KR101723087B1 - Primer for detection of Cylindrocarpon destructans using microsatellite, kit comprising them and the method for identifying Cylindrocarpon destructans thereby - Google Patents

Abstract

The present invention relates to a primer for detecting germ root rot rot disease bacteria using micro-markers, a kit comprising the same, and a method for identifying ginseng root rot disease bacteria using the same, and more particularly, to a method for amplifying microsatellite DNA contained in a sample A primer capable of effectively detecting only the ginseng root rot fungus, a kit including the primer, and a method for identifying the germination root rot fungus.

Description

TECHNICAL FIELD [0001] The present invention relates to a primer for detecting ginseng root rot rot disease using micro-markers, a kit containing the same, and a method for identifying ginseng root rot disease germs using the primer,

The present invention relates to a primer for detecting ginseng root rot disease bacteria using micro-markers, a kit containing the same, and a method for identifying ginseng root rot disease bacteria. More specifically, it is a primer capable of amplifying microsatellite DNA contained in a sample to effectively detect only the ginseng root rot disease bacteria. The kit containing the same provides an identification method suitable for detecting C. destructans of ginseng root rot because it does not detect pathogens reported to be caused by conventional ginseng.

Ginseng (Panax ginseng) is a perennial semi-silky ginseng root, which belongs to the acanthaceae family. Its optimum growth temperature is around 20 ℃, and it is grown or cultivated mainly in the northern hemisphere Far East region. The main region of Korea is Gyeonggi region, Poongsan and Geumsan provinces. The main pharmacological component of ginseng is saponin, its consumption has been on the rise due to its excellent efficacy as nutritional supplement, immunity enhancement, fatigue recovery, central nervous system regulation, antistress, antidiabetic and antitumor activity. Consumption is expected to steadily increase as excellence is revealed.

However, in spite of the excellent efficacy and consumption desire of ginseng, ginseng is a perennial ophthalmic plant, which is a semi-oily plant. Therefore, ginseng is the most important growth limiting factor and is a low temperature plant which inhibits growth at high temperature. It is a weak plant with high light intensity. In addition, ginseng was evaluated as a plant which is difficult to cultivate because of its weak tolerance and effective control method in addition to the above-mentioned growth inhibition factors.

In addition, the plant of ginseng consists of root and head under the ground, stem, leaf, flower (fruit) on the ground, and it is a perennial, so every spring the bud emerges from the root in the ground. do. Ginseng should be cultivated for 4 ~ 6 years in the same packaging for a long time, and after the ginseng is harvested, it is cultivated again for 1 ~ 2 years without cultivation of other crops, It is a plant with a high probability of occurrence of large and continuous obstacles.

The main pathogens of root rot caused by the ginseng damage are Cylindrocarpon destructans , Fusariumsolani , Rhizoctonia < RTI ID = 0.0 > solani), Botrytis cine Leah (Botryis cinerea ), Phytophthora ( Phytophthora cactorum , Pythium sp .), and Alternaria panax (7). These pathogens are known to occur either singly or in combination.

According to recent research results from the Agricultural Research Institute of Korea, the causes of ginseng rooting for 4 years or longer are 35% for root rot, 32% for gray mold, and 15% for spotted fungus, In particular, ginseng roots rot rotens in winter and causes direct disease in roots, so it is difficult to control after planting of ginseng, and the damage caused by disease is very small in 4 years (21.8%) and 6 years (50% To 80% of the total ginseng production.

The initial symptom of ginseng root rot disease is reddish leaf edge, leaf is inward, and symptoms show symptoms. Root showing such symptom forms reddish brown or black brown lesion at the end or middle part and discoloration of hairy root is reddish brown Become corrupt. Also, ginseng root rot disease is the most serious problem in Korean ginseng cultivation farms, such as from seedling ginseng to 6 years old, occurring in all the years and becoming more and more generations to high birth rate.

Since C. destructans , which is the main causal organism of Korean ginseng root rot disease, has been isolated from the typical black lesion tissue of chronic obstructive disease and confirmed pathogenic, Research is actively underway.

Korean Patent Laid-open Publication No. 10-2013-0098792 (published on Sep. 05, 2013) discloses a method for identifying a species and a genus specific primer capable of diagnosing four soil pathogenic fungi causing disease in ginseng . However, other pathogens were detected in addition to C. destructans , indicating that it was not C. destructans - specific primer of ginseng root rot.

