KR102147392B1 - A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same - Google Patents

Abstract

The present application relates to a marker capable of specifically detecting microorganisms in the genus Ganoderma, a composition, a method for detecting microorganisms in the genus Ganoderma using the marker or the composition, and a method for diagnosing basal stem rot.

Description

A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same}

The present application relates to a marker, a composition, a kit, a chip, and a method of using the same for diagnosing root rot.

Root rot disease (basal stem rot) is a disease of plants, mainly showing a condition in which the vitality of the plant decreases due to invasion of young roots. Plants infected with root rot show atrophy, growth is sluggish, fruits are small, yield is reduced, and when the disease progresses severely, leaves degenerate, slowly wither, and die later. Pathogens are known to be microorganisms of the genus Ganoderma, and are known to occur when pathogens invade the roots of plants.

In Malaysia, where the oil palm industry is active, economic losses due to root rot caused by microorganisms in the genus Ganoderma are very large, and the scale is known to reach $46 million per year. Accordingly, there is a need to develop a marker capable of diagnosing root rot that can be used in industrial fields.

In this regard, conventionally, a technique for diagnosing ginseng root rot is known (Korean Patent Registration No. 10-1570792), but this is a method for detecting Cylindrocarpon destructans , which is a pathogen of ginseng root rot, to diagnose root rot caused by microorganisms in Ganoderma Markers for are not yet developed.

Under this background, the present application was completed by discovering a sequence specifically possessed by microorganisms in the genus Ganoderma, which is the main pathogen of root rot, and developing a novel marker capable of detecting microorganisms in the genus Ganoderma from this.

One object of the present application is to provide a composition for diagnosing root rot disease.

Another object of the present application is to provide a kit for diagnosing root rot disease comprising the composition.

Another object of the present application is to provide a chip for diagnosing root rot including the composition.

Another object of the present application is to provide a method for diagnosing root rot.

Another object of the present application is to provide a composition for detecting microorganisms in the genus Ganoderma.

Another object of the present application is to provide a method for detecting microorganisms in the genus Ganoderma.

Hereinafter, the content of the present application will be described in detail. Meanwhile, the description and embodiment of one aspect disclosed in the present application may be applied to the description and embodiment of other aspects with respect to common matters. In addition, all combinations of various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.

An aspect of the present application for achieving the above object provides a composition for diagnosing root rot disease.

In one embodiment, the composition comprises a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or an agent capable of detecting a fragment thereof. It may be a composition for diagnosing root rot disease, but is not limited thereto.

Specifically, the gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof is a gene specifically possessed by microorganisms in the genus Ganoderma , or a fragment thereof It may be, and may be mixed with a marker for detecting microorganisms in the genus Ganoderma.

In the present application, "marker capable of detecting microorganisms in the genus Ganoderma" or "marker" refers to a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, Or a fragment thereof, as a sequence that is specifically present only in microorganisms of the genus Ganoderma, and refers to a sequence capable of determining whether or not a microorganism of genus Ganoderma is present in a sample by determining the presence or absence of the sequence. When using the marker of the present application, it is possible to quickly and accurately determine whether the collected sample is contaminated by microorganisms in the genus Ganoderma. The markers provided in the present application may have a certain level of homology to each other or share a specific core sequence of microorganisms of the genus Ganoderma, but are not limited thereto.

In the present application, "gene represented by the nucleotide sequence of SEQ ID NO: 1" is one of genes having a sequence specifically found in microorganisms of the genus Ganoderma, and the microorganism of genus Ganoderma is in a sample (soil) according to the presence or absence of the gene. You can check whether it exists or not. In addition, "a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1" is a gene that has 80% or more homology or identity to the nucleotide sequence of SEQ ID NO: 1, and is represented by the nucleotide sequence of SEQ ID NO: 1 Likewise, it has a sequence that is specifically found in microorganisms of the genus Ganoderma, and it is possible to check whether or not a microorganism of genus Ganoderma is present in a sample (soil) according to the presence or absence of the gene. Specifically, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1 may have 80%, 85%, 90%, or 95% or more homology, and more specifically, SEQ ID NO: 2 to It may include the base sequence of any one of 9, but is not limited thereto.

In the present application, even if a gene or protein is described as having a nucleotide sequence or amino acid sequence of a specific sequence number, if it has the same or corresponding activity as a gene or protein composed of the nucleotide sequence or amino acid sequence of the corresponding sequence number, As long as it is specifically present in the microorganism of the genus Ganoderma of interest, it is obvious that genes or proteins having a sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added can also be used in the present application.

In addition, at least 80% homology or identity with a nucleotide sequence or amino acid sequence represented by a specific sequence number or an abnormality that has the same or corresponding activity as a gene or protein of a nucleotide sequence or amino acid sequence represented by a specific sequence number ( identity) may also be included in the scope of the present application, but is not limited thereto. Specifically, it may have homology or identity of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more with the nucleotide sequence or amino acid sequence of a specific sequence number, and the corresponding It is obvious that sequences in which some sequences are deleted, modified, substituted or added are also included in the scope of the present application, as long as they are exhibiting efficacy or activity and are specifically present in the microorganism of the genus Ganoderma of interest.

In the present application, the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related to each other, and may be expressed as a percentage.

The terms homology and identity can often be used interchangeably.

The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and a default gap penalty established by the program used can be used together. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the sequence full or full-length in medium or high stringent conditions. Or it can hybridize to 90% or more. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, as performed in the Needleman program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST, or ClustalW of the National Center for Biotechnology Information.

The homology, similarity or identity of a polynucleotide or polypeptide can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program. In summary, the GAP program defines the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps. Thus, as used in this application, the term “homology” or “identity” refers to relevance between sequences.

In the present application, "fragment" refers to a partial sequence of a gene having a specific sequence, specifically, a gene represented by the nucleotide sequence of SEQ ID NO: 1, and at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 It refers to a sequence of a partial region that can be used for detecting microorganisms in the genus Ganoderma by including a sequence specific to a microorganism in the genus Ganoderma while being a partial sequence of a gene having The sequence or length is not limited as long as it is a partial sequence of a gene represented by the nucleotide sequence of SEQ ID NO: 1 and a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 and can detect microorganisms in the genus Ganoderma. , It is obvious that an insignificant sequence is added to both ends of the fragment or a sequence in which some sequences are substituted is also included in the scope of the present application. Specifically, the fragment may include the nucleotide sequence of any one of SEQ ID NOs: 10 to 12, but is not limited thereto.

Specifically, the marker of the present application may include any one of SEQ ID NOs: 1 to 12, and more specifically, the marker of the present application may be composed of any one of SEQ ID NOs: 1 to 12. , Is not limited thereto.

In the present application, the "detectable agent" includes any agent generally used to detect a gene in the art, and not only an agent that detects the entire sequence of the marker, but also detects a part of the marker. It means a formulation that can be identified. In the present application, the detectable agent may mean an agent capable of amplifying and detecting the marker of the present application, but is not limited thereto, and specifically, a probe, a primer pair, an antibody, an aptamer, and It may be any one selected from the group consisting of oligonucleotides, but is not limited thereto.

In the present application, "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be detected, and may serve as a starting point for the synthesis of a primer extension product. In the present application, primers may be prepared to be used for detection of a marker through a PCR reaction, and the specific length and sequence of the primers are used conditions such as temperature and ionic strength as well as the complexity of the required DNA or RNA target. According to the method known in the art can be synthesized. Specifically, the primer pair may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 13 and 14, but is not limited thereto.

In addition, the "probe" of the present application is a probe that can be prepared from a specific gene sequence by a known method, for example, as long as it can be hydrated under stringent conditions with a complementary sequence for all or part of the nucleotide sequence. It may be included without limitation in the scope of the application. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, between genes with high homology or identity, 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, Particularly, under the condition that genes with 99% or more homology or identity are hybridized, and genes with lower homology or identity are not hybridized, or at 60°C, which is a washing condition for common southern hybridization , 1 X SSC, 0.1% SDS, specifically 60° C., 0.1 X SSC, 0.1% SDS, more specifically 68° C., 0.1 X SSC, at a salt concentration and temperature corresponding to 0.1% SDS, once, specifically Conditions for washing 2 times to 3 times can be listed as examples.

Hybridization requires that two nucleic acids have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.

The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

In the present application, "diagnosis" refers to a process of determining whether root rot has occurred due to contamination by microorganisms in the genus Ganoderma. Using the composition of the present invention, it is possible to check whether a sequence specific to the microorganism genus Ganoderma is present in the sample.

The composition for diagnosing root rot disease of the present application is a specific marker of microorganisms in the genus Ganoderma, that is, a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or The composition may be a composition capable of determining whether a fragment is present in the collected sample and diagnosing whether the sample is contaminated by microorganisms in Ganoderma genus or whether a root rot disease has occurred, but is not limited thereto.

Specifically, the root rot disease may be caused by microorganisms in the genus Ganoderma in the oil palm tree, and the plant that causes the root rot disease may be Elaeis guineensis, Elaeis oleifera, Attalea maripa, etc., but is not limited thereto.

In the present application, "Ganoderma genus microorganism" is a microorganism belonging to fungi, and has been traditionally used as a medicine in Asia. In the present application, focusing on the fact that the microorganisms of the genus Ganoderma are the causative bacteria of root rot, a marker capable of specifically detecting the microorganisms is provided. Specifically, the microorganisms of the genus Ganoderma are Ganoderma alba, Ganoderma annularis, Ganoderma atrum, Ganoderma aurea, and Ganoderma austral. ), Ganoderma amboinense, Ganoderma applanatum, Ganoderma boninense, Ganoderma brownie, Ganoderma colossus, Ganoderma colossus Ganoderma cupreum, Ganoderma curtisii, Ganoderma formosanum, Ganoderma incrassatum, Ganoderma lobatum, Ganoderma lobatum, Ganoderma lucidum Ganoderma lucidum), Ganoderma meredithiae, Ganoderma miniatocinctum, Ganoderma multipileum, Ganoderma nigrolucidum, Ganoderma nigrolucidum, Ganoderma Ganoderma orbiforme), Ganoderma oregonense, Ganoderma purpurea, Ganoderma pfeifferi, Ganoderma philippii, Ganoderma pseudoferreum , Ganoderma resinaceum, Ganoderma rubra, Ganoderma sichuanense, Ganoderma sinense, Ganoderma steyaertanum (Ganoderma steyaertanum), Ganoderma tornatum, Ganoderma tsugae, Ganoderma viridis, Ganoderma weberianum, and Ganoderma zonatum It may be selected from the group consisting of, but is not limited thereto.

Another aspect of the present application provides a kit for diagnosing root rot disease.

In one embodiment, it provides a kit for diagnosing root rot disease comprising the composition. Specifically, the kit may include an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, The kit for diagnosing root rot disease of the present application may be used to check whether a microorganism of the genus Ganoderma is present in a soil sample collected at the site.

