KR102414947B1 - Primer sets for diagnosing five fungi infecting peach and diagnostic methods using thereof - Google Patents

Abstract

Primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina ), Diaporthe helianthi ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), Phytophthora cactorum ( Phytophthora cactorum ) One or more sets of primers for diagnosis of peach fungus selected from the group consisting of; A composition for diagnosis of peach fungus comprising the primer pair; A kit for diagnosing peach fungus comprising the composition; and to a method for diagnosing peach fungus.
The present invention isolates and identifies 5 types of fungi from peach trees harvested from various regions, and it is possible to increase the accuracy of diagnosis by designing a pair of primers capable of selectively and specifically binding to each of the 5 types of directly secured peach fungi. , peach fungus diagnosis, development of disease-free peach seedlings, and prevention of damage to peach trees and fruits.

Description

Primer sets for diagnosing five fungi infecting peach and diagnostic methods using thereof}

Primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina ), Diapor the helianti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), Phytophthora cactorum ( Phytophthora cactorum ) One or more sets of primers for diagnosis of peach mold selected from the group consisting of; A composition for diagnosis of peach fungus comprising the primer pair; A kit for diagnosing peach fungus comprising the composition; and to a method for diagnosing peach fungus.

Peach ( Prunus persica (L.) Batch) is a fruit tree belonging to the family Rosaceae , The genus Prunus . Worldwide, peaches are one of the most popular stone fruits along with apricots, plums, plums, and cherries, and peach fruits are mainly consumed as fresh fruits or canned fruits. Currently, various kinds of imported fruits are imported and consumed in large quantities in Korea, replacing many fruits produced in Korea. However, in the case of peaches, it is impossible to import them due to storage difficulties, so peach fruits grown in Korea have good competitiveness in summer compared to imported fruits. Peach varieties cultivated in Korea are very diverse, and mainly produced from July to October. However, various pathogenic bacteria and pests cause a lot of economic damage to peach tree cultivation. Among them, fungal disease adversely affects not only peach yield but also peach quality, so it is necessary to develop methods to prevent or control fungal disease.

On the other hand, most peach varieties are propagated and cultivated through grafting, which is a clonal propagation method. However, peach trees are seriously infected with various pathogenic microorganisms, including viruses, bacteria, and fungi, which are characteristic of vegetatively propagated crops. In order to overcome this problem, recently, diagnostic methods for major pathogenic microorganisms have been developed centered on national research institutes including the Rural Development Administration, and disease-free peach seedlings are being developed based on the diagnostic methods for known pathogenic microorganisms. Until recently, various types of fungi that cause disease on peach trees have been identified. Representative peach infecting molds include Monilinia fructicola and M. laxa , which cause brown rot, gray mold ( Botrytis cinerea ), Alternaria spp., Aspergillus spp., Cladosporium spp. and blue mold ( Penicillium spp.) are known to frequently cause fungal diseases on peach fruits. In addition, it is known that there are mainly red mold species ( Fusarium species) in the soil of the peach orchard. Among various peach fungal diseases, M. fructicola , which causes gray spots, causes a lot of damage to peach fruit production. produce spores

Due to the recent rapid development of next-generation sequencing (NGS) technology, it has become possible to easily obtain information about the genome and transcriptome of various microorganisms, including fungi, and to identify microorganisms using it. In particular, accurate identification of newly isolated fungi is possible through NGS and bioinformatics analysis, and related genetic information can be easily obtained.

Accurate mold identification is very important in preventing fungal diseases. The most common method for diagnosing fungal diseases is through fungal culture. In this method, DNA is extracted from a mold growing in a specific medium, and then PCR amplified using a mold-specific internal-transcribed-space (ITS) primer. The amplified PCR product is sequenced through cloning and Sanger-sequencing, and the newly determined ITS sequence is compared to the existing fungal ITS database using BLAST to determine the newly identified fungal species. decide However, in the case of the method using the ITS primer, it takes a lot of time to identify the fungal species, and since the ITS gene part is sometimes amplified in the plant host, there are many difficulties in diagnosing the fungus. Therefore, in order to effectively diagnose mold, it is essential to develop a diagnostic method using fungal species-specific genes.

Accordingly, the inventors of the present invention areolate and identify 5 types of fungi from peach trees harvested from various regions in order to diagnose and monitor peach infection fungus, further develop disease-free peach seedlings, and prevent damage to peach trees and fruits, The present invention was completed by designing a primer pair capable of selectively and specifically binding to each of the five types of peach mold.

Republic of Korea Patent Publication No. 10-2020-0109767

One object of the present invention is Cytospora leucostoma ( Cytospora leucostoma ), Macrophomina phaseolina ( Macrophomina phaseolina ), Diaporte helianti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), phytope It is to provide a primer set for diagnosing one or more peach molds selected from the group consisting of Phytophthora cactorum .

Another object of the present invention is to provide a composition for diagnosis of peach fungus comprising the primer pair.

Another object of the present invention is to provide a kit for diagnosing peach fungus comprising the composition.

Another object of the present invention is Cytospora leucostoma ( Cytospora leucostoma ), Macrophomina phaseolina ( Macrophomina phaseolina ), Diaporte helianthi ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), To provide a method for diagnosing at least one peach mold selected from the group consisting of Phytophthora cactorum .