Microsatellite markers have been found to be very useful in plant genetic breeding, disease and molecular biology studies, and in some countries microsatellite research has been conducted on major crops in their country, This is the time when continuous research and investment is needed.

However, studies using microsatellite as a primer for detecting C. destructans of ginseng root rot still do not yet exist.

Disclosure of the Invention The present invention has been conceived to solve the problems as described above, and it is an object of the present invention to provide a primer capable of amplifying microsatellite DNA contained in a sample to effectively detect only C. destructans , The present invention provides an identification method suitable for the detection of C. destructans of ginseng root rot caused by the conventional ginseng.

The present invention relates to a method for separating DNA from a sample, comprising: obtaining a sample DNA by separating DNA from the sample; Obtaining a PCR product by performing a polymerase chain reaction (PCR) with a mixture solution containing the sample DNA and a primer for identifying ginseng root rot disease virus containing SEQ ID NOS: 1 to 2; And analyzing the PCR product to identify whether or not the sample contains ginseng roots rot fungus. The present invention also provides a method for identifying C. destructans of ginseng root rot disease.

According to a preferred embodiment of the present invention, the PCR product analysis can perform fragment analysis including size analysis of the PCR product.

According to another preferred embodiment of the present invention, the primer for identification of the ginseng root rot disease virus can amplify the microsatellite DNA contained in the sample DNA.

Also, the present invention provides a primer for detecting C. destructans by using micro-markers comprising SEQ ID NOS: 1 to 2, amplifying microsatellite DNA contained in the ginseng root rot disease germ.

According to a preferred embodiment of the present invention, the microsatellite DNA may include SEQ ID NO: 3.

Further, the present invention provides a kit for detecting C. destructans , which comprises a primer for detecting a germ root rot rot disease bacteria and an amplification reagent using the micro marker as described above.

According to a preferred embodiment of the present invention, the amplification reagent may include at least one of dNTP mixture (dATP, dCTP, dGTP, dTTP), DNA polymerase and buffer solution.

Hereinafter, terms of the present invention will be described.

The term " microsatellite DNA "of the present invention is a repetitive DNA group consisting of about 2 to about 6 nucleotide sequences, which is uniformly distributed within the genome and is a non-coding DNA sequence exhibiting a very high polymorphism DNA sequence). In microsatellite DNA, diversity among individuals is recognized according to the number of repeats of repeating units at a specific position. When there is polymorphism in the number of repeats, the primer designed in the adjacent region is used to perform gene amplification such as polymerase chain reaction , The polymorphism is observed at the length of the amplification reaction product, and the DNA polymorphism can be detected.

Further, the "primer" of the present invention refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be duplicated and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The preferred length of the primer is 5 to 50 nucleotides. The specific length and sequence will depend on the primer usage conditions such as temperature and ionic strength as well as the complexity of the desired DNA or RNA target.

Further, the "microsatellite" of the present invention is also referred to as simple sequence repeats (SSR), and is a region in which 2 to 5 bases in the DNA base sequence in the genome are characteristically repeated, Because there are various alleles, they are inherited from offspring to offspring according to the genetic code of Mendel, so they can be used as a marker for chromosome mapping, to define the genetic characteristics of groups and individuals, or to be used for genotype analysis such as paternity identification . These micro marker specific sites can be amplified by Polymerase Chain Reaction (PCR) using primers of the upper and lower nucleotide sequences containing the same.

The present invention relates to a primer capable of amplifying microsatellite DNA contained in a sample and capable of effectively detecting only C. destructans , a kit comprising the same, and a method for detecting a pathogenic microorganism It is effective to provide an identification method suitable for the detection of C. destructans of ginseng root rot.

FIG. 1 shows the results of detection of standard strains of C. destructans using the primers of the present invention in Example 3. FIG.
FIG. 2 shows the results of detection of C. destructans and various pathogens using the primers of the present invention in Example 3. FIG.
FIG. 3 shows the results of detection of standard strains of C. destructans using the conventional primers of Comparative Examples 1 to 4.
FIG. 4 shows the results of detection of C. destructans and various pathogens using the conventional primers of Comparative Examples 1 to 4.

Hereinafter, the present invention will be described in more detail.

As described above, there is a problem that there is no primer capable of effectively detecting the ginseng root rot disease germ, which causes a lot of damage to the ginseng farming house, and development of primer for detection of ginseng root rot disease bacteria using microsatellite is insufficient. Therefore, it is urgent to develop a primer that can effectively detect ginseng root rot disease bacteria using microsatellite.

