KR101959737B1 - Maker and kit for detection of Ilyonectria mors-panacis and method for detecting of Ilyonectria mors-panacis - Google Patents

Abstract

The present invention relates to a primer set for detecting highly pathogenic strains of ilyonectria mors-panacis. More particularly, the present invention relates to a primer set capable of detecting only highly pathogenic strains in I. radicicola species complex which is detected from conventional Panax ginseng, with high specificity and sensitivity; and a kit comprising the same; and a method for identifying highly pathogenic strains. The identification method of the present invention includes the steps of obtaining a sample DNA, obtaining a PCR product, and identifying whether the sample contains I. mors-panacis.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer set for detecting a pathogenic strain of ginseng root rot, a kit comprising the same, and a method for identifying the same,

The present invention relates to a ginseng root rot steel pathogenic strain detection primer set for, and more particularly, to only a specific, high sensitivity steel pathogenic strain of ginseng root rot Won Kyun complexes (I. radicicola species complex) to be detected in the conventional ginseng A kit comprising the primer set, and a method for identifying a strongly pathogenic strain.

Ginseng ( Panax ginseng ) is a perennial semi-silky ginseng root, which belongs to the acanthaceae family. Its optimum growth temperature is around 20 ℃. It grows or grows mainly in the Far East region of the northern hemisphere. Korea's main region is Gyeonggi region, Poongsan and Geumsan provinces. The main pharmacological component of ginseng is saponin, its consumption has been on the rise due to its excellent efficacy as nutritional supplement, immunity enhancement, fatigue recovery, central nervous system regulation, antistress, antidiabetic and antitumor activity. Consumption is expected to steadily increase as excellence is revealed.

However, in spite of the excellent efficacy and consumption desire of ginseng, ginseng is a perennial ophthalmic plant, which is a semi-oily plant. Therefore, ginseng is the most important growth limiting factor and is a low temperature plant which inhibits growth at high temperature. It is a weak plant with high light intensity. In addition, ginseng was evaluated as a plant which is difficult to cultivate because of its weak tolerance and effective control method in addition to the above-mentioned growth inhibition factors.

In addition, the plant of ginseng consists of root and head under the ground, stem, leaf, flower (fruit) on the ground, and it is a perennial, so every spring the bud emerges from the root in the ground. do. Ginseng should be cultivated for 4 ~ 6 years in the same packaging for a long time, and after the ginseng is harvested, it is cultivated again for 1 ~ 2 years without cultivation of other crops, It is a plant with a high probability of occurrence of large and continuous obstacles.

Root rottenness is one of the most common diseases caused by ginseng. Root rot is mainly caused by Ilyonectria radicicola , Fusarium solanii , solani , Rhizoctonia solani , Botryis < RTI ID = 0.0 > cinerea , Phytophthora cactorum , Pythium, sp .), Alternaria panax ) have been reported, and these pathogens are known to occur either singly or in combination.

According to recent research results from the Agricultural Research Institute of Korea, the causes of ginseng rooting for 4 years or longer are 35% for root rot, 32% for gray mold, and 15% for spotted fungus, In particular, Ilyonectria radicicola is the most effective treatment for ginseng roots because it induces a disease directly in the roots while wintering in the soil. Therefore, it is difficult to control after the planting of ginseng. In the 4-year-old, it is estimated to be the biggest enemy of ginseng production, ranging from 30 to 80%.

The initial symptom of ginseng root rot disease is reddish leaf edge or leaf inward till the symptom is shown. The roots showing such symptom form reddish brown or black brown lesion at the end or middle part, It is corrupt. Also, ginseng root rot disease is the most serious problem in Korean ginseng cultivation farms, such as from seedling ginseng to 6 years old, occurring in all the years and becoming more and more generations to high birth rate.

In recent years, however it made active research related to the identification of the pathogen that causes root rot of ginseng, most studies to diagnose both the (I. radicicola species complex) complex pathogen that causes root rot of ginseng Non-kind Specific primers. The ginseng root rot Won Kyun complexes (I. radicicola species complex) is the pathogenic situation is urgent the development of a specific primer capable of detecting only the strong strain of.

Patent Registration No. 10-0518776

Accordingly, the present invention has been made in consideration of the above-mentioned problems, and it is an object of the present invention to provide a method of isolating ginseng root rot caused by ginseng root rot disease bacteria ( Mors-panacis ) detection kit, a kit containing the same, and a method for identifying a pathogenic strain.

The present invention also relates to a composition for diagnosing ginseng roots disease, which can easily identify and diagnose ginseng root rot disease caused by ginseng root rot disease disease ( I. mors-panacis ) having high pathogenicity, and to diagnose ginseng root rot disease There are other purposes in providing diagnostic methods that can be used.