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

One aspect of the present invention for achieving the above object is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, primers represented by SEQ ID NO: 5 and SEQ ID NO: 6 Cytospora leucostoma ( Cytospora ) comprising at least one primer pair selected from the group consisting of a pair, a primer pair represented by SEQ ID NO: 7 and SEQ ID NO: 8, and a primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10 leucostoma ), Macrophomina phaseolina, Diaporthe helianthi , Monilinia fructicola , Phytophthora cactorum at least one selected from the group consisting of A primer set for diagnosing peach fungus is provided.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer and an extension product. The length and sequence of the primers should allow the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present invention, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included. In addition, the primer may incorporate additional features that do not change the basic properties of the primer to serve as the starting point of DNA synthesis. If necessary, the primer sequence of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg, horse radish peroxidase (HRP), alkaline phosphatase), radioactive isotopes (eg, ³² P), fluorescent molecules, chemical groups (eg, biotin), and the like. have.

In the present invention, the term "peach mold" is a generic term for molds that cause diseases appearing in peaches, for example, Cytospora leucostoma, Macrophomina phaseolina, Diaporte Helianti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), and Phytophthora cactorum ) It may be to include all, and the like, but is not particularly limited thereto.

Specifically, in the present invention, five types of peach fungus, Cytospora leucostoma , Macrophomina phaseolina, Diaporthe helianthi , Monilinia fructicola , and Phytophthora cactorum were identified. Specifically, the identified fungal beta-tubulin (beta-tubulin) gene was obtained and based on this, a primer set for diagnosing peach fungus was prepared.

In the present invention, for peach mold diagnosis means for peach mold detection.

In the present invention, the primer for diagnosis of peach fungus means a primer pair for PCR. The primer pair of the present invention includes a forward primer and a reverse primer, and specifically, a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 2 capable of diagnosing Cytospora leucostoma , macroformina pase Olina ( Macrophomina phaseolina ) A pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4 that can diagnose, Diaporthe helianthi ( Diaporthe helianthi ) A pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6 that can diagnose Nilinia fructicola ( Monilinia fructicola ) A pair of primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 capable of diagnosing, and Phytophthora cactorum ) capable of diagnosing SEQ ID NO: 9 and SEQ ID NO: 10 It may mean a pair of primers that can be diagnosed. In one embodiment of the present invention, beta-tubulin gene information is obtained from each of the five types of peach molds identified from the stems, leaves, and fruits of the peach tree, and based on this, each mold is obtained using a PCR method. A primer set capable of diagnosing specifically and accurately was designed.

Specifically, the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2 is a primer pair capable of specifically binding to the beta-tubulin gene of Cytospora leucostoma , SEQ ID NO: 3 and SEQ ID NO: The primer pair represented by 4 is a primer pair capable of specifically binding to the beta-tubulin gene of Macrophomina phaseolina , and the primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6 is Diaporte heli Anti ( Diaporthe helianthi ) Beta- A primer pair capable of binding specifically to the tubulin gene, and the primer pair represented by SEQ ID NO: 7 and SEQ ID NO: 8 is Monilinia fructicola ( Monilinia fructicola ) Beta-tu It is a primer pair capable of specifically binding to a bulin gene, and the primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10 is a beta-tubulin gene of Phytophthora cactorum that can specifically bind a pair of primers.

Another aspect of the present invention for achieving the above object is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina , Diaporthe helianthi , Monilinia fructicola , and Phytophthora cactorum selected from the group consisting of Provided are a composition for diagnosing at least one peach mold and a kit for diagnosing peach mold comprising the same.

The kit includes a reverse transcription-polymerase chain reaction (PCR) kit, a polymerase chain reaction (PCR) kit, a real-time PCR kit, a real-time polymerase chain reaction quantitative test (RQ-PCR) It may be at least one selected from the group consisting of a kit, an inverse PCR kit, and a multiplex PCR kit, and specifically, it may be a multiplex PCR kit. , but is not particularly limited thereto. In the case of using the multiplex PCR kit, it is possible to diagnose five types of peach mold present in a sample at once even if it is carried out under one PCR reaction condition.

The composition and kit are a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: It may include one or more primer pairs selected from the group consisting of a primer pair represented by 8 and a primer pair represented by SEQ ID NO: 9 and SEQ ID NO: 10, and a reagent for further performing an amplification reaction. For the purpose of the present invention, DNA polymerase, dNTPs, Taq polymerase and PCR buffer may be included as reagents for performing the amplification reaction in the kit, and electrophoresis to confirm whether the PCR product is amplified Components necessary for performing (electrophoresis) may be additionally included in the kit of the present invention. Furthermore, if necessary, RNase inhibitors, DEPC-water and sterile water may be included.

Another aspect of the present invention for achieving the above object is (a) isolating the peach fungal nucleic acid from the sample; (b) amplifying a target nucleic acid using the primer pair of claim 1 as a template using the nucleic acid isolated in step (a); And (c) characterized in that it comprises the step of detecting the target nucleic acid amplified in step (b), Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina ( Macrophomina phaseolina ), Diaporte heli Anti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), Phytophthora cactorum ( Phytophthora cactorum ) It provides a method for diagnosing at least one peach mold selected from the group consisting of.

The sample of step (a) refers to an unknown material for extracting nucleic acids, specifically RNA, necessary to confirm the presence of the peach fungus of the present invention, for example, leaves, stems, It may include fruits, roots, and the like, and may include, but is not limited to, food, natural products (eg, water) or biological samples.

The step of (b) amplifying the target nucleic acid is reverse transcription-polymerase chain reaction (reverse transcription PCR) kit, polymerase chain reaction (PCR) kit, real-time polymerase chain reaction (real-time PCR) kit, real-time polymerase chain It can be carried out using one or more selected from the group consisting of a reaction quantitative test (RQ-PCR) kit, an inverse PCR kit, and a multiplex PCR, specifically, a multiplex polymerase It may be performed using a multiplex PCR, but is not limited thereto. In one embodiment of the present invention, 35 cycles of PCR conditions at 94°C for 3 minutes, then at 94°C for 20 seconds, at 60°C for 40 seconds (annealing temperature is the same for all primers), and at 72°C for 40 seconds and final extension at 72° C. for 5 minutes.