Accordingly, the present invention provides a primer set for detecting C. destructans , which is obtained by amplifying microsatellite DNA contained in a ginseng root rot disease fungus, and which is represented by SEQ ID NOS: 1 to 2, I tried to solve it. The present invention provides a primer set capable of effectively detecting only ginseng roots rot fungi , because the PCR amplification can not be performed in the same pathogen as Cylindrocarpon album , Cylindrocarpon obtusisporum , which is reported to be caused by ginseng root rot germ It is effective.

The present invention relates to a method for separating DNA from a sample, comprising: obtaining a sample DNA by separating DNA from the sample; Obtaining a PCR product by performing a polymerase chain reaction (PCR) on a mixture of the sample DNA and a primer set for identification of a ginseng root rot disease vaccine of SEQ ID NOS: 1 to 2; And analyzing the PCR product to identify whether the sample contains ginseng root rot disease bacteria; ( C. destructans ) containing ginseng root rot.

First, DNA is separated from the sample to obtain a sample DNA.

The sample is not particularly limited as long as it is necessary to discriminate whether or not the ginseng roots rot fungus is contained.

The DNA separation is not particularly limited so long as it is a method for separating genomic DNA (gDNA) from a sample. For example, a DNeasy mini kit from Qiagen can be used.

Next, a PCR product is obtained by performing a polymerase chain reaction (PCR) on the mixture of the sample DNA and a primer set for identifying ginseng root rot disease bacteria identified in SEQ ID NOS: 1 to 2.

The primer set for identification of the ginseng root rot disease vaccine may include a nucleotide sequence capable of amplifying microsatellite DNA contained in the sample DNA, preferably an oligonucleotide having a sequence complementary to the gDNA root rot germ plasmid gDNA sequence. , More preferably the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

The microsatellite DNA contained in the sample DNA is not particularly limited as long as it contains microsatellite that is specifically present in the ginseng roots rot fungus. Preferably, the microsatellite DNA may include the nucleotide sequence of SEQ ID NO: 3.

Next, the PCR product is analyzed to identify whether the sample contains the germplasm of the ginseng root rot disease.

The PCR product analysis is not particularly limited as long as it is a method for analyzing PCR products, but it is preferable to perform fragment analysis, and more preferably, to perform fragment analysis ). ≪ / RTI >

The size of the PCR product refers to an analysis method performed by analyzing the size of the PCR product obtained using a primer set. Preferably, the size of the PCR product is 495 to 505 base pairs (base pair; bp ), The sample can be identified as containing C. destructans , the ginseng root rot.

In addition, the present invention provides a primer set for detecting C. destructans by using micro-markers as shown in SEQ ID NOS: 1 to 2 and amplifying microsatellite DNA contained in the ginseng root rot disease bacteria.

The primer set for the detection of ginseng root rot disease bacteria is not particularly limited as long as it comprises the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and includes the addition, deletion or substitution sequence of the nucleotide sequence of SEQ ID NO: .

The primer set has an effect of identifying whether the sample contains ginseng root rot disease bacteria, and the identification can be performed by detecting microsatellite DNA contained in the ginseng root rot disease bacteria.

The set of primers need not be exactly complementary to the sequence of the template but can be complementary enough to form a hybridcomplex with the template.

The sequence of the template is not particularly limited as long as it is microsatellite DNA contained in a common ginseng root rot disease virus, but may preferably include SEQ ID NO: 3.

In addition, the present invention provides a kit for detecting ginseng root rot disease bacteria comprising a primer set for detecting ginseng root rot disease bacteria as described above and a reagent for amplification.

The amplification reagent is not particularly limited as long as it is contained in a kit for identifying a plant strain. For example, it may include at least one of dNTP mixture (dATP, dCTP, dGTP, dTTP), DNA polymerase and buffer solution.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to explain the present invention to the average person skilled in the art in more detail.

[ Example ]

Example  One. primer  making

The primer pairs were prepared using the Ccms_cotig_66 and SciRoKoCo programs, which are microsatellite DNA information of the ginseng root rot rot fungus through the genome analysis of the C. destructans of ginseng root rot (Table 1). The microsatellite DNA (SEQ ID NO: 3) amplified by the primer pair in Table 1 below and the primer pairs produced are listed in Table 1 below, among Ccms_cotig_66, microsatellite DNA information of the ginseng root rot disease virus.