(A) separating DNA from a sample to obtain a sample DNA; (b) contacting the sample DNA obtained in the step (a) with the DNA of SEQ ID NO: 1 and 2 ( I ) obtaining a PCR product by performing a polymerase chain reaction (PCR) with a composition comprising a primer set for identification of ginseng root rot rot disease ( I. mors-panacis ), and (c) ( I. mors-panacis ) of the ginseng root rot disease disease ( I. mors-panacis ) is identified by analyzing the mors-panacis of the ginseng root rot.

According to one embodiment of the present invention, the sample may be a ginseng ( Panax ginseng ) sample.

According to another embodiment of the present invention, a primer set of ginseng root rot rot ( I. mors-panacis ) may amplify a gyroscide gene contained in a sample DNA.

According to another embodiment of the present invention, the polymerase chain reaction may be a real-time polymerase chain reaction.

In addition, the present invention provides a primer set for detecting ginseng root rot disease I. mors-panacis represented by SEQ ID NOs: 1 and 2.

According to an embodiment of the present invention, the base sequence may be one which amplifies a gyroscide gene of the ginseng root rot disease I. mors-panacis DNA.

According to another embodiment of the present invention, the gyroscide-deceased gene may include the nucleotide sequence of SEQ ID NO: 3.

Also, the present invention provides a kit for detection or quantitative analysis of ginseng root rot rotavirus disease ( I. mors-panacis ) comprising a primer set for detection of ginseng root rot disease I. mors-panacis and an amplification reagent.

According to an embodiment of the present invention, the amplification reagent may include at least one selected from the group consisting of a dNTP mixture, a DNA polymerase and a buffer solution. At this time, the dNTP mixture may include at least one selected from the group consisting of dATP, dCTP, dGTP, and dTTP.

The present invention also provides a composition for diagnosing ginseng root rot disease comprising a primer set represented by SEQ ID NOs: 1 and 2.

The present invention also relates to a method for preparing a DNA sample, comprising the steps of: (a) separating DNA from a sample to obtain a sample DNA, (b) a sample DNA obtained in step (a) and a primer set represented by SEQ ID NOs: 1 and 2 And (c) analyzing the PCR product to determine whether the ginseng roots rot disease is to be caused or to be caused by the sample. To provide a method for diagnosing ginseng root rot disease.

Hereinafter, terms of the present invention will be described.

The " xylosidase gene " of the present invention is an enzyme that encodes an enzyme that degrades a plant cell wall, and the gyrosidase expressing the gene is an enzyme that hydrolyzes plant hemicellulose, which is one of the cell wall components of plants . Gyrosidez, expressed in pathogenic bacteria, is a plant-pathogen interaction that breaks down and destroys the host cell wall to allow pathogens to penetrate into the host. Through this, gyrosidez is associated with pathogen- Directly and / or indirectly. Therefore, depending on whether the pathogen has a gyroscide-caused gene, it can be determined whether the cell wall of the plant, which is the primary line of defense against the pathogen, can be degraded or destroyed, and pathogens having the gyroside gene can be evaluated as highly pathogenic have.

Further, the "primer" of the present invention refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be duplicated and can serve as a starting point for the synthesis of a primer extension product. The primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The lengths of the sense and antisense primers can be modified based on what is known in the art and the length and sequence of the primers should be allowed to initiate the synthesis of extended products. The preferred length of the primer is 5 to 50 nucleotides. The specific length and sequence will depend on the primer usage conditions such as temperature and ionic strength as well as the complexity of the desired DNA or RNA target.

In addition, the primers may, if necessary, comprise labels that are detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of the label include, but are not limited to, enzymes such as horseradish peroxidase, alkaline phosphatase, and the like, radioactive isotopes such as 33P and the like, and chemical groups such as biotin and fluorescent molecules.

The term " real-time PCR " of the present invention is a method for simultaneously amplifying a target DNA molecule and measuring the amount thereof. For one or more specific sequences in a DNA sample, a real- It is a method that can detect and measure quantities. Weighing can count absolute number of copies or relative amount.

The " base sequence " disclosed in the present invention includes modifications using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with analogs, and modifications between nucleotides such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

Ginseng root rot steel pathogenic strains according to the invention (I. mors - panacis) detection primer set for, and a kit using the same ginseng root rot steel pathogenic strains containing the same (I. mors - panacis) identification method that found in conventional ginseng the reported ginseng root rot Won Kyun complexes (I. radicicola species complex) can be identified in a high sensitivity and can be detected specifically, with respect to the steel pathogenic strain I. mors-panacis, in relation to facilitate for the ginseng root rot Can be diagnosed.

Figure 1 shows the result of detecting a pathogenic strain (I. mors-panacis) steel of the present invention using the primer of the ginseng root rot Won Kyun type strain (I. radicicola species complex) in Example 3. Fig.
FIG. 2 shows the results of detection of the standard strains of the radicicola species complex of ginseng root rot by using the known primers of Comparative Examples 1 to 3.
FIG. 3 is a result of analysis of the nucleotide sequence of the Histone H3 PCR product through Comparative Example 4, and as a result of the systematic analysis, it was grouped into a pathogenic strain and a pathogenic strain.
FIGS. 4 and 5 are photographs of pathogenicity test using ginseng slices and seedling ginsengs against I. robusta , I. cyclaminicola and I. mors- panacis in the I. radicicola species complex.
Figure 6 shows the result of detecting the ginseng roots by using a pair of primers rot Won Kyun type strain (I. radicicola species complex) type strain according to the comparative Example 5.