The detection of the target nucleic acid amplified in step (c) uses one or more methods selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement. may be carried out, and is not particularly limited thereto. In one embodiment of the present invention, the amplified PCR product was confirmed by gel electrophoresis followed by EtBr staining, and further, the PCR product amplified in pGEM-T-Easy Vector (Promega, Wisconsin, US) was cloned and then Sanger sequencing was performed. The sequence of the amplified PCR product was confirmed.

The present invention isolates and identifies 5 types of fungi from peach trees harvested from various regions, and can increase the speed and accuracy of diagnosis by designing primer pairs that can selectively and specifically bind to each of the 5 types of directly secured peach fungi. As such, it can be usefully used to diagnose peach fungus, develop disease-free peach seedlings, and prevent damage to peach trees and fruits.

1 shows the results of confirming the amplified PCR product obtained by using the DNA, template, and designed mold-specific primers extracted from 5 kinds of peach mold through 1% agarose gel electrophoresis. M represents a 100 bp DNA marker, and lanes 1 to 5 are each Cytospora leucostoma , Macrophomina phaseolina, Diaporthe helianthi , Monillinia Fructica ( Monilinia fructicola ), and Phytophthora cactorum ( Phytophthora cactorum ) are indicated, and arrows indicate PCR products amplified from fungal-specific primers.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples only.

Example 1 Sample Collection and Fungal Isolation Identification for Peach Fungus Study

To identify the peach-infecting fungus, peach stems showing symptoms of stem blight, stem rot, gray blotch or late blight were collected from 5 regions (Gyeongbuk Sangju, Jeonbuk Jeonju, Jeonnam Jangseong, Jeonbuk Wanju and Gyeonggi Province Janghowon). In the collected samples, a total of five types of fungi Cytospora leucostoma , Macrophomina phaseolina, Diaporthe helianthi , Monilinia fructicola , and Phytophthora cactorum were isolated and identified (Table 1), and the isolated and identified fungi were used for total RNA extraction.

strain number host plant segregated area mold sickness 18-484 peach Gyeongbuk Sangju Cytospora leucostoma stem blight 19-016 peach Jeonju, Jeonbuk Macrophomina phaseolina stem rot disease 19-168 peach Jeonnam Jangseong Diaporthe helianthi stem blight 19-382 peach Jeonbuk Wanju Monillinia fructicola ashen pattern bottle 19-435 peach Gyeonggi-do Janghowon Phytophthora cactorum plague

Example 2: Total RNA extraction and library construction

Each of the five isolated and identified fungi was grown at 28 °C in potato dextrose agar (PDA) medium, and the fungal mycelia were harvested and total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). . Based on the extracted total RNA, a library was prepared using Illumina's TruSeq RNA Library Prep Kit v2. The prepared library was subjected to paired-end (100bp X 2) sequencing using Illumina's NovaSeq6000 system.

Example 3: Transcript assembly and fungal identification

Raw sequence data from each fungus was used for transcript assembly in the Trinity program. BLAST was performed using the DIAMOND program in NCBI's non-redundant (NR) protein database to identify the assembled contigs for each fungus. BLAST results were analyzed using the MEGAN6 program to confirm the exact species of 5 types of mold.

Example 4: Beta-tubulin gene identification of peach fungus

Using BLAST results, beta-tubulin genes were identified for each fungus. As a result, Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina ( Macrophomina phaseolina ), Diaporte helianti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), and Phytope Sora cactorum ( Phytophthora cactorum ) Beta-tubulin gene was confirmed to be SEQ ID NOs: 11 to 15, respectively. The size of the beta-tubulin partial gene identified from each fungal transcript was 1,672 bp to 2,427 bp, and BLASTN was performed on the NCBI nucleotide database with each beta-tubulin gene sequence (Table 2).

strain number Size (bp) Description Query Cover E value Identity Accession No. 18-484 2,427 Cytospora sp. CN-2019b strain MFLUCC 18-1226 40.00% 0 98.38% MH986791.1 19-016 1,705 Paracoccidioides brasiliensis strain Pb18 73.00% 0 77.29% XM_010759883.1 19-168 2,050 Colletotrichum scovillei strain TJNH1 65.00% 0 92.42% XM_035477032.1 19-382 1,767 Botrytis cinerea strain B05.10 99.00% 0 93.72% XM_024690731.1 19-435 1,672 Phytophthora parasitica strain INRA-310 99.00% 0 90.37% XM_008912133.1

As a result, Cytospora leucostoma showed similarity to the existing Cytospora sp. with a low coverage of 40%. Macrophomina phaseolina showed 73% coverage and 77.29% sequence identity with Paracoccidioides brasiliensis . Diaporthe helianthi showed a lower coverage of 65% than Colletotrichum scovillei . Monillinia fructicola and Phytophthora cactorum showed high sequence coverage of 99% to Botrytis cinerea and Phytophthora parasitica , respectively, but sequence identity was found to be 93.72% and 90.37%. Looking at these results, it was found that the fungus identified in this study was very different from the existing mold, and in particular, it could be confirmed that the beta-tublin gene information identified as 5 types of fungi was not present in the NCBI GenBank database at all.