Specifically, the kit may be selected from the group consisting of an RT-PCR kit, an immune strip, a DNA chip kit, a protein 　 chip 　 kit, a rapid 　 kit 　 or a MRM (multiple reaction monitoring) 　 kit, and an ELISA 　 diagnosis kit, As long as it can be ascertained whether or not microorganisms in the genus Ganoderma exist, they are not limited to the principle or form of their operation.

In addition, the kit of the present application may include one kind or more other components 　 composition, solution, or device suitable for diagnosing root rot disease, but is not limited thereto. Examples of the other components include, but are not limited to, a suitable carrier, a labeling substance capable of generating a detectable signal, a chromophores, a solubilizing agent, a detergent, a buffering agent, a stabilizer, and the like. When the labeling material is an enzyme, a substrate capable of measuring enzyme activity and a reaction terminator may be included. The carrier includes a soluble carrier, an insoluble carrier, and an example of a soluble carrier includes a physiologically acceptable buffer solution known in the art, for example, PBS, and an example of an insoluble carrier includes polystyrene, polyethylene, polypropylene, polyester, poly Polymers such as acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, and magnetic particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof may be used, but are not limited thereto.

In addition, the kit of the present application may include a primer pair for detection of a marker, and a reagent for performing a detection reaction, but is not limited thereto. In addition, the kit of the present application may additionally include reagents required for an amplification reaction performed for marker detection, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, and further , It may further include reagents necessary for real-time PCR reaction performance and analysis.

In addition, the kit of the present application may further include a user's guide that describes the optimum reaction performance conditions. The guide is a handout explaining how to use the kit, e.g., how to prepare the PCR buffer, and the reaction conditions presented. The guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

Another aspect of the present application provides a chip for diagnosing root rot.

In one embodiment, it provides a chip for diagnosing root rot disease comprising the composition. The chip may include an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, and specifically, The chip may be a DNA 　 chip or a protein 　 chip.

The DNA chip may include a substrate to which a marker gene for detecting microorganisms in the genus Ganoderma or cDNA corresponding to a fragment thereof or an oligonucleotide is attached, and reagents, preparations, and enzymes for producing a fluorescently labeled probe And the like may additionally be included. In addition, the substrate may include a cDNA or oligonucleotide corresponding to a control gene or a fragment thereof, but is not limited thereto.

The protein chip includes an antibody that specifically recognizes a gene represented by the nucleotide sequence of SEQ ID NO: 1 of the present application, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof. However, it is not limited thereto.

Another aspect of the present application provides a method for diagnosing root rot.

In one embodiment, comprising the step of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample, Provides a method for diagnosing root rot. The gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1 may include any one nucleotide sequence of SEQ ID NOs: 2 to 9, and the fragment is any one nucleotide sequence of SEQ ID NO: 10 to 12 It may include, but is not limited thereto.

The sample may be used without limitation as long as it is possible to determine contamination by microorganisms in Ganoderma genus, but may be soil, plants, etc. In the case of a soil sample, the sample collection depth, collection method, etc. are not limited.

In addition, the detection is reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time polymerase reaction (real time RT-PCR), real time reverse transcriptase polymerase reaction (real time). quantitative RT-PCR), RNase protection method (RNase protection method), Northern blotting (Northern blotting), gene chip, and may be performed by a method selected from the group consisting of a combination thereof, but is not limited thereto.

As an example of the diagnosis method of the present application,

(a) taking a sample;

(b) separating genomic DNA from the sample; And

(c) Using the isolated genomic DNA as a template, it may include the step of detecting the marker by performing real-time PCR using a primer set for detecting the marker of the present application, but is not limited thereto.

In addition, the diagnostic method of the present application further comprises the step of (d) detecting the marker of the present application in the control sample, or (e) the marker of the present application detected in the control sample and in step (c) It may be to further include a step of comparing the detection result of the marker in the confirmed sample, but is not limited thereto. The marker detection method of the present application may be to detect the amplified marker after amplifying the marker, but is not limited to a specific method as long as it is a marker detection method known in the art. The detection result may be the amount of the amplified gene or fragment thereof, but is not limited thereto.

The control sample may be a sample in which microorganisms in Ganoderma do not exist, or a sample in which root rot disease does not occur, but is not limited thereto.

Further, the diagnostic method of the present application is (f) comparing the amount of the amplified gene or fragment thereof in the control sample and the sample, and when the amount of the gene or fragment thereof specifically possessed by the microorganism genus Ganoderma increases, root rot disease It may further include a step of diagnosing as having a disease, but is not limited thereto.

In the present application, a method of separating genomic DNA from a sample or a microorganism contained in a sample may be performed using a method known in the art, for example, the CTAB method or the wizard prep kit (Promega). have. Using the separated genomic DNA as a template, a target sequence can be amplified by performing an amplification reaction using a primer. Methods of amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, and There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

Real-time PCR is a method of monitoring the progress of PCR in real time in order to compare each PCR within an exponentially increasing range. The real-time PCR method, a DNA quantification technique, is a method of quantifying the amount of target DNA present in the first sample by observing the generation process of PCR amplified products in real time using a device in which a thermal cycler and a spectrophotometer are integrated. . Real-time PCR replaces the existing microbial qualitative and quantitative method, which had no choice but to be based on microbial cultivation, and enables qualitative and quantification of microorganisms without performing 　 separation and cultivation of microorganisms.

The real-time PCR method is divided into absolute quantification and relative quantification analysis. In order to quantify the target DNA in a sample, preparation of a standard curve (standard curve) is an essential factor. Quantitative real-time PCR is performed simultaneously on the standard and unknown samples to derive a calibration curve from the standard sample, and then the amount of target DNA in the unknown sample is quantified from the calibration curve. At this time, the calibration curve from the standard sample (x-axis: concentration of the standard sample, y-axis: threshold cycle number (CT; threshold cycle)) is ideal as the correlation index (R ² ) is closer to 1 and the slope is closer to -3.33. . "Quantitative PCR" refers to PCR for quantifying the amount of template DNA at the start of the amplification reaction, and means PCR capable of confirming amplification of a molecule to be amplified at any time point during the reaction. For quantification, in general, such PCR is combined with a calibration curve that correlates the number of template DNA molecules at the initiation of the reaction and a signal serving as an indicator of the amplification. This calibration curve can be produced using a standard sample with a known number of molecules. The calibration curve is based on the calibration curve prepared from the amplification of the standard sample by performing quantitative real-time PCR using a gene or marker of a microorganism in Ganoderma genus to be quantified as a standard sample, and using a primer to specifically amplify it. It may be to confirm the number of threshold cycles (CT) of the target gene or marker.

In addition, the amplified target sequence may be labeled with a detectable labeling substance. The label 　 material may preferably be a fluorescent substance 　, but is not limited thereto. The detection chemistry currently used in real-time PCR is generally divided into a non-specific method using Sybr Green I and a specific method using a hybridization probe. Sybr Green I non-specifically binds to double-stranded DNA to emit fluorescence, and a real-time PCR instrument measures the amount of this fluorescence to confirm the amount of DNA. The hybridization probe specifically hybridizes to a complementary nucleotide sequence and emits fluorescence during the PCR reaction. For example, as a representative hybridization probe, a taqman probe (dual labeled fluorogenic probe) has a fluorescent reporter at the 5'-end and a quencher at the 3'-end. When the fluorescence reporter of the Taqman probe is present in close proximity to the quencher, fluorescence is canceled and thus not detected. When the Taqman probe is hybridized to a specific target sequence and PCR amplification proceeds, the Taqman probe is decomposed by the 5'-3' exonuclease activity of Taq DNA polymerase, and a fluorescent reporter is released freely. As it moves away from the quencher, it emits fluorescence. By measuring this, the amount of generation of the target DNA fragment is monitored in real time.

Specifically, the primer pair used in the method of the present application may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 13 and 14, and the step of detecting a gene or fragment thereof in the method of the present application may be performed with the nucleotide sequences of SEQ ID NOs: 13 and 14. It may be carried out through PCR (polymerase chain reaction) using the formed primer pair, but is not limited thereto.

Another aspect of the present application provides a composition for detecting microorganisms in the genus Ganoderma.

In one embodiment, the gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, including an agent capable of detecting, Ganoderma genus It provides a composition for detecting microorganisms.

The composition for detecting microorganisms in the genus Ganoderma of the present application may be used to determine whether a sample (eg, soil) is contaminated by microorganisms in the genus Ganoderma, and specifically, may be used to detect the marker of the present application. .

Another aspect of the present application provides a method for detecting microorganisms in the genus Ganoderma.

In one embodiment, comprising the step of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample, Provides a method for detecting microorganisms in the genus Ganoderma

The method for detecting microorganisms in Ganoderma genus of the present application may be to detect whether or not a microorganism in genus Ganoderma is present in a sample using the marker or composition of the present application, but is not limited thereto.

The marker capable of specifically detecting the Ganoderma boninense bacteria of the present application can directly detect microorganisms in the genus Ganoderma in soil. Through this, it can be used to prevent and treat root rot caused by contamination of the microorganisms, and industrial use in oil palm farms can be expected.

1 is a diagram showing the result of detecting Ganoderma boninense bacteria as a marker of the present application in Malaysian soil.

Hereinafter, the present application will be described in detail with reference to examples, but this is only for helping understanding of the present application, and the scope of the present application is not limited thereto.

Example 1: Sequence extraction and specific marker discovery of Ganoderma bacteria

The present inventors attempted to discover a marker capable of specifically detecting a microorganism of the genus Ganoderma, which is known as the main cause of root rot.

Thus, among microorganisms of the genus Ganoderma, Ganoderma boninense G3 (GCA_002900995.2) , Ganoderma boninense NJ3 (GCA_001855635.1) , Ganoderma lucidum BCRC (GCA_000338035.1) , Ganoderma Tsugae (GCA_003057275.1) , Ganoderma lucidum Xiangnong5.1) , Ganoderma lucidum G260125 (GCA_000271565.1) , Ganoderma sinense (GCA_002760635.1) microorganisms obtained DNA sequences from a known NCBI site, and Ganoderma boninense directly obtained the DNA sequence of the microorganism, and from the obtained sequence, microorganisms of the genus Ganoderma were obtained. Specific markers for detection were discovered and developed.

Specifically, the DNA sequence (2,544contig, 95,911,849bp) of the Ganoderma boninense strain obtained by the present inventors through NGS (Next Generation Sequencing) sequencing, and nt of NCBI (https://www.ncbi.nlm.nih.gov/) The DNA sequence of the microorganism of the genus Ganoderma known in the database (as of May 2018, 178,448,606,127bp) and the DNA sequence of the fungi strain other than the genus Ganoderma (2,391 strains, 80,288,864,015bp) information were obtained.

Thereafter, among the soil samples obtained by the present inventors, as a result of metagenome analysis, the gDNA sequence of the soil, which was confirmed to be free of microorganisms in the genus Ganoderma, was obtained through NGS (7,724,586,454bp).