Base sequence location Melting point (℃) SEQ ID NO: Ccms66-
GCA51 Forward (F) ATCGAGACGGGGATGCGACAA contig 66: 4911-4931 62 One Reverse (R) TTTGCGCTGTGCGGACTAGGTT contig 66: 5325-5346 2 Ccms_
cotig_66 ATCGAGACGGGGATGCGACAAGATAGGAGAGGTAGGAAAGGAACAAGAGCCAACGGGGGAAATGGAAGAAATGGAAGAATGGAAGGATGGGGTGGGAGGGAAGGAAGGCAGGAAAGAAAGGACGAGACGTCGTTGGTCCGAACAAGGAAAGAGGCCGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAAGCTTTGGCGACGGCTACAGTGACGGGCAGGAGGAGCTGCACGGAAGAGGGACATGGACAGACAGGACAGGACATGGGCGAATCTACTATCAAAGCCCAGCAGCTCAGCAGCTCAGTAGCCCAGCCCGCCCAGGCCTGCGCCAACGCCCACGGCCACACCCACTGCCCACTAATGAATCCACTATTGCAACCGCGCCCTACTGCACCAACCTAGTCCGCACAGCGCAAA - - 3

Example 2 . Preparation of sample pathogen and gDNA  extraction

Detailed information of 11 species of ginseng root rot disease bacteria used in the present invention is shown in Table 2 below. In addition, detailed information of the pathogens used as comparative examples of the present invention among the pathogens found and reported in the conventional ginseng in addition to the ginseng root rot disease fungus are shown in Table 3 below.

Line Name Remarks One 40395 Korea Agricultural Microbiology Resource Center KACC40395 ( Cylindrocarpon destrucdans ) 2 41077 Korea Agricultural Microbiology Resource Center KACC41077 ( Cylindrocarpon destrucdans ns) 3 44656 Korea Agricultural Microbiology Resource Center KACC44656 ( Cylindrocarpon destrucdans ns) 4 44657 Korea Agricultural Microbiology Resource Center KACC44657 ( Cylindrocarpon destrucdans ns) 5 44658 Korea Agricultural Microbiology Resource Center KACC44658 ( Cylindrocarpon destrucdans ns) 6 44659 Korea Agricultural Microbiology Resource Center KACC44659 ( Cylindrocarpo ndestrucdans ) 7 44660 Korea Agricultural Microbiology Resource Center KACC44660 ( Cylindrocarpon destrucdans ) 8 44661 Korea Agricultural Microbiology Resource Center KACC44661 ( Cylindrocarpon destrucdans ) 9 44662 Korea Agricultural Microbiology Resource Center KACC44662 ( Cylindrocarpon destrucdans ) 10 44663 Korea Agricultural Microbiology Resource Center KACC44663 ( Cylindrocarpon destrucdans ) 11 44665 Korea Agricultural Microbiology Resource Center KACC44665 ( Cylindrocarpon destrucdans )

Line Name Remarks One 40395 Korea Agricultural Microbiology Resource Center KACC40395 ( Cylindrocarpon destrucdans ) 2 41077 Korea Agricultural Microbiology Resource Center KACC41077 ( Cylindrocarpon destrucdans ) 3 12yeon02-02 A strain isolated from a laboratory
(Based on the sequence analysis, Cylindrocarpon The strains identified as coming album) 4 12yeon02-04 A strain isolated from a laboratory
(Based on the sequence analysis, Cylindrocarpon The strains identified as coming obtusisporum) 5 13paj01-R10 A strain isolated from a laboratory
(As a result of nucleotide sequence analysis, Alternaria The strain identified as panax ) 6 GA A strain isolated from a laboratory
(As a result of nucleotide sequence analysis, Alternaria The strain identified as panax ) 7 13eum05-18 A strain isolated from a laboratory
(As a result of nucleotide sequence analysis, Alternaria the strain identified as populi ) 8 13eum05-28 A strain isolated from a laboratory
(As a result of nucleotide sequence analysis, Alternaria the strain identified as populi ) 9 12yeon04-09 A strain isolated from a laboratory
(Sequence analysis result of Botrytis a strain identified as cinerea ) 10 13eum04-02 A strain isolated from a laboratory
(Sequence analysis result of Botrytis a strain identified as cinerea ) 11 GCT A strain isolated from a laboratory
(A strain identified as Collectricumgloeosporioides as a result of sequencing) 12 13chu01-15 A strain isolated from a laboratory
(Sequence analysis results showed that Fusarium strain identified as oxysporum ) 13 12eum07-29 A strain isolated from a laboratory
(Sequence analysis results showed that Fusarium strain identified as oxysporum ) 14 12sun01-07 A strain isolated from a laboratory
(A strain identified as Fusariumsonani as a result of sequencing) 15 12eum01-10 A strain isolated from a laboratory
(Sequence analysis results showed that Fusarium strain identified as sonani ) 16 13eum03-03 A strain isolated from a laboratory
(A strain identified by Plectosphaerella cucumerina as a result of sequencing ) 17 13chu01-11 A strain isolated from a laboratory
(Sequence analysis showed that Plectosphaerella strain identified as cucumerina ) 18 12goe04-05 A strain isolated from a laboratory
(Based on the nucleotide sequence analysis, Trichoderma asperellum ) 19 13eum03-05 A strain isolated from a laboratory
(Based on the nucleotide sequence analysis, Trichoderma asperellum )