Hereinafter, the present invention will be described in more detail.

As described above, Ginseng Panax ginseng root that causes a lot of damage to the farmer rot Won Kyun (I. radicicola species complex) of the steel pathogenic strain situation is the development of the primers capable of effectively detecting (I. mors panacis) insufficient . As can be seen particularly also through the schematics for 3 I. radicicola species complex, I. radicicola species complex is I. robusta, I. cyclaminicola, I. mors - panacis To include, 4 and 5 As can be seen also via the I. radicicola species of complex I. mors - according to the river panacis pathogenic strain being I. radicicola species of complex I. mors - only a specific panacis, development is very urgent to identify with a high sensitivity, and detection can be quantified primer Do.

Accordingly, the present invention relates to a method for producing ginseng root rot disease fungus ( I. ginseng), which is capable of amplifying DNA of a predetermined target region among DNA contained in ginseng root rot disease I. mors-panacis . mors-panacis ) detection primer set.

In this study, we investigated the effects of ginseng root rot rot ( I. radicicola species complex) on the growth of ginseng root rot rot ( I. mors-panacis ) Can be detected and identified more effectively.

First, the primer set for detecting ginseng root rot rot disease I. mors-panacis according to the present invention is not particularly limited as long as the base sequence comprises a primer represented by SEQ ID NO: 1 and a primer represented by SEQ ID NO: 2, Addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2.

The primer set has the advantage that the presence of ginseng root rot-bacterium (I. mors-panacis) contained in the sample can be discriminated by species-specificity very easily and with high sensitivity. In addition, the identification may be to detect the xylosidase gene contained in ginseng root rot disease I. mors-panacis . The xylosidase gene is a gene encoding an enzyme that degrades a plant cell wall. The gyroscidal gene expressing the gene is a β-1,4-D-glucosidase gene, which is one of the cell wall components of plant hemicellulose, The present invention relates to a method for directly and / or indirectly hydrolyzing D-xylenes, thereby causing plant infections caused by pathogens such as decomposing and destroying the host plant cell walls and allowing pathogens to penetrate into the host, and / It is a gene expressing indirectly involved gyroscide. Therefore, depending on whether the pathogen has a gyroscide-caused gene, it can be determined whether the cell wall of the plant, which is the primary line of defense against the pathogen, can be degraded or destroyed, and pathogens having the gyroside gene can be evaluated as highly pathogenic have. The primer set having the nucleotide sequences of SEQ ID NOS: 1 and 2 according to the present invention can target the ginseng gene which can be related to the high pathogenicity to ginseng as described above. In addition, the ginseng gene having excellent species specificity, high sensitivity , It is possible to identify a pathogenic strain in the ginseng root rot disease pathogen complex.

The primer need not be exactly complementary to the sequence of the template but can be complementary enough to form a hybridcomplex with the template.

In addition, the primers can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, " capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, But are not limited to, phosphoramidate, phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). In addition, the primers may, if necessary, comprise labels which can be detected directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of the label include, but are not limited to, enzymes such as horseradish peroxidase, alkaline phosphatase, and the like, radioactive isotopes such as 33P and the like, and chemical groups such as biotin and fluorescent molecules.

In addition, the sequence of the template is not particularly limited as long as it is a DNA of a gyroside gene contained in a common ginseng root rot disease I. mors-panacis , but preferably, 3 < / RTI >

The present invention is also embodied as a kit for detection or quantitative analysis of ginseng root rot disease ( I. mors-panacis ) comprising the primer set as described above.

The kit includes an amplification reagent in addition to the above-described primer set. In addition, the kit may further include a primer set having a different base sequence that can aid in the detection of ginseng root rot disease I. mors-panacis .

The amplification reagent is not particularly limited as long as it is contained in a kit for identifying a strain that usually causes plant diseases. For example, it may contain at least one of dNTP mixture (dATP, dCTP, dGTP, dTTP), DNA polymerase and buffer solution, which can be selected and adjusted in a proper amount The present invention is not particularly limited thereto, and a detailed description thereof will be omitted.

In addition, the present invention can identify quantitative analysis as well as identify the presence or absence of ginseng root rot disease ( I. mors-panacis ) in the sample using the primer set or kit described above.

In one embodiment of the present invention, an identification method using the primer set described above will be described. (A) A step of separating DNA from a sample to obtain a sample DNA, (b) DNA and a primer set for identification of ginseng roots rot ( I mors-panacis ) represented by SEQ ID NOs: 1 and 2 to obtain a PCR product And (c) analyzing the PCR product to identify whether or not the ginseng root rot -bacterium ( I. mors-panacis ) is contained in the sample.