Subsequently, among microorganisms of the genus Ganoderma, microorganisms not belonging to the genus Ganoderma, and microbial sequences obtained from soil DNA in Malaysia, a marker specific to the microorganism of the genus Ganoderma was discovered (Table 1).

Sequence number microbe Identity One CJ Ganoderma boninense - 2 Ganoderma boninense G3 99% 3 Ganoderma boninense NJ3 99% 4 Ganoderma lucidum BCRC 86% 5 Ganoderma Tsugae 88% 6 89% 7 Ganoderma lucidum Xiangnong 87% 8 Ganoderma lucidum G260125 87% 9 Ganoderma sinense 91%

It was confirmed that the microorganism-specific marker of the genus Ganoderma represented by the nucleotide sequence of SEQ ID NO: 2 to 9 has at least 86% identity with the marker sequence of SEQ ID NO: 1.

Example 2: Diagnosis of root rot disease using Ganoderma specific marker

Using the markers obtained in Example 1, it was confirmed whether microorganisms in the genus Ganoderma could be directly detected in the soil.

To this end, primers for detecting the markers of SEQ ID NOs: 1 to 9 of the present application were prepared, and the regions within the microorganism-specific sequence of the genus Ganoderma to which the primers bind are shown in Table 2 below.

Sequence number microbe 10 Ganoderma boninense G3 11 Ganoderma boninense 12 Ganoderma boninense NJ3

Primer information for detecting a partial region of SEQ ID NOs: 10 to 12 is shown in Table 3 below.

Sequence number order 13 Forward GTCCATGTTTGGGACTTTCACT 14 Reverse ATCAGCTGTGACCACACAAGT

Using a pair of primers consisting of the nucleotide sequences of SEQ ID NOs: 13 and 14, it was confirmed whether infection by Ganoderma bacteria in soil could be diagnosed.

Specifically, 300-500 ng of soil DNA obtained from soil samples contaminated with Ganoderma boninense collected in Malaysia (lanes 6 and 7 in FIG. 1) or 1-20 ng of genomic DNA (fungi other than G. boninense or Ganoderma genus microorganisms) Into the AccuPowr® PriFi Taq PCR PreMix tube, 10 pmol/uL of primers of SEQ ID NOs: 13 and 14 were added. Thereafter, distilled water was added to make the total volume 20uL, and the blue pellet was well dissolved and then spin down. After that, after setting on a thermocycler, PCR was performed under the following conditions.

After 5 minutes at 95°C, cycle 30-50 cycles at 95°C for 20 seconds, 60°C for 30 seconds, and 68°C for 1 minute. After that, it was placed at 68° C. for 5 minutes.

Temperature time Cycles 95°C 5 minutes 1cylces 95°C 20 seconds 30~50cylces 60°C 30 seconds 68°C 1 min 68°C 5 minutes 1cylces

After the completion of the PCR reaction, it was maintained at 4°C, and all 20uL was loaded onto a 1% agrose gel to analyze the PCR product by electrophoresis. From the obtained PCR product, the presence or absence of microorganisms in the genus Ganoderma was confirmed, and the degree of contamination of the soil by the Ganoderma bacteria was confirmed from the band intensity of the PCR product (FIG. 1).

Each lane of FIG. 1 represents as follows. Lane 1 is a DNA ladder, lane 2 is a PCR product using Ganoderma boninense Genomic DNA; Lane 3 is a PCR product using Genomic DNA of a Vercandera microorganism (Bjerkandera sp.); Lane 4 is a PCR product using the Fusarium microorganism (Fusarium sp.) Genomic DNA; Lane 5 is a PCR product using a Trichoderma microorganism (Trichoderma sp.) genomic DNA; Lane 6 is a PCR product using soil DNA in which root rot has occurred; Lane 7 is a PCR product using soil DNA in which root rot has occurred; Lane 8 shows the PCR product (negative control) proceeded with only water.

From the results of FIG. 1, it was confirmed that root rot caused by Ganoderma bacteria can be detected using the marker of the present application.

From the above-described examples, the present inventors not only discovered novel markers specifically possessed by microorganisms in the genus Ganoderma, but also confirmed that it is possible to diagnose whether or not root rot infection is caused by Ganoderma bacteria in soil.

From the above description, those skilled in the art to which the present application belongs will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including the meaning and scope of the claims to be described later rather than the above detailed description, and all changes or modifications derived from the equivalent concepts within the scope of the present application.