The above-mentioned strains were suspended in CM liquid medium (2 g NaNO ₃ per liter, 2.5 g Bacto-peptone, 1.0 g Bacto-yeast extract, 30.0 g sucrose, 1.0 g KH ₂ PO ₄ , 0.5 g MgSO ₄ .7H ₂ O, 0.5 g of trace element solution, 0.2 ml of trace element solution and 10.0 ml of vitamin stock solution), followed by suspension culture at 25 ° C for 7 days. The cultured mycelia were lyophilized, and the genomic DNA (gDNA) was extracted with CTAB extract solution (containing cetyltrimethylammonium bromide buffer, 2% CTAB, 100 mM TrisHCl pH 8.0, 20 mM EDTA pH 8.0 and 1.4 M NaCl). The extracted gDNA was used for PCR amplification at a concentration of 20 ng / μl.

Example  3. PCR On by Micro satellite DNA Amplification of

0.5 μl of the primer (10 pmol) of SEQ ID NO: 1, 1 μl of the primer (10 pmol) of SEQ ID NO: 2, 1 μl of the gDNA (20 ng / μl) extracted in Example 2, 0.4 μl of dNTP , 2 占 퐇 of 10X Tag buffer, 0.2 占 퐇 of Inclone 占 tag (5 units / 占 퐇) and 15.4 占 퐇 of sterilized water were mixed to prepare a mixed solution. Then, 25 μl of the mixed solution was used for the PCR reaction.

Specifically, 20 μl of the mixed solution was subjected to initial denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 20 seconds, annealing at 62 ° C. for 20 seconds, extension at 72 ° C. for 30 seconds 35 cycles were repeated with one cycle as a cycle of extension, followed by final elongation at 72 ° C for 10 minutes.

Thereafter, the PCR product obtained in the PCR reaction was confirmed by electrophoresis on a 1.2% agarose gel. Electrophoresis results are shown in Figures 1 and 2.

As can be seen in FIG. 1, the amplification products of all the standard strains of the ginseng root rot disease sold by the primer set of the present invention were confirmed.

As shown in FIG. 2, the primer set of the present invention amplified various pathogens reported in Ginseng with the primer set of the present invention. As a result, the primer set of the present invention was found to contain Cylindrocarpon album , which is the same species as other pathogens except ginseng root rot, No amplification products were identified in Cylindrocarpon obtusisporum .

Thus, it was found that the primer set of the present invention is suitable for effectively identifying ginseng root rot disease bacteria.

Comparative Example  One.

PCR mixtures were treated in the same amounts as in Example 3, except that the primers of SEQ ID NOS: 4 to 5 (see Table 4) known as the conventional ITS1-ITS4 primer (Waite et al., 1990) were used. Thereafter, a PCR reaction was performed by repeating 35 cycles of 20 sec denaturation at 94 ° C, 1 min at 55 ° C and 1 min at 72 ° C, and electrophoresis results are shown in FIGS. 3 to 4.

Comparative Example  2.