Example 5: Development of PCR primers for specific diagnosis of 5 types of peach fungus

By analyzing the transcriptome of 5 types of peach mold, beta-tubulin genes were identified for each fungus and the gene sequence was obtained. Based on the obtained beta-tubulin gene sequence, PCR primers capable of specifically diagnosing each fungus were designed. For Multiplex PCR, which can diagnose 5 types of fungi through a single PCR reaction, various primers were designed by varying the length of the PCR product to be amplified.

PCR was performed on the DNA extracted from the fungus using the template and the designed primers. Based on the PCR results, primers to be amplified specifically for each fungus were finally selected.

To perform the PCR reaction, in a 50 ml PCR tube, 1 µL of DNA template, 1 µL of Forward primer (10 pmol/ul), 1 µL of Reverse primer (10 pmol/ul), 3 µL of 10 X Buffer, 3 µL of dNTP (2.5 mM) Add 4 μL, 0.5 μL of EX-Taq, and finally adjust the final volume to 30 μL with distilled water. For genomic DNA, DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used. For PCR, Solg 2X Multiplex PCR Series (SolGent, Daejeon, Korea) was used. Fungal PCR conditions were 35 cycles of 94 °C for 3 min, followed by 94 °C for 20 s, 60 °C for 40 s (annealing temperature was the same for all primers), and 72 °C for 40 s, followed by 35 cycles at 72 °C for 5 min. It was final extension (final extension).

The amplified PCR products were confirmed by EtBr staining after electrophoresis (FIG. 1). As a result of PCR, each mold-specific primer showed PCR amplification only in the target mold. In addition, the amplified PCR product size is Cytospora leucostoma 100 bp, Macrophomina phaseolina 549 bp, Diaporte helianthi 200 bp, Monilinia fructicola ( Monilinia fructicola ) 300 bp, Phytophthora cactorum ( Phytophthora cactorum ) appeared as 400 bp. After cloning all additionally amplified PCR products in pGEM-T-Easy Vector (Promega, Wisconsin, US), Sanger sequencing was performed to confirm the sequence of the amplified PCR products. The partial nucleotide sequence of the beta-tubulin gene amplified with a fungal-specific primer is shown in SEQ ID NOs: 16 to 20.

Finally, the peach mold-specific primers selected based on the PCR results are shown in Table 3 below.

mold Primer name 5'-primer sequence-3' PCR product size SEQ ID NO: Cytospora leucostoma 18-484-tub-F2 CCAAGGGTCTCAAGATGTCC 100 One 18-484-tub-R2 CGACGGAACATAGCACTGAA 2 Macrophomina phaseolina 19-016-tub-F1 ATCGCATGATGGCCTACGTTT 549 3 19-016-tub-R1 TTCGACCTCCTTTTGGAAA 4 Diaporthe helianthi 19-168-tubb-F2 TCTTTTCTCCCAGACCCAGA 200 5 19-168-tubb-R2 AGGTTGGACGACGCTATTGT 6 Monilinia fructicola 19-382-tub-F3 TTGAGTGGATCCCTAACAACG 300 7 19-382-tub-R3 GGGCCTCCTCTTCATACTCC 8 Phytophthora cactorum 19-435-tub-F3 CACGCTAGCCTTGATGTTGT 400 9 19-435-tub-R3 CACCTACGTGGACCTGAACC 10

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims to be described later and their equivalents.