<110> CJ CheilJedang Corporation <120> A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same <130> KPA181334-KR <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 4072 <212> DNA <213> Unknown <220> <223> CJ Ganoderma boninense <400> 1 gtccttctac gacgacggct atggcttgga cggcgaggtg gaggaggagt acgaggagat 60 cacgcaagaa gactgctgga cggtcatttc cagctttttc gaccagaagg gtcttgtcag 120 gcagcaacta gactcctttg acgaattcgt ccaaaatact atgcaggagc ttgtggacga 180 aaactcggac ctcatcctcg accaggcgga ccagcacacc ggccacgacg gagacgtaac 240 acgtcgctat gagatcaagt tcgggcagat ttacctctca cggccaaccg tcacggaggc 300 ggatggtgct gtggttcccg ttttccctca ggaggcccgt ttgcgaaacc tcacgtactc 360 cgcgccattg tacatcgaaa tgaagaagag ggtcctgatc ggaagggagg atcatgatgg 420 gagcggggat atggtttggg aagtgcagcg ggacgacgat cctgaggaca ccaggaaagt 480 gtggattggc aaggtatgtc atatgagtcc atgtttggga ctttcacttc acagtcgtcg 540 gtccaggtgc ccatcatgct gcggtccaca tactgtatcc tccacgagct tggcgaaaag 600 gagctgttcg atctcaacga gtgtccctac gactccggag gatatttcat tatcaacggt 660 tctgagaagg tactcattgc ccaagagcgt atggcgacaa accacgtcta cgtcttcgcc 720 aaggcacagc cttccccgat cagtttcctc gccgagattc gaagtgcggt cgagaagggt 780 gggaagacca tcagccagtt ccaggttaag ctttaccata ggagccagga gcgttcggta 840 cgtggcatgt cttttgtgct tgcgcaaccg ccgtagcaaa gccccttacc ctgtttcaca 900 gctcgggaat gtaatgaagg ctacaattcc ctacatcaag gtcgacatcc ctatctgggt 960 cgtcttccgc gcgctggggg tcatctcaga ccgcgacatc ctggaacata tctgctatga 1020 tatgcaggac aaccagatgc tcgagatgct gaagccttgt atcgacgagg gtttcgttat 1080 tcaggaccgc gaggttggtg gggacgtttt gcatcgggaa ctctttgttg aatctttttt 1140 agattgcact ggactacatc ggtaatcgtg ggacgacaac aggcttgaac cgcgaacgtc 1200 gtctgcgtta cgcacaagag atccttcaga aggaaatgct gccccacgtc tccatggcag 1260 agggttctga gtccaagaag gcgtacttct tcggctatat gatccatcgt ctcctgctcg 1320 ctgctttgga acggagagac ctcgacgatc gcgatcactt cggtaaaaag cgccttgatc 1380 ttgcgggccc acttctcgcc aacctgttcc gcatgttgtt ccgcaagctt accaaggatg 1440 tataccgcta ccttcagaag gtgagccatt atacttgtgt ggtcacagct gatattaaca 1500 tgccgtttcg tagtgtgtcg agacgcacaa agagttcaat atctcactcg cggtcaagca 1560 caataccatt accaacggcc tgaagtactc tctcgcaact ggtaactggg gagaccagaa 1620 aaagtcgatg tcgtcgaagg ctggcgtctc gcaagtgctc aaccggtaca cctatgcatc 1680 gacgctgtcc cacttgcgcc gttgtaatac acctcttggc cgcgaaggga agatcgcaaa 1740 accccgtcag ctacacaaca ctcactgggg tatggtctgt cctgcggaga cgccagaagg 1800 acaggcgtgc ggtctcgtca agaacttgtc tctgatgtct tgcatttctg tcggtaccct 1860 ctcagcgccc gtcatcgagt tcttggagga atggggtctg gagtctctgg aagagaacgc 1920 tcacgcttca acgccatgca cgaaggtctt cgtgaatggc gtctggatgg gtgtccaccg 1980 agatcctgta aagcttgtca gcacgctcag gaagctccgc cgcaaagacg acatcaactg 2040 cgaagtatcc gttgttcgtg atatccgaga acgggagctc cgtctctata cggacgccgg 2100 tcgtgtctgc aggcctctct tcatcgtcga gaaccagcag ctcctcatcc agaagaaaca 2160 catcgaaagc ctagttcgtg cgaaggacga cccgacgtta tcttacaact gggacagcct 2220 cctcaaggac ggtgtcatcg agctgctaga tgccgaggaa gaggagacgg tcatgatctc 2280 tatgacgcct gaggatttgg agaactcaag gcttcagtct gcgggtatgc atgcggagga 2340 cgagaacgac gacccctcag ctcgattaaa ggcggccacc tccgcgcata cctggacgca 2400 ttgcgagatt caccctagca tgatcttggg tgtttgtgct agtatcattc ccttccccga 2460 ccataaccag gtaagattag gctacgaact caacccccag tcaagttact gacatacgtg 2520 tagtcccctc gtaatacgta ccagtccgcc atgggcaaac aagccatggg catcttcctc 2580 acaaacttcc tcatccggat ggacacgatg gcgaacatcc tctactaccc gcagaagcca 2640 ctggccacca cccgttccat ggaatacctc cgcttccgag agttgcctgc tggtcagaac 2700 gccatcgttg ctattctgtg ctacagtggt tacaaccagg aagattccgt catcatgaac 2760 cagagctcca tcgaccgagg tctgttccgt agtatttatt atcggagtta tatggacctg 2820 gagaagaaga gcggagttca gcagttggag gagttcgaaa aacccactcg tgacaccaca 2880 ttgcggatga aacacggaac gtacgacaag cttgaagacg atggtctcat cgcgcccggg 2940 acgaacgtca acggcgagga catcatcatc ggtaaaactg cccccatccc tccagacagc 3000 gaggagcttg gccagcggac tcgaacgcac acgaagcgcg acgtctcgac accgctgaag 3060 agtactgagc agggtatcgt tgaccaggtg ctcattacca caaacgcgga gggtcagaag 3120 ttcgtgaaga tccgtgtacg ttccacccgt ataccgcaga tcggcgacaa gttcgcatcg 3180 cgtcacggcc agaagggtac gatcggtatc acctaccgcc aggaggacat gccgttcacg 3240 gcggaaggta tcacccccga catcatcatc aacccccacg ccattccatc tcgtatgaca 3300 atcggccact tggtcgagtg tctgctctcc aagcttgcga cgctcatcgg aaacgaggga 3360 gatgcaactc ccttcacgga cctcactgtc gagtccgtct cgcagttcct tcgccagaag 3420 ggctaccact cgcgaggtct tgaggtcatg taccacggcc acaccggacg caagttgcaa 3480 gcacaggtct acctcggtcc gacctactac cagcgtctca agcacatggt ggacgacaag 3540 atccactcac gtgcgcgtgg cccagtgcag atcctcacgc gtcagccagt cgagggtcgt 3600 agtcgcgacg gtggtctgcg gtttggggag atggagcgtg attgtatgat ttcgcatggt 3660 gtggcagcgt tcttgaagga gcgtctgttc gaggccagcg atgcctaccg actgcatgtc 3720 tgtgatatgt acgtccacac atggccgtca ctgccctact ggctactaat gttctcttct 3780 acagatgtgg tcttaccgcc atcgccaacc tggtcggtat tttagccaag ttctgtctca 3840 tagacgctaa ccactttcac agaaaaagca aacgtttgaa tgccgagcgt gcaagaacaa 3900 gactgcatgt tcacagatct acattcctta tgccgcgaag ctgctcttcc aggtgaggat 3960 tgctcattat ttggactgct cattcctggt tgacaacgct ccctaggaat tgcaatccat 4020 gaatatcgca gcacggttgt acacgacatc cacaggacgg attcgggatt aa 4072 <210> 2 <211> 4082 <212> DNA <213> Unknown <220> <223> Ganoderma boninense G3 <400> 2 gtccttctac gacgacggct atggcttgga cggcgaggtg gaggaggagt acgaggagat 60 cacgcaagaa gactgctgga cggtcatttc cagctttttc gaccagaagg gtcttgtcag 120 gcagcaacta gactcctttg acgaattcgt ccaaaatact atgcaggagc ttgtggacga 180 aaactcggac ctcatcctcg accaggcgga ccagcacacc ggccacgacg gagacgtaac 240 acgtcgctat gagatcaagt tcgggcagat ttacctctca cggccaaccg tcacggaggc 300 ggatggtgct gtggttcccg ttttccctca ggaggcccgt ttgcgaaacc tcacgtactc 360 cgcgccattg tacatcgaaa tgaagaagag ggtcctgatc ggaagggagg atcatgatgg 420 gagcggggat atggtttggg aagtgcagcg ggacgacgat cctgaggaca ccaggaaagt 480 gtggattggc aaggtatgtc atatgagtcc atgtttggga ctttcacttc acagtcgtcg 540 gtccaggtgc ccatcatgct gcggtccaca tactgtatcc tccacgagct tggcgaaaag 600 gagctgttcg atctcaacga gtgtccctac gactccggag gatatttcat tatcaacggt 660 tctgagaagg tactcattgc ccaagagcgt atggcgacaa accacgtcta cgtcttcgcc 720 aaggcacagc cttccccgat cagtttcctc gccgagattc gaagtgcggt cgagaagggt 780 gggaagacca tcagccagtt ccaggttaag ctttaccata ggagccagga gcgttcggta 840 cgtggcatgt cttttgtgct tgcgcaaccg ccgtagcaaa gccccttacc ctgtttcaca 900 gctcgggaat gtaatgaagg ctacaattcc ctacatcaag gtcgacatcc ctatctgggt 960 cgtcttccgc gcgctggggg tcatctcaga ccgcgacatc ctggagcata tctgctatga 1020 tatgcaggac aaccagatgc tcgagatgct gaagccttgt atcgacgagg gtttcgttat 1080 tcaggaccgc gaggttggtg gggacgtttt gcatcgggaa ctctttgttg aatctttttt 1140 agattgcact ggactacatc ggtaatcgtg ggacgacaac aggcttgaac cgcgaacgtc 1200 gtctgcgtta cgcacaagag atccttcaga aggaaatgct gccccacgtc tccatggcag 1260 agggttctga gtccaagaag gcgtacttct tcggctatat gatccatcgt ctcctgctcg 1320 ctgctttgga acggagagac ctcgacgatc gcgatcactt cggtaaaaag cgccttgatc 1380 ttgcgggccc acttctcgcc aacctgttcc gcatgttgtt ccgcaagctt accaaggatg 1440 tataccgcta ccttcagaag gtgagccatt atacttgtgt ggtcacagct gatattaaca 1500 tgccgtttcg tagtgtgtcg agacgcacaa agagttcaat atctcactcg cggtcaagca 1560 caataccatt accaacggcc tgaagtactc tctcgcaact ggtaactggg gagaccagaa 1620 aaagtcgatg tcgtcgaagg ctggcgtctc gcaagtgctc aaccggtaca cctatgcatc 1680 gacgctgtcc cacttgcgcc gttgtaatac acctcttggc cgcgaaggga agatcgcaaa 1740 accccgtcag ctacacaaca ctcactgggg tatggtctgt cctgcggaga cgccagaagg 1800 acaggcgtgc ggtctcgtca agaacttgtc tctgatgtct tgcatttctg tcggtaccct 1860 ctcagcgccc gtcatcgagt tcttggagga atggggtctg gagtctctgg aagagaacgc 1920 tcacgcttca acgccatgca cgaaggtctt cgtgaatggc gtctggatgg gtgtccaccg 1980 agatcctgta aagcttgtca gcacgctcag gaagctccgc cgcaaagacg acatcaactg 2040 cgaagtatcc gttgttcgtg atatccgaga acgggagctc cgtctctata cggacgccgg 2100 tcgtgtctgc aggccctctc ttcatcgtcg agaaccagca gctcctcatc cagaagaaac 2160 acatcgaaag cctagttcgt gcgaaggacg acccgacgtt atcttacaac tgggacagac 2220 agcctcctca aggacggtgt catcgagctg ctagatgccg aggaagagga