The PCR product was purified using a Wizard® SV Gel and PCR Clean-Up System (Promega) kit after the first PCR reaction using the ITS1-ITS4 primer of Comparative Example 1 was performed. The purified first PCR product was used as template DNA and the primers of SEQ ID NOs: 6 to 7 (described in Table 4), which are known as the prior Dest1-Dest4 primer (Hamelin et al., 1996) Nested PCR was performed by repeating 30 cycles of 1 cycle at 95 ° C for 35 sec denaturation, 55 ° C for 1 min, and 72 ° C for 2 min. Electrophoresis results are shown in FIGS. 3 to 4.

Comparative Example  3.

The PCR product was purified using a Wizard® SV Gel and PCR Clean-Up System (Promega) kit after the first PCR reaction using the ITS1-ITS4 primer of Comparative Example 1 was performed. The PCR mixture was treated in the same amounts as in Example 3, except that the purified first PCR product was used as template DNA and the primers of SEQ ID NOS: 8 to 9 (as shown in Table 4) known as Destruc2F-Destruc2R primer . Nested PCR was performed by repeating 35 cycles of 1 cycle at 94 ° C for 20 sec denaturation, 30 sec at 65 ° C and 30 sec at 72 ° C. Electrophoresis results are shown in FIGS. 3 to 4.

Comparative Example  4.

The PCR mixture was treated in the same amount as in Example 3 except that the primers (shown in Table 4) of SEQ ID NOs: 10 to 11, which were conventionally known as CylF01-CylR625 primers, were used and denatured at 94 DEG C for 5 seconds, PCR was performed by repeating 35 cycles of one cycle extending for 10 seconds at 72 ° C. Electrophoresis results are shown in FIGS. 3 to 4.

Comparative Example  5.

The PCR mixture was treated in the same amount as in Example 3 except that the primers of SEQ ID NOS: 12 to 11 (described in Table 4), which were conventionally known as CylF146-CylR625 primers, were used and denatured at 94 DEG C for 5 seconds, The PCR reaction was performed by repeating 35 cycles of one cycle extending for 10 seconds at 72 ° C. Electrophoresis results are shown in FIGS. 3 to 4.

Comparative Example  6.

The PCR mixture was treated in the same amounts as in Example 3, except that the primers of SEQ ID NOS: 12 to 13 (described in Table 4), which were conventionally known as CylF146-CylR407 primers, were used. PCR was performed by repeating 35 cycles of 1 cycle of denaturation at 94 ° C for 5 seconds, binding at 54 ° C for 5 seconds, and extension at 72 ° C for 10 seconds. Electrophoresis results are shown in FIGS. 3 to 4.

Primer name Base sequence SEQ ID NO: ITS1 TCCGTAGGTGAACCTGCGG 4 ITS4 TCCTCCGCTTATTGATATGC 5 Dest1 TTGTTGCCTCGGCGGTGCCTG 6 Dest4 GGTTTAACGGCGTGGCCGCGCTGTT 7 Destruc2F GTGCCTGYTTCGGCAGC 8 Destruc2R CTGTTTCCGTGCGAGGTGTGC 9 CylF01 CATGCGTGAGATTGTAAGTT 10 CylR625 TGACCCTTGGCCCAGTTGTT 11 CylF146 ACGACGTGATTTTGGGACAA 12 CylR407 TCGTTGAAGTAGACGCTCAT 13

As shown in FIG. 3, amplification products of all standard strains were confirmed by amplifying the standard strains of the ginseng root rot disease pre-marketed with the conventional primers of Comparative Examples 1 to 6 in Table 4. [

As shown in FIG. 4, as a result of amplification of various pathogens reported in Ginseng with the conventional primers of Comparative Examples 1 to 6 in Table 4, it was found that conventional primers showed amplification products in other pathogens except for ginseng root rot disease bacteria I could confirm. In particular, the primers of Comparative Example 1 were confirmed to be amplified in all pathogens known to be found in ginseng, and the primers of Comparative Examples 2 to 4 were confirmed to be amplified even in pathogens other than ginseng root rot. In particular, in the case of the primers of Comparative Examples 2 and 3, it is troublesome to perform the PCR reaction two times.

In addition, the primers of Comparative Examples 5 to 6 showed no amplification products in other plant pathogens, but Cylindrocarpon album , Cylindrocarpon , which is the same genus of C. destructans , The amplified product was identified in obtusisporum .

As a result, the conventional primers were found to be not suitable for effectively identifying the ginseng roots rot fungi, because the amplification products were detected in the same genus as other pathogens other than the ginseng root rot disease fungus.