First, in step (a) according to the present invention, DNA is isolated from a sample to obtain a sample DNA.

The sample is not particularly limited as long as it is a sample requiring identification of whether or not the pathogenic strain of the ginseng root rot disease is included in the ginseng root rot disease bacteria. For example, the sample may be ginseng ( Panax ginseng ), a soil sample of ginseng to be cultivated or cultivated land, Preferably a ginseng sample. In the case of the ginseng, the present invention is not particularly limited as long as it is commonly recognized as ginseng.

The DNA separation is not particularly limited as long as it is a method for separating genomic DNA (gDNA) from a sample. For example, a DNeasy mini kit from Qiagen can be used.

Next, in step (b) according to the present invention, a composition comprising the sample DNA obtained in step (a) and a primer set for identification of ginseng root rot rot disease ( I. mors-panacis ) represented by SEQ ID NOs: 1 and 2 (Polymerase chain reaction, PCR) to obtain a PCR product.

The composition comprises a primer for identification of ginseng root rot disease I. mors-panacis , wherein the primer is an oligonucleotide having a sequence complementary to a predetermined region of the ginseng root rot fungus germline gDNA sequence, 1 and SEQ ID NO: 2, which is capable of amplifying xylosidase DNA contained therein.

In addition, the composition may further include components necessary for the polymerase chain reaction in addition to the primers. For example, the composition may be a dNTP mixture (dATP, dCTP, dGTP, dTTP), a DNA polymerase and a buffer solution, It is not.

In addition, the gyrosidase DNA contained in the sample DNA is not particularly limited in the case of xylosidase which is specifically present in ginseng root rot disease I. mors-panacis , And thus it is easy to identify and detect a pathogenic strain in the ginseng root rot disease pre-infection complex with higher sensitivity.

In addition, the polymerase chain reaction can be carried out by suitably selecting and changing the methods and conditions known in the art. An example of such a method may be a real-time PCR reaction, a specific method for the real- Since the known conditions can be employed, the present invention is not particularly limited to this.

Next, in step (c) according to the present invention, the step of analyzing the PCR product to identify whether the sample contains ginseng root rot disease I. mors-panacis is performed.

The PCR product analysis is not particularly limited as long as it is a method of analyzing the PCR product, which is generally the result of PCR employed in the art.

For example, the size of the PCR product refers to an analysis method performed by analyzing the size of the PCR product obtained using the primer. Preferably, the size of the PCR product is 200 to 500 base pairs (base pair ; bp), the sample can be identified as containing ginseng root rot rot ( I. mors-panacis ). More specifically, in the case of the nucleotide sequence of SEQ ID NO: 3, the PCR product size may be about 300 base pairs and it can be identified as containing the ginseng root rot disease I. mors-panacis .

In addition, the present invention can include a primer represented by the nucleotide sequences of SEQ ID NOS: 1 and 2 to form a composition for diagnosing ginseng root disease.

The composition may be the same as the composition described in step (b) in the description of the identification method described above.

The composition for diagnosing ginseng root disease comprises the steps of: (a) obtaining DNA from a sample by separating the DNA; (b) contacting the sample DNA obtained in the step (a) with the DNA of SEQ ID NO: (C) obtaining a PCR product by performing a polymerase chain reaction (PCR) with a composition containing a primer set, and (c) analyzing the PCR product to determine whether the ginseng root rot disease is expected to occur or is expected to occur And the method for diagnosing ginseng root rot disease.

The composition and method for the diagnosis of ginseng root rot disease according to the present invention are highly sensitive and specific for the identification and detection of I. mors - panacis , which is a highly virulent pathogenic strain, in ginseng root rot disease. Therefore, identification of I. mors - panacis There is an advantage that it is possible to predict whether the ginseng root rot disease can occur in the sample through the detection or to diagnose it more easily.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to explain the present invention to the average person skilled in the art in more detail.

Primer production

First, genomic analysis of ginseng root rot rot ( I. radicicola ) was performed. Genomic analysis of ginseng radicicola I. radicicola strain (KACC41077) was performed using hybrid sequencing (Roche 454 and Illumina Hiseq) to obtain genomic information of about 64 Mb. This genetic information was predicted using Maker version 2.31.8 and Protein BLAST was performed on UniProt Swiss-Prot (2010506). We have identified 13,833 genes and selected xylosidase gene (xylosidase 1) which can identify P. gingkoi rot rot disease isolate ( I. mors- panacis ) among several xylosidase genes. The selected xylosidase gene was amplified by PCR using the primer 3 program (http://bioinfo.ut.ee/primer3-0.4.0/) to generate a PCR product at about 200-500 bp. Primer pair (Cy01820). The xylosidase DNA (SEQ ID NO: 3) amplified by the primer pair (SEQ ID NOs: 1 and 2) in Table 1 for the species specific xylosidase gene in ginseng root rot disease pathogenic strain ( I. mors - panacis ) .