gacggtcatg 2280 atctctatga cgcctgagga tttggagaac tcaaggcttc agtctgcggg tatgcatgcg 2340 gaggacgaga acgacgaccc ctcagctcga ttaaaggcgg ccacctccgc gcatacctgg 2400 acgcattgcg agattcaccc gagcatgatc ttgggtgttt gtgctagtat cattcccttc 2460 cccgaccata accaggtaag attaggctac gaactcaacc cccagtcaag ttactgacat 2520 acgtgtagtc ccctcgtaat acgtaccagt ccgccatggg caaacaagcc atgggcatct 2580 tcctcacaaa cttcctcatc cggatggaca cgatggcgaa catcctctac tacccgcaga 2640 agccactggc caccacccgt tccatggaat acctccgctt ccgagagttg cctgctggtc 2700 agaacgccat cgttgctatt ctgtgctaca gtggttacaa ccaggaagat tccgtcatca 2760 tgaaccagag ctccatcgac cgaggtctgt tccgcagtat ttattatcgg agttatatgg 2820 acctggagaa gaagagcgga gttcagcagt tggaggagtt cgaaaaaccc actcgcgaca 2880 ccacattgcg gatgaaacac ggaacgtacg acaagcttga agatgatggt ctcatcgcgc 2940 ccgggacgaa cgtcaacggc gaggacatca tcatcggtaa aactgccccc atccctccag 3000 acagcgagga gcttggccag cggactcgga cgcgcacacg aagcgcgacg tctcgacacc 3060 gctgaagagt actgagcagg gtatcgttga ccaggtgctc attaccacaa acgcggaggg 3120 tcagaagttc gtgaagatcc gtgtacgttc cacccgtata ccgcagatcg gcgacaagtt 3180 cgcatcgcgt cacggccaga agggtacgat cggtatcacc taccgtcagg aggacatgcc 3240 gttcacggcg gagggtatca cccctgacat catcatcaac ccccacgcca ttccatctcg 3300 tatgacaatc ggccacttgg tcgagtgtct gctctccaag cttgcgacgc tcatcggaaa 3360 cgagggagat gcaactccct ttacggacct cactgtcgag tccgtctcgc agttccttcg 3420 ccagaagggc taccactcgc gaggtcttga ggtcatgtac cacggccaca ccggacgcaa 3480 gttgcaagca caggtctacc tcggtccgac ctactatcag cgtctcaagc acatggtgga 3540 cgacaagatc cactcacgtg cgcgtggccc agtgcagatc ctcacgcgtc agccagtcga 3600 gggtcgtagt cgcgacggtg gtctgcggtt tggggagatg gagcgtgatt gtatgatttc 3660 gcatggtgtg gcagcgttct tgaaggagcg tctgttcgag gccagcgatg cctaccgact 3720 gcatgtctgt gatatgtacg tccacacatg gcctgttact gccctactgg ctactaatgt 3780 tctcttctac agatgtggtc ttaccgccat cgccaacctg gtcggtattt taaccaagtt 3840 ctgtctcata gacgctaacc gctttcacag aaaaagcaaa cgtttgaatg ccgagcgtgc 3900 aagaacaaga ctgcatgttc acagatctac attccttatg ccgcgaagct gctcttccag 3960 gtgaggattg ctcattattt tggacttgct cattcctggt tgacaacgct ccctaggaat 4020 tgcaatccat gaatatcgca gcacggttgt acacgacatc cacaggacgg attcgggatt 4080 aa 4082 <210> 3 <211> 4068 <212> DNA <213> Unknown <220> <223> Ganoderma boninense NJ3 <400> 3 gtccttctac gacgatggct atggcttgga cggcgaggtg gaggaggagt acgaggagat 60 cacgcaagaa gactgctgga cggtcatttc cagctttttc gaccagaagg gtcttgtcag 120 gcagcaacta gactcctttg acgaattcgt ccaaaatact atgcaggagc ttgtggacga 180 aaactcagac ctcatcctcg accaggcgga ccagcacacc ggccacgacg gagacgtaac 240 acgtcgctac gagatcaagt tcgggcagat ttacctctca cggccgaccg ttacggaggc 300 ggatggtgct gtggtccccg ttttccctca ggaggcccgt ttgcgaaacc tcacgtactc 360 cgcgccattg tacatcgaaa tgaagaagag ggttctgatc ggaagggagg atcatgatgg 420 gagcggggat atggtttggg aagtgcagcg ggacgacgat cctgaggaca ccaggaaagt 480 gtggattggc aaggtatgtc atatgagtcc atgtgcggga ctttcacttc atagtcgtcg 540 gtccaggtgc ccatcatgct gcgatccaca tactgtatcc tccacgagct tggcgaaaag 600 gagctgttcg atctcaacga gtgtccctac gactctggag gatatttcat tatcaacggt 660 tctgagaagg tactcattgc ccaagagcgt atggcgacaa accacgtcta cgtcttcgcc 720 aaggcacagc cttccccgat cagtttcctc gccgagattc gaagtgcggt cgagaagggc 780 gggaaaacca tcagccagtt ccaggttaag ctttaccata ggagccagga gcgttcggta 840 cgtggcatgt cttttgtctt gcgcaaccgc tgtagcaaag cccttacccc gttccacagc 900 tcgggaatgt aatgaaggct acaattccct acatcaaggt cgacatccct atctgggtcg 960 ttttccgcgc gctgggggtc atctcagacc gcgacatatt ggagcatatc tgttatgata 1020 tgcaggacaa ccagatgctc gagatgctga aaccttgtat cgacgagggt ttcgttattc 1080 aggaccgcga ggttggtggg gacgttttgc atcgggaact ctttgttgaa tcttttttag 1140 attgcactgg actacatcgg taatcgtggg acgacaacag gcttgaaccg cgaacgtcgt 1200 ctgcgttacg cacaagagat ccttcagaag gaaatgctgc cccacgtctc catggcagag 1260 ggttctgagt ccaagaaggc gtacttcttc ggctatatga tacatcgtct cctgctcgct 1320 gctttggaac ggagagacct cgacgatcgc gatcacttcg gtaaaaagcg ccttgatctt 1380 gcgggcccac ttctcgccaa cctgttccgc atgttgttcc gcaagcttac caaggatgta 1440 taccgctacc ttcagaaggt gagccattat acttgtgtgg tcaaagctga tattaacatg 1500 ccgttttgta gtgtgtcgag acgcacaaag agttcaacat ctcactcgcg gtcaagcaca 1560 ataccattac caacggcttg aagtactctc tcgcaactgg taactgggga gaccagaaaa 1620 agtcgatgtc gtcgaaggct ggcgtctcgc aggtgctcaa ccggtacacc tatgcatcga 1680 cgctgtccca cttgcgccgt tgcaatacac ctcttggccg cgaagggaag atcgcaaaac 1740 cccgtcagct gcacaacact cactggggta tggtctgtcc tgcggagacg ccagaaggac 1800 aggcgtgcgg tctcgtcaag aacttgtctc tcatgtcttg catctctgtc ggtaccctct 1860 cagcgcccgt catcgagttc ttggaggaat ggggtctgga gtctctggaa gagaacgctc 1920 acgcttcaac gccatgcacg aaggtcttcg tgaatggcgt ctggatgggt gtccaccgag 1980 atcctgtaaa gcttgtcagc acgctcagga agctccgccg caaagacgac atcaactgcg 2040 aagtatccgt tgttcgtgat atccgagaac gggagctccg tctctatacg gacgccggtc 2100 gtgtctgcag gcctctcttc atcgtcgaga accagcagct cctcatccag aagaaacaca 2160 tcgaaagcct agttcgtgcg aaggacgacc cgacgttatc ttacaactgg gacagcctcc 2220 tcaaggacgg tgtcatcgag ctgctagatg ccgaggaaga ggagacggtc atgatctcta 2280 tgacgcctga ggatttggag aactcaaggc ttcagtctgc gggtatgcat gcggaggacg 2340 agaacgacga cccctcagct cgattaaagg cggccacctc cgcgcatacc tggacgcatt 2400 gcgagattca cccgagcatg atcttgggtg tttgtgctag tatcattccc ttccccgacc 2460 ataaccaggt aagattaggc tacgaactca actcccagtc aagttactga catacgtgta 2520 gtcccctcgt aatacgtacc agtccgccat gggcaaacaa gccatgggca tcttcctcac 2580 aaacttcctc atccggatgg acacgatggc gaacatcctc tactacccgc agaagccact 2640 ggccaccacc cgttccatgg aatacctccg cttccgagag ttgcctgctg gtcagaacgc 2700 catcgttgct attctgtgct acagtggtta caaccaggaa gattccgtca tcatgaacca 2760 gagctccatc gaccgaggtc tgttccgcag tatttattat cggagttata tggacctgga 2820 gaagaagagc ggagttcagc agttggagga gttcgaaaaa cccactcgtg acaccacatt 2880 gcggatgaaa cacggaacgt acgacaagct tgaagacgat ggtctcatcg cgcccgggac 2940 gaacgtcaac ggcgaggaca tcatcatcgg taaaactgcc cccatccctc cagacagcga 3000 ggagcttggc cagcggactc gaacgcacac gaagcgcgac gtctcgacac cgctgaagag 3060 tactgagcag ggtatcgttg accaggtgct cattaccaca aacgcggagg tcaggttcgt 3120 gaagatccgt gtacgttcca cccgtatacc gcagatcggc gacaagttcg catcgcgtca 3180 cggccagaag ggtacgatcg gtatcaccta ccgccaggag gacatgccgt tcacggcgga 3240 gggtatcacc cccgacatca tcatcaaccc ccacgccatt ccatctcgta tgacaatcgg 3300 ccacttggtc gagtgtctgc tctccaagct tgcgacgctc atcggaaacg agggagatgc 3360 aactcccttc acggacctca ctgtcgagtc cgtctcgcag ttccttcgcc agaagggcta 3420 ccactcgcga ggtcttgagg tcatgtacca cggccacacc ggacgcaagt tgcaagcaca 3480 ggtctacctc ggtccgacct actaccagcg tctcaagcac atggtggacg acaagatcca 3540 ctcacgtgcg cgtggcccag tgcagatcct cacgcgtcag ccagtcgagg gtcgtagtcg 3600 cgacggtggt ctgcggtttg gggagatgga gcgtgattgt atgatttcgc atggtgtggc 3660 agcgttcttg aaggagcgtc tgttcgaggc cagcgatgcc taccgactgc atgtctgtga 3720 tatgtacgtc cacacatggc cgttactgcc ctactggcta ctaatgttct cttctacaga 3780 tgtggtctta ccgccatcgc caacctggtc ggtattttaa ccaagttctg tctcatagac 3840 gctaaccgct ttcacagaaa aagcaaacgt ttgaatgccg agcgtgcaag aacaagactg 3900 catgttcaca gatctacatt ccttatgccg cgaagctgct cttccaggtg aggattgctc 3960 attatttgga cttgctcatt cctggttgac aacgctccct aggaattgca atccatgaat 4020 atcgcagcac ggttgtacac gacatccaca ggacggattc gggattaa 4068 <210> 4 <211> 4084 <212> DNA <213> Unknown <220> <223> Ganoderma lucidum BCRC <400> 4 tctttctatg atgacggtta tggcttggat ggcgaggtgg aggacgagta cgaggagatc 60 acgcaagaag actgctggac ggtcatttcc agcttcttcg acctgaaggg tcttgtcaga 120 cagcaactag actctttcga tgagttcgtc caaaatacca tgcaggaact tgtggacgaa 180 aactcggatc tcatcctcga ccaggcggac cagcataccg gccacgacgg agacgtaacg 240 cgccgctacg agatcaagtt cggccagatc tatctctcac ggccgactgt tacggaggca 300 gatggtgctg tggtccccgt tttccctcag gaagcccgtt tacgcaactt aacgtactcc 360 gcgccactgt acatcgaaat gaagaagcgg gtgttgattg ggagggagga tcaggacggg 420 ggtggggata tgatttggga agtgcaacgg gacgatgatc ctgaagacac caggaaagtc 480 tggataggaa aggtatgtca caatgcggtc cgaacgctgg atgttcgcct cacggtactc 540 ggtttaggtg cccatcatgt tgcggtctac