<110> Seoul National University R&DB Foundation <120> Primer sets for diagnosing five fungi infecting peach and diagnostic methods using thereof <130> KPA01554 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> 18-484-tub-F2 <400> 1 ccaagggtct caagatgtcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18-484 -tub-R2 <400> 2 cgacggaaca tagcactgaa 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-016-tub-F1 <400> 3 atcgcatgat ggctacgttt 20 <210 > 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-016-tub-R1 <400> 4 ttcgacctcc tttgtggaaa 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-168-tub-F2 <400> 5 tcttttctcc cagacccaga 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-168-tub -R2 <400> 6 aggttggacg acgctattgt 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 19-382-tub-F3 <400> 7 ttgagtggat ccctaacaac g 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-382-tub-R3 <400> 8 gggcctcctc ttcatactcc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19 -435-tub-F3 <400> 9 cacgctagcc ttgatgttgt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 19-435-tub-R3 <400> 10 cacctacggt gacctgaacc 20 <210> 11 <211> 2427 <212> DNA <213> Unknown <220> <223> Cytospora leucostoma_18-484_beta-tubulin <400> 11 ccacctccag accggccaat gcggtaacca aatcggtgct gctttctggt gcgtaccagc 60 cttcgaccac ggcagcaaac gatacgcgac agtaatcatg tcgaaggatt gaaactgacc 120 ccgattaaac aggcaaacca tctctggcga gcacggtctc gacagcaatg gagtttacaa 180 cggcacttct gagctccagc tggagcgcat gaacgtctac ttcaacgagg cttccggcaa 240 caagtatgtt cctcgcgctg tcctcatcga tctcgagccc ggtaccatgg acgccgtccg 300 tgccggtcct ttcggccagc tgttccgtcc cgacaacttc gttttcggcc agtccggtgc 360 tggaaacaac tgggccaagg gtcactacac tgagggtgcg gagctggtcg accaggtcct 420 ggatgtcgtc cgtcgcgagg ctgagggttg cgactgcctg cagggcttcc agatcaccca 480 ctccctgggt ggtggtac cg gtgccggtat gggtactctg ctcatctcca agattcgcga 540 ggagttcccc gaccgcatga tggctacctt ctccgtcatg ccctctccca aggtctccga 600 caccgtcgtt gagccctaca acgccaccct ctccgtccac cagctggtcg agaactcgga 660 cgagactttc tgtatcgaca acgaggccct ctacgacatt tgcatgcgga cgctgaagct 720 gtccaacccc tcttacggtg accttaacta cctggtgtcg gctgtcatgt ccggcgtcac 780 cgtctcgctg cgtttccccg gtcagctgaa ctctgacctc cgcaagctgg ctgtgaacat 840 ggtgccgttc cctcgtctgc acttcttcat ggttggcttc gctcccctga ccagccgtgg 900 cgcccactcc ttccgcgctg tcaccgtccc tgagctcacc cagcagatgt tcgaccccaa 960 gaacatgatg gctgcgtctg acttccgtaa cggtcgctac ctgacgtgct ctgccatctt 1020 gtgagtcctc ccgcccccaa gtgtctctat ccgtgcttgt ggtgctaatt atgtttccag 1080 ccgtggcaag gtctccatga aggaggttga ggaccagatg cgcaacgtcc agagcaagaa 1140 ctcgtcctac ttcgtcgagt ggatccccaa caacgtccag accgccctct gctctattcc 1200 ccccaagggt ctcaagatgt cctcgacctt cgttggtaac tcgactgcta tccaggagct 1260 gttcaagcgt gtcggcgagc agttcagtgc tatgttccgt cgcaaggctt tcttgcattg 1320 gtacactggt gagggtatgg acgagatggagttcaccgag gctgagtcca acatgaacga 1380 tcttgtctcg gaataccagc agtaccagga tgccagcatc gacgaggagg aggaggagta 1440 cgaggaggag gctccccttg aggaggagtg aactatggtg tgattaaaaa gtgtttcccg 1500 gcggtcttga tggccaagga cctatgtcca taatttgtca ccttgggtac ccacggcact 1560 tcccgcatgt attctgcttg tgtgggttgt gtgtcacgtt tgcgtgggta gctatgcgat 1620 ccggagatgg gttctggtaa tcgattggcc gtatgaacaa agggacacaa cattgatttg 1680 aaatatacct cttgtagttg accctttacc acgaatacaa aatcggacaa agccgtccac 1740 atgatagccc caagcgtgtg tgatacaata tcagtagtaa cgatttgcca aacagaggcc 1800 aagattgtct taatccactt gcttgagtcc ataccacagg ggaccttgca ccgcctcttc 1860 tacgtaggta ttgcaggtaa tcctagggca gtgcagttga ctttgatagt cgcttgaggc 1920 tggtagtatg ttccactatc gtgatctagc ccatggcacc cacaactggt caaggagagg 1980 ctgaaaggca tcgccgactt tcagcggcag gcggccgacc agcggcgtaa actggaaatg 2040 tagattgtgc gcgaggtcac ccgagatcaa aatctcatgc tgatcagcgt atcaggcgcc 2100 tattaagcgc tatagtgact gactgactgc accgatatgt agtaggtagg taggcccagc 2160 ccaccttagg gacagattac aggcaccgaa ccggat acct actaagtcgt caggtatgta 2220 atgtgtgaat ctgtgtgggc ttcacatagg ctaagttagg tagtgtagat aagcggcaag 2280 gaggatgcgg cattgccatg cgttgatcaa taaatcctcc tagtcactca tctttccccc 2340 ttctgttata gatctgatgt aagcgctgaa ggaggtgaga ggcagcctgc gtgtcagttt 2400 tcttacggta tagtgtatgc gtgtgac 2427 <210> 12 <211> 1705 <212> DNA <213> Unknown <220> <223 > Macrophomina phaseolina_19-016_beta-tubulin <400> 12 cgtctgcaac caatttgcgc tgtccacctc acagaaccca caacagacgt gatcaattcg 60 tcacccgctg ccaatatgcg cgagattatc catgttcagg ctggccaatg tggtaaccaa 120 atcggatctg ctttctggca gacgatctgc aaagagcatg gtgtcgatag ctctggaaac 180 tacaacggca catcggatct ccaactcgag cgcatgaatg tctatttcaa tgagccttcg 240 agcaagaaat tcgtaccccg cgccgtgctc gttgatcttg aacccggcac catggatgcc 300 gttcgtgccg gcccagctgg acggctcttc cgccccgaca attttgtttt cgggcagtct 360 ggagccggaa acaactgggc aaaaggccat tacaccgaag gcgctgagct ggtggatcag 420 gttcttgatg ttgtgcgccg ggagt ccgaa ggttgcgatt c ggtt caaggt ccgaa ggttgcgatt c ggtt caaggt cc ggt ac ggctaagatt 540 cgggaagagt ttccggatcg catgatggct acgttttcgg tcatgccttc gccgaaggtg 600 tccgaggtcg ttgttgagcc ctacaatgct actctgtcga ttcatgagtt ggttgaaaat 660 gccgatgaga cgttctgcat