gene Base sequence SEQ ID NO: xylosidase 1 Cy01820 Forward (F) GGCTTTGTCAACCCCATTATTCC One Cy01820 Reverse (R) GGTGCCCAAACTCCTCCAGAC 2 Cy01820 ATGTCCACTAATGAGGGCTTTGTCAACCCCATTATTCCGGGATTCAACCCTGATCCTTCAATCTGTCGTGTGGGCGATGACTACTTCCTTGTCACCTCGACTTTTGAATACTTCCCGGGCATTCCGATTTACCACAGCAAAGACCTGTTGGCTTGGACGCTAATCGGGCATGTCTTGACACGTCGATCCCAGCTTGAGATGCGCACGACAGAACCGTCTGGAGGAGTTTGGGCACCAACATTGCGATATCACCAGGGAACATTTTACGTGTCTGTCGGGTGTACCCAGAGGTTTCGACCTAAGGAGTGGTTGTTTTTCGACGATGACGGCAAGGTTTACTTCTCTGCCGTCAATCAAATGAAGGACCCGAAAATCTCCAAGCATGGTCTTGGACTTGCAACCTTCACTGCCGAAATTGACCTAAAGACGGGAAGTTGTGTGGGGCCTATCAGGTGGAATCGCATGTCAAACTTCGGATTCGGCATCGCAGAAGGACCTCACATTTTCAGAAAAGATGGCTACTACTATCTATCTACCGCTGAAGGAGGTACTGATGAGGGTCATCAGCAGTGGATACATCGCAGTAACGTCGGGCCTTTTGGCCCATGGGAAGCGCCTGGAAACGACGTCAATCCAATTCTCTTCAACGACATGGACACGCAAGTCCGCAACACTGGACATTTGGATTTCATTGAGACCAGTGATGGGCGTTGGTGGGCAGTGTTCCTTGGAGTCCGACCACAAGGAGACAAGGCTCAGTTCAAGTCGCAACTTGGGCGAGAGACATTCCTCGCGCCTGTTCAATGGATCGATGGCTGGCCTATCGTTAATGAACGGAAGAACATCAGCCTTGAAATGAAGGCACCAGGAATGCATCCTCTTACAAAGCCACAGTCATGGCGGGATGATTTTGAAGGTCCTGAGTTGAAGCTTGGGTGGTACCATCTACGAACACCCTTG
AAGCAAGCATACAAATTCGACACTCACCAGAACTCATTACTCTTATACGGTGGTGCCAACAGAATCTGGGATTTCGAATGCCCAAGCATGTTGTTGCAGAAGCAAGTCCATTTTTCTTTGGATTGGCGCGTGGAGATGAACTTCTCCCCCATGATTGCCGAGGAGGAAGCGGGCACGGCGATTTGGTGGTCCCAGTTTGCCTACGCCTCGATTAGCCTTCGAAGGATGAGCAATGGAAAAGGTTTGGAGATTATTTGTCGGTATTTAGATGAGAAGAATGAGTTTCAGGGAGCCGACGTGCAATTCGTTATAAAAGCGAGGGAACTGTACTACGACCTTGGCTATATGGCGCAGACGTCCTCGGAATCAGGGGCAGCTTTCATTAAGATGGGGTCGATTACCTCTGAATCATTCACACATCGCGTGCCAGGTCGGGAGTCCCCAAACACCGGTGCTCATTTTGCGATATACGCACAAGGATCTTATGATATGCCGTGTTTCACACCGGCTTGTTTCAAATCTACCGAATGGGAGGTAGTCGTTTAA 3

Sample pathogen preparation and gDNA extraction

To the ginseng root rot Won Kyun (I. radicicola species complex) type strain of 11 details used in the present invention are shown in Table 2.

Line Name Remarks One 40395 Korea Agricultural Microbiology Resource Center KACC40395 ( Ilyonectria radicicola ) 2 41077 Korea Agricultural Microbiology Resource Center KACC41077 ( Ilyonectria radicicola ) 3 44656 Korea Agricultural Microbiology Resource Center KACC44656 ( Ilyonectria radicicola ) 4 44657 Korea Agricultural Microbiology Resource Center KACC44657 ( Ilyonectria radicicola ) 5 44658 Korea Agricultural Microbiology Resource Center KACC44658 ( Ilyonectria radicicola ) 6 44659 Korea Agricultural Microbiology Resource Center KACC44659 ( Ilyonectria radicicola ) 7 44660 Korea Agricultural Microbiology Resource Center KACC44660 ( Ilyonectria radicicola ) 8 44661 Korea Agricultural Microbiology Resource Center KACC44661 ( Ilyonectria radicicola ) 9 44662 Korea Agricultural Microbiology Resource Center KACC44662 ( Ilyonectria radicicola ) 10 44663 Korea Agricultural Microbiology Resource Center KACC44663 ( Ilyonectria radicicola ) 11 44665 Korea Agricultural Microbiology Resource Center KACC44665 ( Ilyonectria radicicola )