As can be seen from the examples and comparative examples, the primer set of the present invention and the breed identification method using the same can amplify the microsatellite DNA contained in the sample to obtain a primer capable of effectively detecting only C. destructans of ginseng root rot disease A kit containing the same, and a method for identifying C. destructans , which are not detected in the conventional ginseng, are provided.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer for detection of Cylindrocarpon destructans, kit          comprising them and identification of Cylindrocarpon destructans <130> 1040579 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Cylindrocarpon destructans <400> 1 atcgagacgg ggatgcgaca a 21 <210> 2 <211> 22 <212> DNA <213> Cylindrocarpon destructans <400> 2 tttgcgctgt gcggactagg tt 22 <210> 3 <211> 436 <212> DNA <213> Cylindrocarpon destructans <400> 3 atcgagacgg ggatgcgaca agataggaga ggtaggaaag gaacaagagc caacggggga 60 aatggaagaa atggaagaat ggaaggatgg ggtgggaggg aaggaaggca ggaaagaaag 120 gacgagacgt cgttggtccg aacaaggaaa gaggccgcag cagcagcaac agcagcagca 180 gcaacagcag cagcaacagc agcagcaagc tttggcgacg gctacagtga cgggcaggag 240 gagctgcacg gaagagggac atggacagac aggacaggac atgggcgaat ctactatcaa 300 agcccagcag ctcagcagct cagtagccca gcccgcccag gcctgcgcca acgcccacgg 360 ccacacccac tgcccactaa tgaatccact attgcaaccg cgccctactg caccaaccta 420 gtccgcacag cgcaaa 436 <210> 4 <211> 19 <212> DNA <213> Cylindrocarpon destructans <400> 4 tccgtaggtg aacctgcgg 19 <210> 5 <211> 20 <212> DNA <213> Cylindrocarpon destructans <400> 5 tcctccgctt attgatatgc 20 <210> 6 <211> 21 <212> DNA <213> Cylindrocarpon destructans <400> 6 ttgttgcctc ggcggtgcct g 21 <210> 7 <211> 25 <212> DNA <213> Cylindrocarpon destructans <400> 7 ggtttaacgg cgtggccgcg ctgtt 25 <210> 8 <211> 17 <212> DNA <213> Cylindrocarpon destructans <400> 8 gtgcctgytt cggcagc 17 <210> 9 <211> 23 <212> DNA <213> Cylindrocarpon destructans <400> 9 ctgtttycca gtgcgaggtg tgc 23 <210> 10 <211> 20 <212> DNA <213> Cylindrocarpon destructans <400> 10 catgcgtgag attgtaagtt 20 <210> 11 <211> 20 <212> DNA <213> Cylindrocarpon destructans <400> 11 tgacccttgg cccagttgtt 20 <210> 12 <211> 20 <212> DNA <213> Cylindrocarpon destructans <400> 12 acgacgtgat tttgggacaa 20 <210> 13 <211> 20 <212> DNA <213> Cylindrocarpon destructans <400> 13 tcgttgaagt agacgctcat 20

Claims (7)

Separating the DNA from the sample to obtain a sample DNA;
Obtaining a PCR product by performing a polymerase chain reaction (PCR) on a mixture of the sample DNA and a primer set for identification of a ginseng root rot disease vaccine of SEQ ID NOS: 1 to 2; And
Analyzing the PCR product to identify whether the sample contains the germplasm of the ginseng root rot disease;
Of C. destructans containing ginseng root rot. The method according to claim 1, wherein the analysis of the PCR product is performed by a fragment analysis including a size analysis of a PCR product. The method according to claim 1, wherein the primer set for identification of the ginseng root rot disease vaccine amplifies microsatellite DNA contained in the sample DNA. A primer set for detecting C. destructans using micro-markers as shown in SEQ ID NOS: 1 to 2 and amplifying Microsatellite DNA contained in the ginseng root rot disease womb. 5. The primer set of claim 4, wherein the microsatellite DNA comprises SEQ ID NO: 3. A kit for detecting C. destructans , comprising a primer set for detecting a germ root rot rot disease bacteria and an amplification reagent using the micro marker of claim 4 or 5. The method according to claim 6, wherein the amplification reagent comprises at least one member selected from the group consisting of a dNTP mixture (dATP, dCTP, dGTP, dTTP), a DNA polymerase and a buffer solution. Detection kit.

Images