cgacaacgag gcgctgtatg atatctgtag gcgcacgctc 720 aaactcgacc atccatcgta cggagatctc aactcgctcg tgtccaccgt catgtccggc 780 gtcaccaccg gcttccgctt tcctggccaa ctcaattcag atctccggaa actggccgtg 840 aacatggtcc cgtttcctcg tcttcacttc tttacggttg gctttgcgcc tctcacggcc 900 cgcggtggca gctcattccg caattcatcc gtgtcagact tgacgcagca actgttcgac 960 ccaaggaaca tgatggccgc cgccgacttc cggaatggca ggtacttgac gtgctcgact 1020 ttcttccgtg gcaacgtttc cacaaaggag gtcgaagatc aaatgatcaa gttgcaagac 1080 aagaactctt cctatttcgt cgaatggatt ccgaacaatt tccaaaccgc cgtgtgctcc 1140 gtccccccgc caggcttgaa aatgtctgcc acctttgttg ggaataccac ttctattcag 1200 gagctcttca agcgtgtcgg agatcagttc actgccatgt tccgccgcaa agccttcttg 1260 cattggtata ccgccgaagg aatggacgag atggaattca cggaggcaga gtccaatatg 1320 aatgatctcg tggcggagta tcagcagtac caggaggcct cgatcagcga caccgaagac1380 tacgatgagg aagctccatt ggaagaggag gaggagtgag gaagtgtacg acaaacgtta 1440 ctctgattgt ctgtcgtcat ttgttgcatc tttgagaaga caagaaccat atagcgtacc 1500 actagcgaat catcattgaa ttgcgccaac gtatcacctc attcatctcg ttgaccatga 1560 tccgtcctat gtacctattc aaacttcaaa ttgggcattt ttcgtagtag atcttgcacc 1620 tccaaggcgc gcagaattgc tccttagtat aggaagacct tagcgttact taaaaaaggc 1680 aacgcgcgat gatgctcgcc gtgcc 1705 <210> 13 <211> 2050 <212 > DNA <213> Unknown <220> <223> Diaporthe helianthi_19-168_beta-tubulin <400> 13 ctcttccgat ctttcacccc tggcacctgg cacctggcac tggcagcagc agcagctccg 60 gcacaacaga gtgaaagagg gaaagcgaag ggcctccact ccactctttt ctcccagacc 120 cagactggcc ctgccagaca atccatccca atcccaacac caccaccgtc gccgccgata 180 cccaaacctc accttctcaa tctcgctccg agctaccggc ccttcgtctt ggacctcgct 240 gctctcgttt gtctaccgcc attcttctgt ctcgacccga ctcgacaata gcgtcgtcca 300 accttcaaaa tgcgtgagat tgttcacctt cagaccggcc aatgcggtaa ccaaacccggt 360 gctgcttttct gt gtcaacca ctccagct cgagcgcatg aacgtctact tcaacgaggc ctccggcaac 480 aagtatgttc ctcgcgccgt cctcgtcgat ctcgagcccg gtaccatgga cgccgtccgt 540 gccggtccct ttggccagct cttccgcccc gacaacttcg tcttcggcca gtccggtgct 600 ggaaacaact gggccaaggg tcactacact gagggtgctg agctggtcga ccaggtcctc 660 gatgtcgtcc gtcgcgaggc tgagggctgc gactgcctcc agggcttcca gatcacccac 720 tccctgggtg gtggtactgg tgctggtatg ggtacgctgc ttatctccaa gatccgcgag 780 gagttccccg accgcatgat ggccaccttc tccgtcgtgc cctcccccaa ggtctccgac 840 accgtcgtcg agccctacaa cgccaccctg tccgtccacc agctggtcga gaactcggac 900 gagaccttct gcatcgacaa cgaggccctg tacgacatct gcatgcgtac gctcaagctg 960 tccaacccct cctacggcga cctgaactac ctggtgtcgg ctgtcatgtc cggcgtcacc 1020 gtctccctgc gtttccccgg tcagctgaac tctgacctgc gcaagctggc cgtgaacatg 1080 gtgcccttcc ctcgtctgca cttcttcatg gtcggctttg ctcccctgac cagccgtggc 1140 gcccactcct tccgcgccgt taccgttcct gagctcaccc agcagatgtt cgaccccaag 1200 aacatgatgg ctgcctctga cttccgtaac ggtcgctacc tgacgtgctc tgctatcttc 1260 cgtggaaagg tctccatgaa ggaggt cgag gaccagatgc gcaacgtcca gagcaagaac 1320 tcatcctact tcgtcgagtg gatccccaac aacgtccaga ccgccctctg ctcgatccct 1380 cccaagggcc tcaagatgtc ctctaccttc gttggtaact cgactgctat ccaggagctg 1440 ttcaagcgtg tgggtgagca gttcactgcc atgttccggc gcaaggcttt cttgcattgg 1500 tacactggtg agggtatgga cgagatggag ttcaccgagg ctgagtccaa catgaacgat 1560 ctggtctccg aataccagca gtaccaggac gcctccattg atgaggagga ggaggagtac 1620 gaggaggagg ttccccttga gggcgaggag tgaatagtgg tctgatgaga tctgctgtct 1680 ggattggttc aatgatctag gactctgcta ccgtccttaa tccgtcatca ttgtacccct 1740 gacacttctc actcatttct tgtgtgcgtg tgcgcgcgtg tgcgaatgtg tgggacgctt 1800 gaagctggtg tgaatagcta ttcgattcat gattcgggag gagcgggggt gttctggtaa 1860 ttattgaatg acagacccgg ccgatcgtcc gaagaagaga gcagagcaaa aaggggaaac 1920 attgatttta aaaatatacc tctttgtagt tgaaccctgt gcccacatcc ggcctgccag 1980 tttcgcaccc tttcatgcat acatgcaacc acgtttccat ttggaatgaa attcacagga 2040 tgattgcttc 2050 <210> 14 <211> 1767 < 212> DNA <213> Unknown <220> <223> Monillinia fructicola_19-382_beta -tubulin <400> 14 ctccactatc cacaaggaca tctcagcaat ccttaacctc ttactttctc tatctacaac 60 ctcgacttct caatatccaa actaccatac tttaacacct caacacaaga tcctaaatct 120 accttcaaaa tgcgtgagat tgttcatctt caaaccggtc aatgtggtaa ccaaattggt 180 gctgctttct ggcaaactat ctctggcgag cacggtcttg atggctctgg tgtctacaat 240 ggtacctccg acctccaact tgagcgtatg aacgtctact tcaacgaggc ttccggcaac 300 aagtatgttc cccgtgccgt tctcgtcgat ttggagccag gtaccatgga cgctgtccgt 360 gccggtcctt tcggtcaact cttccgcccc gataacttcg tcttcggtca atccggtgct 420 ggtaacaact gggctaaggg tcattacact gagggtgctg agcttgttga ccaagttctt 480 gatgttgttc gtcgtgaagc tgaaggctgt gactgccttc aaggtttcca aatcacccac 540 tctctcggtg gtggaactgg tgccggtatg ggtacgcttt tgatctccaa gatccgtgag 600 gagttccccg atcgtatgat ggctaccttt tctgtcgttc catcgccaaa ggtttccgat 660 accgttgtcg agccatataa cgctaccctc tccgttcatc aattggtaga aaactctgat 720 gaaaccttct gtatcgataa cgaggctctt tacgacatct gcatgagaac cttgaagctc 780 agcaacccat cctacggaga tcttaaccac ttggtttctg ctgtcatgtc cggtgttacc 840 acc tgtctcc gtttccctgg tcaacttaac tcagatctcc gaaagttggc tgttaacatg 900 gttccattcc cacgtctcca tttcttcatg gttggatttg ctcctttgac cagccgtggt 960 gcacactctt tccgtgctgt taccgttcca gagttgactc aacaaatgta cgaccctaag 1020 aacatgatgg