc cagaaagcag caccgatttg gttaccgcac tgaccggtct 1500 ggaggtgaac aatctcacgc atgttgatga gtgtggatga atgtaatctg gaggagtaga 1560 gagaaggagg agagaaatgg gccgaagtcg tcgaagagct gaagtagacc tagctttgac 1620 ggaggaggac aagagtgggt tgggttgggt tggaaggaga ccaaa 1665 <210> 16 <211> 400 <212> DNA <213> Artificial Sequence <220> <223> 14-253-tub-400 <400> 16 acactgaggg tgctgagctt gtcgaccaag ttcttgatgt cgttcgtcgt gaggctgagg 60 gctgtgactg ccttcaaggt ttccaaatca cccactctct cggtggtgga actggtgccg 120 gtatgggtac gcctttgatt tccaagatcc gtgaggagtt cccagatcgt atgatggcta 180 ccttctccgt cgtcccatcg ccaaaggttt ccgataccgt cgtcgagcca tataacgcta 240 ctctctctgt tcatcaattg gtcgagaact ctgacgagac cttctgtatc gacaacgagg 300 ctctctacga catttgcatg agaaccttga agctcagcca cccatcctac ggagatctta 360 accacttggt ctccgctgtc atgtccggtg ttaccacctg 400 <210> 17 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> 16-306-tub-300 <400> 17 atgccccaca gacttggtta cgatgataat ctcccgtgtg cacgagaccg ataccacgtc 60 gccttcgcca tcaagaccga gttcccgaac agctgtctcc cattttccga ctttagcggc 120 tactgctgtg gcaaacaatg cccctgtctg cgtcattcgt gtacctgcgg aacgtgcctc 180 ctactcacct tttcgttcca cgttctttca tgaccctgtt gtgaacccac gactacgagg 240 agatggtggc gagccagatt actatgggac aatggatcgt gaatccaagc gattgtggac 300 300 <210> 18 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> 17-453-tub-200 <400> 18 aggaggtcga agagcagatg cagaacgtgc agaacaagaa ctctgcctac tttgttgagt 60 ggatccccaa caacgtgctc tcggcacagt gcgacattgc tcctcgtggt ctcaagatgg 120 ccgtcacatt catcggtaac tcgaccgcca tccaggagct cttcaagcgt gtgtcggacc 180 agttcacggc catgttcaag 200 <210> 19 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> 18-488-tub-100 <400> 19 ctcttccgtc ccgacaactt cgtgttcggc caaacaggcg ccggtaacaa ctgggccaag 60 ggacactaca cagagggtgc tgagcttatt gactcggtgc 100 <210> 20 <211> 500 <212> DNA <213> Artificial Sequence <220> <223> 19-019-tub-500 <400> 20 tgacaagcca tgtgctatcc gaccacaaag ttgcgataga ctaagcgtcg accttagcgg 60 ggacttcctc ctcgtcatac tcctccacgc tatagacgtc gtcgtcgatg actgcgtcct 120 gatactgctg gtactccgat accaggtcat tcatattgga ctcagcctcc gtaaactcca 180 tctcgtccat gccttctccg gtataccagt gcaagaaggc cttgcggcgg aacatagcgg 240 tgaactgctc gccaacgcgc ttaaagatct cttggatggc ggtcgagtta ccgacaaaag 300 tggacgacat cttcaacccc tgcggcggga cagagcatag actcgtctgc acgttatgg 360 gaatccattc aacaaagtaa gccgagttct tctgctgaat cttgtgcatc tggtcctcca 420 cctccttcgc agacaccttt ccgcgaaaga tagcagagca ggtcaggtag cggccgtttc 480 gaaaatcaga gcctgtcatc 500

Claims (6)

Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 pair, and a primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10,
Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici and Fusarium oxysporum ( A set of primers for diagnosing pepper mold at least one selected from the group consisting of (Fusarium oxysporum ).
Comprising the primer set of claim 1, Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici ) and Fusarium oxysporum. A composition for diagnosing one or more pepper molds selected from the group consisting of Fusarium oxysporum .
A kit for diagnosing pepper mold, comprising the composition of claim 2.
The method of claim 3, wherein the kit is a reverse transcription PCR kit, polymerase chain reaction (PCR) kit, real-time polymerase chain reaction (real-time PCR) kit, real-time polymerase chain reaction quantitative A kit for diagnosing pepper mold, characterized in that it is at least one selected from the group consisting of a test (RQ-PCR) kit, an inverse PCR kit, and a multiplex PCR kit.
(a) isolating pepper fungal nucleic acid from the sample;
(b) amplifying a target nucleic acid using the primer set of claim 1 using the nucleic acid isolated in step (a) as a template; and
(c) comprising the step of detecting the target nucleic acid amplified in step (b),
Sclerotinia sclerotiorum , Pythium sp., Sclerotium rolfsii , Phytophthora capsici and Fusarium oxysporum ( One or more pepper mold diagnosis methods selected from the group consisting of Fusarium oxysporum ).
The diagnostic method according to claim 5, wherein the step (b) amplifying the target nucleic acid is performed by multiplex polymerase chain reaction (multiplex PCR).