gtattgcatc ctccacgagc taggcgacaa 600 agagctgttt gacctcaatg agtgtcccta tgactccgga ggttacttca taatcaatgg 660 ctccgagaag gtgctcatcg cccaggagcg tatggcgaca aatcatgtct atgtcttcgc 720 caaggcgcag ccttctccta tcagtttcct cgccgagatt cgaagtgccg tcgaaaaggg 780 tgggaagacc atcagccagt tccaggtcaa gctctaccat aggagccagg atcgttcggt 840 acgtgtgagg tcttgtatgc gaaccccagt gcctcccctt atcctttttc gcagctcgga 900 aatgtaatga aggccacgat cccttacatc aaggtcgaca tacccatctg ggtcgtcttc 960 cgtgcattgg gggtcatctc cgaccgggac atcttggaac atatatgcta cgatatgcaa 1020 gacaaccaga tgctggagat gctgaaacct tgtatcgatg agggctttgt tatccaggat 1080 cgcgaggtcg gtggggacat cttaaatcat aggctgtcta ttgacatttt cttagattgc 1140 tctggactac atcggcaacc gtgggacgac cacgggcttg aaccgtgaac gtcgtctacg 1200 gtatgcgcaa gaaatccttc agaaggagat gttgccgcac gtctccatgg ccgagggttc 1260 cgagtccaag aaggcgtatt tcttcggcta catgatccat cgtctcctgc tcgctgctct 1320 ggaacgcaga gacctcgatg accgtgacca cttcggcaaa aaacgccttg accttgcggg 1380 tccccttctt gcgaacctat tccgtatgct gttccgcaag ctcaccaagg acgtgtatcg 1440 ctaccttcag aaggtgagtt gctgtgttcg ttccatcaaa gttgaaactc aacgtgtcat 1500 cgcgtagtgt gtcgagacgc ataaggagtt caacatctcg cttgcggtca aacacaacac 1560 catcacaaac ggcctcaagt actctctcgc tactggcaac tggggagacc agaagaagtc 1620 gatgtcgtcg aaggctggcg tctcgcaggt actcaaccgg tatacttacg cctcgacatt 1680 atcccacttg cgtcgttgca acacgcccct tggccgtgaa gggaagatcg ctaaaccccg 1740 tcagttacac aacactcact ggggtatggt ctgtcctgcc gagacgccag aagggcaggc 1800 ttgcggtctc gtcaagaacc tgtcgctcat gtcttgcatc tccgtcggta ccctgtctgc 1860 gcccgtcatc gagtttttgg aggagtgggg tcttgagtcc ctggaagaga acgctcatgc 1920 atcgacgccg tgcacgaagg tcttcgtgaa tggcgtgtgg atgggtgtcc atcgggatcc 1980 tgtgaagctc gtgagcacgc tcaggaagct ccgccgcaaa gacgacatca actgcgaggt 2040 gtcagtcgtc cgcgacatcc gagaacgcga gcttcgcctt tacacagatg ctggtcgcgt 2100 ctgccgaccg ctcttcatcg tcgagaacca gcagctcctc attcagaaac gacacatcga 2160 gagcttggtc cgtgccaagg acgatccgac gttgtcctac aactgggaca gccttctcaa 2220 ggacggtgtc atagagttgc tggatgccga ggaagaggag acggtcatga tctgtatgac 2280 accggaggat ttggagaact ccaggctcca ggctgccggt atcgacccgc atgcggacga 2340 cgagaatgac gacccgtcag ctcgattgaa ggcggcgacc tccgcacata cgtggacgca 2400 ctgcgagatt catccgagta tgatcttggg tgtctgtgcc agtattattc ccttccccga 2460 ccacaaccag gtaagctccg agctaggaag tcaccgtcag ttgagttact gatatgcgtc 2520 cagtcacctc gtaacacgta ccaatccgct atgggtaaac aagcgatggg tatctttctc 2580 acgaacttcc tcatccgaat ggatacgatg gcaaacattc tctactaccc ccagaagccg 2640 cttgccacca cacgttcgat ggagtacctt cgcttccgag agttgcctgc tggccagaat 2700 gccattgtcg ccattctatg ctacagtggt tacaaccagg aagattccgt catcatgaac 2760 cagagctcta tcgaccgagg cttgttccgt agtatctatt accggagcta catggacctg 2820 gagaaaaaga gcggcgttca gcagctggag gagttcgaga agcccactcg cgacacgaca 2880 ttgcggatga agcatgggac gtacgacaag ctcgaagacg atggtctcat cgcacctggg 2940 acgaacgtca acggcgagga catcatcatc ggcaaaactg cccctatttc cccagacagt 3000 gaggagctgg gccagcggac acggacgcac acgaagcgcg atgtctcgac gccattgaag 3060 agcaccgagc agggtatcgt cgaccaggtg cttatcacca cgaacgcgga gggccaaaag 3120 tttgtcaaga tccgtgtacg ctccacccgt attccacaga tcggtgacaa gttcgcttcg 3180 cgtcacgggc agaagggtac aatcggtatc acctaccgcc aagaggacat gccgttcaca 3240 gcggagggta tcacccccga tatcatcatc aaccctcatg ctattccctc ccgtatgaca 3300 atcggccact tggtcgagtg tctgctttcc aagcttgcga cgctcattgg taacgagggc 3360 gatgcgacgc cattcacaga cctcaccgtc gagtccgtct cgcagttcct tcgccagaaa 3420 ggctatcagt cgcgaggtct cgagatcatg taccacggcc acactggacg gaagctgcag 3480 gcgcaggtct accttggtcc gacctactac cagcgtctca agcacatggt cgacgacaag 3540 atccactccc gtgcgcgcgg gccggtgcaa atcctcacac gtcagccggt tgagggtcgt 3600 agtcgtgacg gtggtctgcg gttcggagaa atggaacgtg attgtatgat ttcgcatggt 3660 gtggcggcgt tcttgaagga acgtttgttc gaggcgagcg atgcctatcg actgcacgtc 3720 tgtgacatgt acgtccaccc atattcgacc cttccctacc tactgcgtgt tactaatgat 3780 atcttctgca gctgcggtct cacagccatc gccaacctcg tcagtactcc attcttgttt 3840 tatcctgcgc acaggggctg accgttctca tagaaaaagc aaacattcga gtgtcgcgca 3900 tgcaagaaca aaactgcatg ttcacagatc tatattcctt atgccgccaa gttgctgttc 3960 caggtgcgca ctgcttcact gctcgaactc actcattctc gctgacttct ttcaccagga 4020 attgcagtct atgaacatcg cagcacggtt gtacacgacg tcgacaggaa ggattcggga 4080 ttaa 4084 <210> 5 <211> 1739 <212> DNA <213> Unknown <220> <223> Ganoderma Tsugae <400> 5 tccttctatg acgacggcta cggcctggat ggcgaggtgg aggacgagta cgaggagatc 60 acccaagaag actgctggac ggtcatttcc agcttcttcg accagaaagg tcttgtcagg 120 cagcaactag actccttcga cgagttcgtc cagaatacca tgcaggaact cgtagacgaa 180 aactcggatc tcatccttga ccaggcggac cagcataccg gccacgacgg agacgtaaca 240 cgccgctacg agatcaagtt cgggcagatc tacctctcac ggccgaccgt tacggaggcg 300 gatggtgctg tggttcccgt tttccctcag gaagcccgtt tgcgcaacct cacgtattcc 360 gcgccactgt acatcgaaat gaagaagagg gttttgattg ggagggagga ccaggatggg 420 ggtggggata tgatttggga agtgcaacgg gatgacgatc ctgaagacac caggaaagtg 480 tggataggca aggtatgtca caacgcggcc caagtgctga acgttcgctt cacggttttc 540 ggtccaggtg cccatcatgt tgcggtccac atattgcatc ctccacgagc ttggcgacaa 600 agagctattc gacctcaatg agtgccccta cgactccgga ggatacttca taatcaacgg 660 ctctgagaag gtgctcatcg cgcaggagcg tatggcgaca aaccatgtct acgtcttcgc 720 caaggggcag ccttctccta tcagtttcct cgccgaaatc cgaagtgctg tcgaaaaggg 780 tgggaagacc atcagtcagt ttcaggtcaa gctctaccat aggagcaagg agcgttcggt 840 atgtgtgata tattgcgtgc gatccctgta gcgccgctcc ttatcttttt acacagctgg 900 gaaatgtaat gaaggccaca atcccctaca ttaagatcga catacctatc tgggtcgtct 960 tccgtgcact gggagtcatc tccgaccgcg acatactaga gcatatctgc tacgatatgc 1020 aggacaatca gatgttggaa atgttgaaac cttgtatcga cgagggcttc gtcatccagg 1080 accgcgaggt tggtcgggac gtcttgaatc atgagctctt tgttgagact ttcttagatt 1140 gcactggact acattggcaa tcgtggaacg acgacgggcc tgaaccgtga acgtcgtcta 1200 cgttacgccc aagaaatcct ccagaaggag atgttgccgc acgtctccat ggccgagggg 1260 tccgagtcca agaaggcgta ctttttcggc tacatgatcc accgtctcct gctcgcggct 1320 ctggaacgca gagacctcga cgatcgcgat cacttcggta aaaagcgcct tgacctcgcg 1380 ggaccccttc tcgcgaacct gtttcgcatg ctgtttcgca agcttaccaa ggatgtctac 1440 cgctatcttc agaaggcgag ttgctgtgct cgtacgatcg gcgtcggaac ttaacatatc 1500 attgcgtagt gtgtcgagac gcacaaggag tttaacatct cacttgcagt caagcataac 1560 accatcacga acggcctcaa gtactctctc gccactggca actggggaga ccagaagaag 1620 tcgatgtcgt cgaaggctgg cgtctcgcag gtgctcaacc ggtataccta tgcgtcgacg 1680 ctgtcccact tgcgtcgctg caacacacct cttggccgtg aagggaagat tgcaaaacc 1739 <210> 6 <211> 2582 <212> DNA <213> Unknown <220> <223> Ganoderma Tsugae <400> 6 ttaacatatc attgcgtagt gtgtcgagac gcacaaggag tttaacatct cacttgcagt 60 caagcataac accatcacga acggcctcaa gtactctctc gccactggca actggggaga 120 ccagaagaag tcgatgtcgt cgaaggctgg cgtctcgcag gtgctcaacc ggtataccta 180 tgcgtcgacg ctgtcccact tgcgtcgctg caacacacct cttggccgtg aagggaagat 240 tgcaaaacct cgtcagttac acaacactca ctggggtatg gtctgtcctg ccgagacgcc 300 agaaggacag gcctgcggtc tcgtcaagaa cttgtcgctt atgtcttgca tatccgtcgg 360 caccctctct gcacccgtca tcgaattctt ggaggagtgg ggcctggagt ctctggagga 420 gaatgctcat gcctcaacgc cttgcacgaa ggtcttcgtg aatggcgtct ggatgggcgt 480 ccatcgagat cctgtgaagc tcgtcagcac gctcaggaag ctccgtcgca aagatgacat 540 caactgcgaa gtatccgtcg tccgtgacat tcgagaacgc gagctccgtc tctacacgga 600 tgctggtcgt gtttgccgac cgctcttcat cgtcgagaac cagcagctcc ttatccagaa 660 gaaacacatc gagagcttgg tccgtgccaa ggaagacccg acgttgtcct acaactggga 720 cagcctcctc aaggacggtg tcatcgagct gctggatgcc gaggaagagg agacggtgat 780 gatatgcatg acaccggagg atttggagaa ctccaggctc caggctgccg gtatcgaccc 840 ccatgcggac gaggagaacg acccctcagc tcgattgaag gcgccgacct ccgcgcatac 900 gtggacgcac tgcgagattc acccgagtat gatcttgggt gtctgtgcca gtatcattcc 960 gttccccgat cacaatcagg taagctcagg ttaggaagta aacgtcagtc gaagtactaa 1020 cgtgcgtcta gtcccctcgt aacacgtacc aatctgccat gggtaaacaa gcgatgggta 1080 tcttcctcac gaacttcctc attcggatgg acacgatggc gaacatcctc tactaccctc 1140 agaaaccgct tgccaccacg cgttctatgg aatacctccg cttccgagag ttgcctgctg 1200 gacagaatgc cattgttgct attttgtgct