ccgcttccga tttccgtaac ggtcgttact tgacctgctc tgctatcttc 1080 cgtggtaagg tttccatgaa agaggtcgag gaccaaatgc gcaatgtcca aaacaagaac 1140 tcttcttact tcgttgagtg gatccctaac aacgtccaaa ccgccctttg ctcgattcct 1200 ccacgtggtc ttaagatgtc ttccaccttc gtcggtaact cgacctctat ccaagaactc 1260 ttcaagcgtg ttggtgatca attcactgct atgttccgaa gaaaggcttt cttgcattgg 1320 tacactggtg agggtatgga cgagatggag ttcactgagg ctgagtccaa catgaacgat 1380 ttggtttccg agtaccaaca ataccaggat gcctccatct ccgagggaga ggaggagtat 1440 gaagaggagg ccccaatcga gggcgaggaa tagatgtttg attctgttcc tacttcgctt 1500 ctttgacaaa acgacgggct ggttactgat attgcattag tggcaacacg atgtcgaatc 1560 atatttatta gtagcaacgt tgataatttc tcgggtgtgg tttgttttag tctttttgtt 1620 aattaggagc gagtggtctt aagggcgtag agcgactaga catcgtcgat accctatgaa 1680 gtagttcatc ttgatggatt aagaaatcaa gacaatatta caaaactggt gtttactgca 1740 aatatacggt gatgtcaaat gtggtgg 1767 <210> 15 <211> 1672 <212> DNA <213> Unknown <220> <223> Phytophthora cactorum_19-435_beta-tubulin <400> 15 ttttttttga aaacggatga aaaaggcagg tttgcattga agttatgtgt agcaaaaagc 60 agcgggttaa gcaaggtaat atgatctctg ttctgtagat gctaagccac taacctctcg 120 ggctaaacta ctcacgaggt gcacgaaggt gatcagcaag gaggtagtaa cgactacgac 180 gggtctacat catctcgtcc atctcctcgt cctcgtcgaa ctcgccctcc tcctctgcgg 240 tggcgtcctg gtactgctgg tactcagaca ccagatcgtt catgttggac tcggcctcag 300 tgaactccat ctcatccata ccctcaccag tgtaccagtg caagaaagcc ttacgacgga 360 acattgccgt aaactgttcg gacacacgct tgaacatctc ctggatggcg gtcgagttac 420 caatgaacgt ggtgctcatc ttcagaccct tgggaggaat atcacacacg ctagccttga 480 tgttgttggg gatccactca acgaagtacg atgagttctt gttctgcacg tttagcatct 540 gttcgtcaac ctccttcgtg ctcatccgtc cgcggaacat acacgcggca gttaaatagc 600 gaccgtggcg agggtcagcg gcacagtcatca tcgaactggt caggt cggtcagcg gcacagtcatca tcgttctgt cgg gct gagatccacg cgaggtcaac ggggcgaaac 720 caatcataaa gaagtggaga cgcgggaacg ggatcaggtt cacagccaac ttacgcaggt 780 ccgagttcaa ctgaccgggg aaacgcaggc acgtcgtgat accggacatg gcagcacaca 840 ccaagtggtt caggtcaccg taggtgggcg tggtgagctt cagcgtacgg aagcaaatat 900 cgtacagggc ctcgttatcc aggcacatga cctcatcagc gttctcgaca agctggtgta 960 ccgacaacgt ggcgttgtag ggctccacga cagtgtccga caccttaggc gacgggcaca 1020 ccgagtacgt gcacatgata cggtcggggt actcctcacg aatcttcgag ataagaagcg 1080 tacccatacc ggaaccggta ccgccaccaa gcgagtgggt gatctggaaa ccctgcaggc 1140 agtcacagct ctcagcctcc ttgcggacga catcaagcac cgagtcgatc agctcagcac 1200 cctctgtata gtgtcccttg gcccagttgt taccagcgcc tgtttggccg aacacgaagt 1260 tgtccggacg gaagagctga ccgtaagggc cagcgcggac cgagtccatt gtgccaggct 1320 ccagatccat aaggatggcg cggggcacgt aacggccgcc cgtagcctcg ttgtagtaca 1380 cattgatgcg ctccagctgc aggtccgagt cgccgtggta cgagcccgtc gggtccacgc 1440 catgttcgtc agagatgacc tcccagaact tggcaccgat ctggttaccg cactgaccac 1500 cctggatgtg aacaagctct ctcatgttat ggtctgt tgc tttacgtgcg cgaagacgtc 1560 gggggttcct tcctgcagcg gctcttggct ggctgtgagg agaattcgga cttttggcga 1620 atgaaggagt cgcgttgcag gcggggcgt 100 gggacgc > 16 ccaagggtct caagatgtcc tcgaccttcg ttggtaactc gactgctatc caggagctgt 60 tcaagcgtgt cggcgagcag ttcagtgcta tgttccgtcg 100 <210> 17 <211> 549 <212> DNA <213> ggc 19ac-016-tubgat <223> Artificial Sequence <220> 49 tcggtcatgc cttcgccgaa ggtgtccgag gtcgttgttg 60 agccctacaa tgctactctg tcgattcatg agttggttga aaatgccgat gagacgttct 120 gcatcgacaa cgaggtgaga aaccccccaa ttgatgccaa atcaggcgct aattgactgc 180 caggcgctgt atgatatctg taggcgcacg ctcaaactcg accatccatc gtacggagat 240 ctcaactcgc tcgtgtccac cgtcatgtcc ggcgtcacca ccggcttccg ctttcctggc 300 caactcaatt cagatctccg gaaactggcc gtgaacatgg tcccgtttcc tcgtcttcac 360 ttctttacgg ttggctttgc gcctctcacg gcccgcggtg gcagctcatt ccgcaattca 420 tccgtgtcag acttgacgca gcaactgttc gacccaagga aca tgatggc cgccgccgac 480 ttccggaatg gcaggtactt gacgtgctcg actttcttcc gtggcaacgt ttccacaaag 540 gaggtcgaa 549 <210> 18 <211> 200 <212> DNA <213> Artificial Sequence <aga220> <223> ctcc 19-cctctttga cctt atctcaatcc caacaccacc 60 accgtcgccg ccgataccca aacctcacct tctcaatctc gctccgagct accggccctc 120 cgtcttggac ctcgctgctc tcgttttgtct accgccattc ttctgtctcg accctubc-223 <> 213cc Sequenceacc ttctgtgtctcg accctubc-212> <19gt> aca <400> 19 ttgagtggat ccctaacaac gtccaaaccg ccctttgctc gattcctcca cgtggtctta 60 agatgtcttc caccttcgtc ggtaactcga cctctatcca agaactcttc aagcgtgttg 120 gtgatcaatt cactgctatg ttccgaagaa aggctttctt gcattggtac actggtgagg 180 gtatggacga gatggagttc actgaggctg agtccaacat gaacgatttg gtttccgagt 240 accaacaata ccaggatgcc tccatctccg agggagagga ggagtatgaa gaggaggccc 300 300 <210> 20 <211> 400 <212 > DNA <213> Artificial Sequence <220> <223> 19-453-tub-400 <400> 20 cacgctagcc ttgatgttgt tggggatcca ctcaacgaag tacgatgagt tcttgttctg 60 cacgtttagc atctgttcgt caacctcctt cgtgctcatc cgtccgcgga acatacacgc 120 ggcagttaaa tagcgaccgt ggcgagggtc agcggcacac atcatgttct tagcatcgaa 180 ctgttgctgg gtcagctcag ggaccgtgag ggcacggtac tgctgagatc cacgcgaagt 240 caacggggcg aaaccaatca taaagaagtg gagacgcggg aacgggatca ggttcacagc 300 caacttacgc aggtccgagt tcaactgacc ggggaaacgc aggcacgtcg tgataccgga 360catggcagca cacaccaagt ggttcaggtc accgtaggtg 400