The strains shown in Table 2 were suspended in CM liquid medium (NaNO ₃ per 1 L 2 g, Bacto-peptone 2.5 g, Bacto-yeast extract 1.0 g, sucrose 30.0 g, KH ₂ PO _{4 1.0 g, MgSO 42 O 0.5 g} , KCl 0.5 g, trace element solution comprises a 0.2 ㎖ and vitamin stock solution 10.0 ㎖) was 7 days in suspension culture was inoculated in 25 ℃ thermostat. The cultured mycelia were lyophilized, and the genomic DNA (gDNA) was extracted with CTAB extract solution (containing cetyltrimethylammonium bromide buffer, 2% CTAB, 100 mM Tris HCl pH 8.0, 20 mM EDTA pH 8.0 and 1.4 M NaCl) . The extracted gDNA was prepared to be used for PCR amplification at a concentration of 20 ng / μl.

Amplification of plant cell wall degrading enzyme xylosidase gene by PCR

0.5 μl of the primer (10 pmol) of SEQ ID NO: 1 in Table 1, 0.5 μl of the primer (10 pmol) of SEQ ID NO: 2, 1 μl of the gDNA (20 ng / , 2 μl of 10 × Taq buffer, 0.2 μl of Inclone ™ taq (5 units / μl) and 15.4 μl of sterilized water were mixed to prepare a mixed solution. Then, 20 μl of the mixed solution was used for the PCR reaction.

Specifically, 20 μl of the mixed solution was subjected to initial denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 20 seconds, annealing at 62 ° C. for 20 seconds, extension at 72 ° C. for 30 seconds 35 cycles were repeated with one cycle as a cycle of extension, followed by final elongation at 72 ° C for 10 minutes.

Thereafter, the PCR product obtained in the PCR reaction was confirmed by electrophoresis on a 1.2% agarose gel. Electrophoresis results are shown in FIG.

As can be seen in FIG. 1, amplification of standard strains of ginseng root rot rot ( I. radicicola species complex) pre- emulsified with the primer of the present invention revealed that amplification products were formed only in the pathogenic strain ( I. mors-panacis ) I could confirm.

Thus, it was found that the primer of the present invention is suitable for effectively identifying a pathogenic strain ( I. mors-panacis ) of ginseng root rot disease.

[Comparative Example 1]

PCR mixtures were treated in the same amounts as in Example 3, except that the primers of SEQ ID NOS: 4 to 5 were used, which are known as conventional ITS1-ITS4 primers (Waite et al ., 1990) Thereafter, the PCR reaction was performed by repeating 35 cycles of 20 sec denaturation at 94 ° C, 1 min at 55 ° C and 1 min at 72 ° C, and the result of electrophoresis was shown in FIG.

As can be seen in FIG. 2, the standard strains of the radicicola species complex of Ginseng Root Rotor with the previously invented ITS1-ITS4 primer were amplified, and it was confirmed that all amplification products were formed regardless of pathogenicity.

[Comparative Example 2]

The first PCR reaction was performed using the ITS1-ITS4 primer of Comparative Example 1, and the PCR product was purified using a Wizard®SV Gel and PCR Clean-Up System (Promega) kit. The purified first PCR product was used as template DNA and the same primers as those of Example 3 except that the primers of SEQ ID NOS: 6 to 7 as shown in Table 3 below, known as Dest1-Dest4 primer (Hamelin et al ., 1996) Nested PCR was performed by repeating 30 cycles of 1 cycle at 95 ° C for 35 sec denaturation, 55 ° C for 1 min, and 72 ° C for 2 min. The electrophoresis results are shown in FIG.

As can be seen in FIG. 2, amplification of the standard strains of ginseng root rot rotavirus ( I. radicicola species complex) with the previously invented Dest1-Dest4 primer revealed that all amplification products were formed regardless of pathogenicity.

[Comparative Example 3]

The PCR mixture was treated in the same amounts as in Example 3, except that the primers of SEQ ID NOS: 7 to 8 as shown in the following Table 3, which were known as conventional CYLH3F-CYLH3R primers (Ismail et al ., 2013) Thereafter, the PCR reaction was performed by repeating 35 cycles of 30 sec denaturation at 94 ° C, 30 sec denaturation at 61 ° C and 30 sec elongation at 72 ° C, and electrophoresis results are shown in FIG.

As shown in FIG. 2, the standard strains of the radicicola species complex of the ginseng root rot with the CYLH3F-CYLH3R primer which was previously invented were amplified, and it was confirmed that the whole amplification product was formed regardless of the pathogenicity.