acagtggtta caaccaggaa gattccgtca 1260 tcatgaacca gagctctatc gaccgaggtc tgttccgcag tatctactat cggagctaca 1320 tggacctgga gaagaagagc ggcgttcagc agctggagga attcgagaaa cccacccgcg 1380 acaccacatt gcggatgaag catgggacgt acgataagct cgaagacgat ggcctcattg 1440 cacctgggac gaacgtcaac ggcgaggaca tcatcatcgg caaaactgcc cctatccctc 1500 cggacagcga ggagctcggc cagcggacac ggacgcacac aaagcgcgac gtctcgacac 1560 cactgaagag cacggagcag ggtatcgtcg accaggtgct tatcaccaca aatgcggagg 1620 gccaaaagtt cgtcaagatt cgtgtacgct ccacccgtat tccgcagatc ggcgacaagt 1680 tcgcatcgcg ccacggtcag aagggtacga tcggtatcac ctaccgccag gaggacatgc 1740 cgttcaccgc ggagggtatt actcccgaca tcatcatcaa cccacacgcc attccctccc 1800 gtatgacaat cggccacttg gtcgagtgtc tgctttccaa gctcgcgacg ctcatcggaa 1860 acgagggcga tgcgacacca ttcacggatc tcaccgtcga gtccgtctcg cagttcctcc 1920 gccagaaggg ctaccagtcg cggggcctcg agatcatgta ccacggccac accggacgca 1980 agctgcaggc gcaggtctac ctcggcccga cgtactacca gcgtctgaag cacatggtgg 2040 acgacaagat ccactcgcgt gcgcgtgggc cggtgcaaat cctcacacgt cagccagtgg 2100 agggccgtag tcgtgacggt ggtctgcggt tcggagagat ggagcgtgat tgtatgattt 2160 cgcatggtgt ggcggcgttc ttgaaggagc gtctgttcga ggccagcgac gcctatcgac 2220 tgcacgtttg tgacatgtat gtccaccatg ttcgacatta ccctatctgt tgctaatgtt 2280 gtcttttgca gttgtggtct tacagccatc gccaacctcg tcagtattcc accttgtctt 2340 gtcttgcgca caggggctga gcgctttcac agaaaaaaca aacgttcgag tgtcgcgcgt 2400 gcaagaacaa gactgcatgt tcacagatct acattcctta tgccgcgaag ttgctcttcc 2460 aggtgaggat tggtcgccgc tcaaacccgc tcattttcgc tgacagtact cgccaggaat 2520 tgcaatctat gaacatcgca gcgcggttgt acacgacgtc cacaggacgg attcgggact 2580 aa 2582 <210> 7 <211> 4074 <212> DNA <213> Unknown <220> <223> Ganoderma lucidum Xiangnong <400> 7 tctttctacg acgacggcta tggcttggat ggcgaggtgg aggacgagta cgaagagatc 60 acacaagaag actgctggac ggtcatttcc agcttctttg accaaaaggg tcttgtcagg 120 cagcaattag actccttcga cgagttcgtc caaaatacca tgcaggaact tgtggacgaa 180 aactcggatc tcattctcga ccaggcggac caacataccg gccatgacgg agacgttaca 240 cgccgctacg agatcaagtt cggccagatt tacctttcac gaccgaccgt tacggaggcg 300 gatggtgctg ttgtccccgt tttccctcag gaagcccgtt tgcgcaacct cacctactct 360 gcgccactgt acatcgaaat gaagaagcgg gttttgattg gaagggagga tcaggatggg 420 agtggggata tgatttggga agtgcagcgg gacgatgatc ctgaagacac cagaaaagtg 480 tggataggga aggtatgtca tgacactgtc caaatattgg atgcttgctt cacgatcttc 540 gcttcaggtg cccatcatgt tgcggtccac atattgcatc ctccacgaac ttggggacaa 600 ggagctgttc gacctcaacg agtgtccata cgactccgga ggatacttca taatcaacgg 660 ttctgagaag gtgctcatcg cccaggagcg catggcgaca aaccatgtct acgtcttcgc 720 caaggctcag ccttctccta tcagtttcct cgccgagatt cgaagtgccg tcgaaaaggg 780 tgggaagacc atcagtcagt tccaggtcaa gctctatcat aggagtcagg aacgttctgt 840 acgtgcgatg tcttctatag gttgcccgtg gcgcctctcc tcatgctttc gcagcttgga 900 aatgtaatga aggccacgat cccatatatt aaggtcgaca tacccatctg ggtcgtcttc 960 cgtgcattgg gggtcatctc cgaccgcgac atattggagc acatatgcta cgatatgcag 1020 gacaaccaga tgctggagat gttgaaacct tgtatcgacg aggggttcgt tatccaagat 1080 cgtgaggtgg gttggcacgt ctcaaacatg ggcctttcgt tgatattttc ttagatcgca 1140 ttggactaca tcggcaatcg tgggacgacg acgggcttga accgtgaacg tcgtctacgg 1200 tacgcccagg agatccttca gaaggagatg ttgccgcacg tttccatggc tgagggctcc 1260 gagtcgaaga aggcgtactt tttcggctac atgattcatc gtctcttact cgctgctctg 1320 gaacgcagag acctcgacga ccgtgatcac ttcggtaaaa agcgtcttga cctcgcgggt 1380 ccccttctcg cgaatctgtt ccgtatgctg ttccgtaagc ttaccaaaga tgtgtaccgc 1440 tatcttcaga aggtgagtcg tcgtactttt cctccagaag tcgaaactca atccgtcatg 1500 gtgtagtgtg tcgagacgca caaggagttt aacatctcgc ttgcggtcaa gcacaacacc 1560 atcacaaacg gtctcaagta ctctctcgcc actggtaatt ggggagacca gaagaagtcc 1620 atgtcggcga aggctggcgt ctcgcaggtg ctcaaccggt atacctatgc ctcgacactg 1680 tcccacttgc gtcgttgcaa cacgcctctt ggtcgtgaag ggaagatcgc taaaccccgt 1740 cagttacaca acactcactg gggtatggtc tgtcctgccg aaacgccaga aggacaagct 1800 tgcggtctcg tcaagaactt gtcgctcatg tcttgcatct ccgtcggtac cctctctgca 1860 cccgtcatcg aattcttgga ggaatggggc ctggagtctc tagaagaaaa tgctcatgct 1920 tcaacacctt gcacgaaggt atttgtgaat ggcgtttgga tgggtgtcca ccgagatcct 1980 gtgaagcttg tcagcacact ccggaaactc cgccgcaaag acgacattaa ctgcgaagta 2040 tccgtcgtcc gcgacatccg agagcgcgag ctccgccttt acacggatgc tggacgtgtc 2100 tgccggccgc tcttcatcgt cgataaccag cagctcctca tccagaagcg acacatcgag 2160 agcctagtac gtgccaagga cgacccggca ttatcctaca actgggacag ccttctcaag 2220 gatggtgtca ttgagttgct ggatgcggag gaagaggaga cagtcatgat ctgtatgaca 2280 ccggaggatt tggagaactc gaggctccag gctgccggca ttgacccaca cgcggaagac 2340 gagaatgacg acccctcggc tcgattaaag gcggcgacct ctgcacatac atggacgcat 2400 tgcgagattc atccaagtat gatcttgggc gtctgtgcca gtattattcc cttccccgac 2460 cacaaccagg taagctcggg ctaggaggtc atcctcagtc gagttactga catgcgtcaa 2520 gtcgcctcgt aacacatacc aatctgccat gggaaaacaa gcgatgggca tcttcctcac 2580 aaacttcctc atccggatgg acacaatggc aaacatcctc tactaccccc agaagccgct 2640 tgccaccacg cgttctatgg agtatctccg cttccgagag ttgcctgctg gtcagaatgc 2700 cattgtcgct attctatgct acagtggtta caaccaggaa gattccgtca tcatgaacca 2760 gagctccatc gaccgaggtt tgttccgcag tatctattac cggagctaca tggacctgga 2820 gaagaagagc ggcgttcagc agctggagga attcgagaaa cctactcgtg acactacatt 2880 gcggatgaag catgggacgt acgacaagct tgaagatgat ggtctcatcg cgcctgggac 2940 gaatgtcaac ggcgaggaca tcatcatcgg caaaactgcc ccaatccctc cggacagcga 3000 ggagctcggc caacgcacac ggacgcacac gaagcgcgat gtctcgacac cactgaagag 3060 cacagagcag ggtatcgtcg accaagtgct aatcaccaca aacgcagagg gtcaaaaatt 3120 cgtcaagatc cgtgtacgct ccacccgtat accgcagatc ggtgacaagt tcgcttcacg 3180 ccatggtcag aagggtacga tcggtatcac ctaccgccag gaggacatgc cattcaccgc 3240 ggagggcatt acccccgata tcatcatcaa cccacacgcc attccctccc gtatgacaat 3300 tggtcacttg gtagagtgtc tgctttccaa actcgcgacg ctcatcggaa acgagggtga 3360 tgcgacgcca ttcactgacc tcaccgtcga gtccgtctcg cagttccttc gccagaaggg 3420 ctaccagtcg cgaggcctcg aggtcatgta ccacggccac accggacgca agctgcaggc 3480 gcaggtctac ctcggcccaa catactacca gcgtctcaag cacatggtgg acgacaagat 3540 ccactcgcgt gcgcgtggcc cggtgcagat cctcacacgt caaccggtcg agggtcgtag 3600 tcgtgacggt ggtctgcgtt tcggagagat ggagcgtgat tgtatgattt cgcatggtgt 3660 agcggcgttc ttgaaggagc gtctgttcga ggccagcgat gcctatcgac tgcacgtctg 3720 cgacatgtac gtacacccag cgctgacagt acctaaacgg ttgctaacgg tgtttcctgc 3780 agttgtggcc ttacagccat cgccaacctc gtcagtattc cagccctgtc ttatcctgcg 3840 aacggggact gactgctatc cacagaaaaa gcaaacgttc gagtgccgcg cgtgcaagaa 3900 caagactgca tgttcgcaga tctacattcc ttacgccgcg aagctgctct tccaggtgag 3960 gtttgttttt cattcaaggc tattcagttc actgactccg ttcgccagga attgcaatcc 4020 atgaacattg cagcgcgctt gtacacgaca tccactggac ggatccggga ttaa 4074 <210> 8 <211> 4076 <212> DNA <213> Unknown <220> <223> Ganoderma lucidum G260125 <400> 8 tccctctatg acgacggtta tggcttggat ggcgaggtgg aggacgagta cgaggagatc 60 acgcaagaag actgctggac ggtcatttcc agcttcttcg accagaaggg tcttgtcagg 120 cagcaactag actccttcga cgagttcgtc caaaatacta tgcaggaact tgtagacgaa 180 aactcggatc tcatcctcga ccaggccgac caacataccg ggcacgacgg agacgtaacg 240 cgacgctacg agatcaagtt tgggcagatc tacctctcac ggccgaccgt tacggaagcg 300 gatggtgctg tagtcccagt tttccctcag gaagctcgtt tgcgcaatct cacgtactcc 360 gcgccactgt acatcgagat gaagaagaga gttttgattg ggagggagga tcaggacggg 420 ggtggggata tgatttggga ggtgcagcgg gacgatgatc ctgaggacac caggaaagtg 480 tggataggga aggtatgtca tcacgcggtc caaatgctgg acgttcgctt cacggtcttc 540 gatccaggtg cccatcatgt tacggtctac atattgcatc cttcacgaac tcggcgacaa 600 agaactgttt gacctcaacg agtgccccta cgactccgga ggatatttca taatcaacgg 660 ctccgagaag gtgctcatcg cccaggagcg tatggcgaca aatcatgtct acgtcttcgc 720 caaggcgcaa ccttctccta tcagtttcct cgcagagatt cgaagcgccg tcgaaaaggg 780 tgggaagacc atcagccagt tccaggtcaa gctctaccat aggagccagg agcgttcggt 840 acgtgtgatg tcttgtatgc gagccccagc gccgcccctt atcctctttc ccagcttgga 900 aatgtaatga aggctacgat cccctacatc aaggtcgaca tacctatctg ggttgtcttc 960 cgtgcattgg gggtcatctc cgaccgagac atcctggagc acatatgcta cgatatgcag 1020 gacaaccaga