Claims (6)

Primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 4, primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6, primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 comprising a pair and a pair of primers represented by SEQ ID NO: 9 and SEQ ID NO: 10;
Cytospora leucostoma , Macrophomina phaseolina, Diaporthe helianthi , Monilinia fructicola , and Phytophthora cactorum ) at least one primer set for diagnosis of peach fungus selected from the group consisting of.
Claim 1 comprising the primer set, Cytospora leucostoma ( Cytospora leucostoma ) , Macrophomina phaseolina ( Macrophomina phaseolina ), Diaporte helianti ( Diaporthe helianthi ), Monilinia fructicola ( Monilinia fructicola ), Phytophthora cactorum ( Phytophthora cactorum ) At least one composition for diagnosis of peach fungus selected from the group consisting of.
A kit for diagnosing peach fungus, comprising the composition of claim 2.
According to claim 3, wherein the kit is a reverse transcription-polymerase chain reaction (reverse transcription PCR) kit, polymerase chain reaction (PCR) kit, real-time polymerase chain reaction (real-time PCR) kit, real-time polymerase chain reaction quantitative Test (RQ-PCR) kit, reverse polymerase chain reaction (inverse PCR) kit, and multiplex PCR kit, characterized in that at least one selected from the group consisting of, Peach mold diagnosis kit.
(a) isolating the peach fungal nucleic acid from the sample;
(b) amplifying a target nucleic acid using the primer set of claim 1 using the nucleic acid isolated in step (a) as a template; and
(c) characterized in that it comprises the step of detecting the target nucleic acid amplified in step (b),
Cytospora leucostoma , Macrophomina phaseolina, Diaporthe helianthi , Monilinia fructicola , Phytophthora cactorum At least one method for diagnosing peach fungus selected from the group consisting of.
The diagnostic method according to claim 5, wherein the step of (b) amplifying the target nucleic acid is performed by multiplex PCR.

Images