Primer name Base sequence SEQ ID NO: ITS1 TCCGTAGGTGAACCTGCGG 4 ITS4 TCCTCCGCTTATTGATATGC 5 Dest1 TTGTTGCCTCGGCGGTGCCTG 6 Dest4 GGTTTAACGGCGTGGCCGCGCTGTT 7 CYLH3F AGGTCCACTGGTGGCAAG 8 CYLH3R AGCTGGATGTCCTTGGACTG 9

As a result, as shown in FIG. 1 and FIG. 2, the standard strains of the radicicola species complexes of the ginseng root rot by using the conventional primers of Comparative Examples 1 to 4 in Table 3 were amplified, The amplification product was confirmed in the strains. Therefore, the conventional primers could not distinguish ginseng root rot rot ( I. mors-panacis ). However, as shown in FIG. 1, it can be confirmed that the primers of SEQ ID NOS: 1 and 2 in Table 1 are very effective in identifying only the pathogenic strain among the standard strains of the ginseng root rot rot A. bromicola species complex.

[Comparative Example 4]

The PCR product was purified using a Wizard®SV Gel and PCR Clean-Up System (Promega) kit after performing a primary PCR reaction using the CYLH3F-CYLH3R primer of Comparative Example 3. Direct sequencing was performed using the purified first PCR product as template DNA and CYLH3F-CYLH3R primer. Sequence analysis of the analyzed strains was performed. The results of the system analysis are shown in FIG.

As shown in FIG. 3, the standard strains of the radicicola species complex of ginseng root rot with the conventional CYLH3F-CYLH3R primers of Comparative Examples 3 to 4 in Table 3 were amplified, I. robusta, I. cyclaminicola, and I. mors-panacis among the radicicola species complexes of ginseng root rot ( I. mors-panacis ) can be identified. there was. However, as can be seen from the above-mentioned experimental results, the primer set of SEQ ID NOS: 1 and 2 according to the present invention can be used for the pathogenicity of the radicicola species complex of ginseng root rot, It is able to identify only the strain ( I. mors-panacis ) and is therefore well suited for identification of I. mors-panacis .

[Comparative Example 5]

The xylosidase gene of Example 1 and the xylosidase gene (xylosidase 2) were selected from among several xylosidase genes analyzed in the same manner as in Example 1. The selected xylosidase 2 was amplified by PCR using the primer 3 program (http://bioinfo.ut.ee/primer3-0.4.0/) to generate the PCR product at about 200-500 bp. As shown in Table 4, SEQ ID NO: 10 and SEQ ID NO: 11 Primer pair (Cy04652).

gene Base sequence SEQ ID NO: xylosidase 2 Cy04652 Forward (F) GTTTTCCCCCGACCCTTCC 10 Cy04652 Reverse (R) GGTTTATCGCGTTGCCTGAGAA 11

Then, the PCR reaction was carried out in the same manner as in Example 3 except that the primer pairs of SEQ ID NOs: 10 and 11 were used instead of the primer pairs of SEQ ID NOs: 1 and 2. PCR products obtained were subjected to 1.2% agarose- The gel was confirmed by electrophoresis. The results of the electrophoresis are shown in Fig.

As can be seen in FIG. 6, the amplification of the standard strains of the radicicola species complex of Ginseng root rot, which had been pre-treated with the primer according to the comparative example 5, showed that pathogenic bacteria including I. mors-panacis It was confirmed that the amplification product was formed in both the weak and the non-resistant strains. Thus, it can be confirmed that the xylosidase gene can not be identified species-specifically for the pathogenic strain ( I. mors-panacis ) among the radicicola species complexes of ginseng root rot.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Maker and kit for detection of Ilyonectria mors-panacis and          method for detecting Ilyonectria mors-panacis <130> 1063064 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 23 <212> DNA <213> Unknown <220> <223> Ilyonectria radicicola_Cy01820_primer (F) <400> 1 ggctttgtca accccattat tcc 23 <210> 2 <211> 21 <212> DNA <213> Unknown <220> <223> Ilyonectria radicicola_Cy01820_primer (R) <400> 2 ggtgcccaaa ctcctccaga c 21 <210> 3 <211> 1506 <212> DNA <213> Unknown <220> <223> Ilyonectria radicicola_Cy01820 <400> 3 atgtccacta atgagggctt tgtcaacccc attattccgg gattcaaccc tgatccttca 60 atctgtcgtg tgggcgatga ctacttcctt gtcacctcga cttttgaata cttcccgggc 120 attccgattt accacagcaa agacctgttg gcttggacgc taatcgggca tgtcttgaca 180 cgtcgatccc agcttgagat gcgcacgaca gaaccgtctg gaggagtttg ggcaccaaca 240 ttgcgatatc accagggaac attttacgtg tctgtcgggt gtacccagag gtttcgacct 300 aaggagtggt tgtttttcga cgatgacggc aaggtttact tctctgccgt caatcaaatg 360 aaggacccga aaatctccaa gcatggtctt ggacttgcaa ccttcactgc cgaaattgac 420 ctaaagacgg gaagttgtgt ggggcctatc aggtggaatc gcatgtcaaa cttcggattc 480 ggcatcgcag aaggacctca cattttcaga aaagatggct actactatct atctaccgct 540 gaaggaggta ctgatgaggg tcatcagcag tggatacatc gcagtaacgt cgggcctttt 600 ggcccatggg aagcgcctgg aaacgacgtc aatccaattc tcttcaacga catggacacg 660 caagtccgca acactggaca tttggatttc attgagacca gtgatgggcg ttggtgggca 720 gtgttccttg gagtccgacc acaaggagac aaggctcagt tcaagtcgca acttgggcga 780 gagacattcc tcgcgcctgt tcaatggatc gatggctggc ctatcgttaa tgaacggaag 840 aacatcagcc ttgaaatgaa ggcaccagga atgcatcctc ttacaaagcc acagtcatgg 900 cgggatgatt ttgaaggtcc tgagttgaag cttgggtggt accatctacg aacacccttg 960 aagcaagcat acaaattcga cactcaccag aactcattac tcttatacgg tggtgccaac 1020 agaatctggg atttcgaatg cccaagcatg ttgttgcaga agcaagtcca tttttctttg 1080 gattggcgcg tggagatgaa cttctccccc atgattgccg aggaggaagc gggcacggcg 1140 atttggtggt cccagtttgc ctacgcctcg attagccttc gaaggatgag caatggaaaa 1200 ggtttggaga ttatttgtcg gtatttagat gagaagaatg agtttcaggg agccgacgtg 1260 caattcgtta taaaagcgag ggaactgtac tacgaccttg gctatatggc gcagacgtcc 1320 tcggaatcag gggcagcttt cattaagatg gggtcgatta cctctgaatc attcacacat 1380 cgcgtgccag gtcgggagtc cccaaacacc ggtgctcatt ttgcgatata cgcacaagga 1440 tcttatgata tgccgtgttt cacaccggct tgtttcaaat ctaccgaatg ggaggtagtc 1500 gtttaa 1506 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITS1_primer <400> 4 tccgtaggtg aacctgcgg 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITS4_primer <400> 5 tcctccgctt attgatatgc 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Dest1_primer <400> 6 ttgttgcctc ggcggtgcct g 21 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Dest4_primer <400> 7 ggtttaacgg cgtggccgcg ctgtt 25 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CYLH3F_primer <400> 8 aggtccactg gtggcaag 18 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYLH3R_primer <400> 9 agctggatgt ccttggactg 20 <210> 10 <211> 19 <212> DNA <213> Unknown <220> <223> Ilyonectria radicicola_Cy04652_primer (F) <400> 10 gttttccccc gacccttcc 19 <210> 11 <211> 22 <212> DNA <213> Unknown <220> <223> Ilyonectria radicicola_Cy04652_primer (R) <400> 11 ggtttatcgc gttgcctgag aa 22

Claims (11)

(a) separating DNA from a sample to obtain a sample DNA;
(b) a composition comprising the sample DNA obtained in the step (a) and a primer set for identification of ginseng root rot rot disease ( I. mors-panacis ) represented by SEQ ID NOS: 1 and 2, and a polymerase chain reaction , PCR) to obtain a PCR product; And
(c) analyzing the PCR product to identify the presence of the ginseng root rot -bacterium ( I. mors-panacis ) in the sample; and identifying the mors-panacis ginseng root rot. The method according to claim 1, wherein the sample is a ginseng ( Panax ginseng ) sample I. ginseng root rot disease I. mors-panacis identification method. The method according to claim 1, wherein the primer set of the ginseng root rot disease primer ( I. mors-panacis ) amplifies a gyroscide gene gene contained in a sample DNA, wherein identification of the ginseng root rot disease I. mors-panacis Way. According to claim 1, wherein said polymerase chain reaction is a method for identifying ginseng root rot Won Kyun (I. mors-panacis), characterized in that real-time polymerase chain reaction. A primer set for detection of ginseng root rot rot ( I. mors-panacis ) represented by SEQ ID NOS: 1 and 2. 6. The method according to claim 5, wherein the base sequence is a primer set for detecting I. mors-panacis of ginseng root rot, characterized by amplifying the gyroside gene of the ginseng root rot disease I. mors-panacis DNA . 7. The primer set for detecting mors-panacis of ginseng root rot disease according to claim 6, wherein the gyroscidease gene comprises the nucleotide sequence shown in SEQ ID NO: 3. A kit for the detection or quantitative analysis of ginseng root rot disease ( I. mors-panacis ) comprising a primer set for detecting I. mors-panacis of any one of claims 5 to 7 and an amplification reagent . The method according to claim 8, wherein the amplification reagent comprises at least one selected from the group consisting of a dNTP mixture, a DNA polymerase, and a buffer solution . The mors-panacis strain of ginseng root rot, Kits for detection or quantitative analysis. A composition for diagnosing ginseng root rot disease comprising a primer set represented by SEQ ID NOs: 1 and 2. (a) separating DNA from a sample to obtain a sample DNA;
(b) obtaining a PCR product by performing a polymerase chain reaction (PCR) with a composition comprising the sample DNA obtained in the step (a) and a primer set represented by SEQ ID NOS: 1 and 2; And
(c) analyzing the PCR product to determine whether the ginseng root rot disease is onset or onset in the sample.

Images