tgctggagat gttgaaacct tgtatcgacg agggcttcgt tatccaggat 1080 cgcgaggttg gtggggacgt cttaaatcat agtctgtcta ttgagacgtt cttagatcgc 1140 tctggactac atcggcaacc gtgggacgac aacgggcttg aaccgtgaac gtcgtctacg 1200 atacgctcaa gaaattcttc agaaggagat gttgccgcac gtctccatgg ccgagggttc 1260 cgagtccaag aaggcgtact tctttggcta catgatccat cgtctcctgc tcgctgctct 1320 ggaacgcaga gacctcgatg accgtgacca cttcggtaaa aagcgccttg acctcgcggg 1380 tccccttctc gcgaacctgt tccgcatgct gttccgcaag ctcaccaagg acgtgtaccg 1440 ttaccttcag aaggttagtt gccgcgctcg ttcgattgaa gtcgaaactc aacaaatcat 1500 tgcgtagtgt gtcgagacgc acaaggagtt caacatctcc cttgcggtca aacacaacac 1560 catcacgaat ggtctcaagt actccctcgc cactggcaac tggggagacc agaagaagtc 1620 gatgtcgtcg aaggctggcg tctcgcaggt gctcaaccgg tatacctatg cctcgacact 1680 gtcccacttg cgtcgttgca acacacctct tggccgtgaa ggaaagattg ctaaaccccg 1740 tcagctacac aacactcact ggggtatggt ctgtcctgcc gagacgccag aaggacaggc 1800 ttgcggtctc gtcaagaacc tgtcgcttat gtcttgcatc tccgtcggta ccctctctgc 1860 acccgtcatc gagttcttgg aggagtgggg cctcgagtct ctggaggaga acgctcatgc 1920 atcaacaccg tgcacgaagg tcttcgtgaa tggcgtctgg atgggtgtcc accgagatcc 1980 tgtgaagctc gtgagcacgc ttaggaagct ccgccgcaaa gacgacatca actgcgaggt 2040 gtccgtcgtc cgtgacatcc gagaacgcga gctccgcctt tacacggatg ctggtcgcgt 2100 ctgccgaccg ctcttcatcg tcgaaaacca acagctcctc atccagaagc gacatatcga 2160 gagtctagtc cgtgccaagg acgacccgac gttgtcctac aattgggaca gccttctgaa 2220 ggacggtgtc atcgagctgc tggatgccga ggaagaggag acggtcatga tctgtatgac 2280 atcggaggat ttggagaact cgaggctcca ggccgccggt atcgacccac atgcagacga 2340 cgaaaacgac gacccctcag ctcggctgaa ggcggcgacc tccgcccaca cgtggacgca 2400 ctgtgagatt catccgagca tgatcttagg tgtctgtgcc agcatcattc ccttccccga 2460 ccacaaccag gtaagctggg gctaggaaac accttcagtt gagttatact gacatgtgtg 2520 tagtcgcctc gtaatactta ccaatctgcc atgggtaaac aagcaatggg tatcttcctc 2580 acgaacttcc tcatccggat ggacacgatg gcgaacattc tctactaccc ccagaagccg 2640 cttgccacca cacgttccat ggagtacctc cgcttccgag agttgcctgc tggccagaat 2700 gccattgtcg ctattctgtg ctacagcggt tacaaccagg aagattccgt catcatgaac 2760 cagagctcca tcgaccgagg tctgttccgc agtatctact accggagcta catggacctg 2820 gagaagaaga gcggcgttca gcaactagag gagttcgaaa aacccactcg cgataccacg 2880 ttgcggatga agcatggaac ctacgataag ctcgaagacg atggtctcat tgcacctggg 2940 acgaacgtca acggcgagga tatcattatc ggcaaaactg ctcctatccc gcccgacagc 3000 gaagagcttg gccagcggac acgaacgcac acgaagcgtg acgtctcgac accgctgaag 3060 agcacggagc agggtatcgt cgatcaggtt cttatcacca cgaatgcgga gggccaaaag 3120 ttcgtcaaga tccgtgtacg gtccacccgt attccacaga tcggcgacaa gttcgcttcg 3180 cgtcatggtc agaagggtac gattggcatt acctaccgcc aggaggacat gccgttcacc 3240 gcggagggta tcacccctga catcatcatc aacccccacg ctattccctc ccgtatgacg 3300 atcggccact tggtcgagtg tctgctttcc aagctcgcga cgctcatcgg gaacgaaggc 3360 gatgcgacgc cattcacgga cctcaccgta gagtccgtct cgcagttcct tcgccagaag 3420 ggctatcagt cgcgaggtct cgagatcatg taccacggtc acactggacg gaagctgcag 3480 gcgcaagttt accttggtcc aacctactac cagcgtctca agcacatggt ggacgacaag 3540 atccactcgc gtgcacgtgg gccggtgcag atcctcacac gtcagccggt cgagggtcgt 3600 agccgtgacg gtggtctgcg gttcggagag atggagcgtg attgtatgat ttcgcacggt 3660 gtggcggcgt tcttgaagga gcgcctgttt gaggcgagcg atgcctatcg actgcacgtc 3720 tgtgacatgt acgtccaccc atgtttgacc tttccctacc tgctgctgat tgtgttttcg 3780 gcagttgcgg cctcacagcc atcgccaacc tcgtcagtat tcaatcttgt actgtcttgc 3840 gtacgggggc taactgtttt cacagaaaaa gcaaacattc gaatgtcgcg cgtgcaagaa 3900 caagactgca tgttcacaga tctacattcc ttatgccgca aagttgctct tccaggtgag 3960 gattccttca ccgctcgaac ccgcctattc ttgctgactt cattcgatag gaattgcaat 4020 ctatgaacat cgcagcacgg ttgtacacga cgtcgacagg acggattcgg gattaa 4076 <210> 9 <211> 4062 <212> DNA <213> Unknown <220> <223> Ganoderma sinense <400> 9 gtccttctac gacgatggct atggcttgga tggcgaggtc gaggacgagt acgaggagat 60 cacccaggaa gactgctgga cggtcatttc cagctttttt gaccagaaag gcctggtcag 120 gcagcaacta gactcttttg acgaattcgt ccaaaatact atgcaggagc ttgtggacga 180 aaactcggat ctcatcctcg accaggcaga ccagcacacc ggccacgacg gggacgtcac 240 acgtcgctat gagatcaaat tcgggcagat ctacctctca cggccgactg ttacagaggc 300 ggatggtgct gtcgttcccg ttttcccgca ggaggctcgt ttgcgcaacc tcacatattc 360 tgcgccactg tatatcgaaa tgaagaagag ggttttgatc ggaagggagg atcatgacgg 420 gaatggggat atgatttggg aagtgcagcg ggacgacgat cccgaggaca ccaggaaagt 480 gtggataggc aaggtatgtc ataacggaat ccatgtgtgg gacgttcgct tcagtcttct 540 ccccaggtgc ccatcatgct gcggtccaca tactgcatcc tccacgagct tggcgacaaa 600 gagctgtttg atctcaatga gtgtccctac gactctggag gatatttcat tatcaacggc 660 tctgagaagg tgctcattgc tcaggagcgc atggcaacaa atcatgtcta cgtcttcgcc 720 aaggcccagc catcccctat cagtttcctc gccgagattc gaagtgcggt cgaaaagggt 780 gggaagacca tcagccagtt ccaggttaag ctttatcaca ggagccagga gcgttcggta 840 tgtgggatgt cttgtgtgca accgctgtaa caacgcacct tactctatgc cacagctcgg 900 gaatgtaatg aaggccacaa ttccctacat taaggtcgac atccctatct gggtcgtctt 960 ccgtgcactg ggggtcatct ccgaccgcga catattggag catatctgct acgatatgca 1020 agacaaccag atgctggaga tgttgaaacc ttgtatcgac gagggcttcg ttattcagga 1080 ccgcgaggtt ggtggggacg ctttgcatcg tgatccctct tttgagactt tcttagattg 1140 cccttgacta catcggtaat cgtgggacga cgacgggctt gaaccgcgaa cgtcgcctac 1200 ggtacgcaca agagatcctt cagaaggaga tgctacccca cgtctccatg gccgaggggt 1260 ccgagtccaa gaaggcgtac ttcttcggct acatgatcca tcgtctcctc cttgctgcat 1320 tggaacggag agacctcgac gaccgtgatc acttcggtaa aaagcgtctt gacctcgcag 1380 gcccacttct cgccaacctg ttccgcatgc tgttccgcaa acttaccaaa gatgtgtacc 1440 gctaccttca gaaggtgagc cattgtgcat gtgtggtcag tgtaggaaac taacatgccg 1500 ttccgcagtg tgtcgagacg cacaaggagt tcaacatctc actcgcggtc aagcacaata 1560 ccatcacaaa cggcctgaag tactctctcg cgactggtaa ctggggagac cagaagaagt 1620 cgatgtcgtc gaaggctggc gtctcgcagg tgctcaaccg gtacacctat gcctcgacac 1680 tgtcccactt acgtcgttgc aatacgcctc ttggccgcga agggaagatc gcgaaacccc 1740 gtcagttgca caacacacac tggggtatgg tctgtcccgc ggagacgcca gaaggacagg 1800 cttgtggtct cgtcaagaac ttgtctctca tgtcttgcat ctccgttggt accctctcgg 1860 cgcctgtcat cgaattcttg gaggaatggg gtctggagtc tctggaggaa aacgctcacg 1920 cttcaacgcc gtgcacgaaa gtcttcgtga atggtgtctg gatgggtgtc caccgagatc 1980 ctgtgaaact cgtcagcacg ctcaggaagc ttcgccgcaa ggacgacatc aactgcgaag 2040 tatccgtcgt ccgcgacatc cgagaacgcg agctccgcct gtatacggac gctggtcgtg 2100 tttgcaggcc actcttcatt gtcgagaacc agcagctcct cattcagaag agacatatcg 2160 agagcctggt ccgtgccaag gacgacccga cattgtctta caactgggac aacctcctca 2220 aggacggtgt cattgagctg ctagatgctg aggaagagga gacagtcatg atctgtatga 2280 caccggagga tttggagaac tcgaggctcc agtctgccgg tatccatgcg gaggacgaga 2340 acgacgaccc gtcagctcga ttgaaggcgg ctacctccgc gcacacgtgg acgcactgcg 2400 agattcaccc aagcatgatc ttgggtgtct gtgccagcat cattccgttc cccgaccaca 2460 accaggtaag atcaagctac aaactcaacc ccagttaagt gactaacata cgtgtagtcg 2520 cctcgtaata cgtaccagtc cgccatgggt aaacaggcca tgggtatctt cctcacaaac 2580 ttcctcatac ggatggacac aatggcgaac atcctctact acccccagaa gccgcttgcc 2640 accactcgtt ccatggaata cctccgcttc cgagagttgc ccgccggtca gaatgccatc 2700 gtcgcaattc tatgttacag cggttacaat caggaagatt ctgtcattat gaaccagagc 2760 tccatcgatc gaggtctgtt ccgtagtatc tactaccgga gctacatgga cctggaaaag 2820 aagagcggcg ttcagcagtt ggaggagttc gagaaaccca ctcgtgacac cacactgcgg 2880 atgaagcacg gaacgtacga caaactcgaa gacgacggcc tcatcgcgcc cgggacgaac 2940 gtcaacggcg aggacatcat catcggcaaa actgccccca ttcctccgga cagcgaggag 3000 ctaggccagc ggacacgaac acatacgaag cgtgacgtct cgacaccact gaagagtacc 3060 gagcagggga ttgtcgacca ggtgctcatc acgacgaacg cggagggtca aaagttcgtc 3120 aagatccgtg tacgttctac ccgtatacca cagatcggcg acaagttcgc ttcgcgtcac 3180 ggtcaaaagg gtacgatcgg tattacctac cgccaggagg acatgccatt tacggcggag 3240 ggtatcaccc ccgacatcat catcaacccg cacgccattc cgtcacgtat gacaatcggc 3300 cacttagtcg agtgtctcct ttccaagctc gccacgctca tcggaaacga gggcgatgcg 3360 acgccattca cggacctcac cgtcgagtcc gtgtcacagt tccttcgcca gaagggttac 3420 cagtcgcgag gtctcgaggt catgtaccat ggccacaccg gacgcaagct gcaggcacag 3480 gtctacctcg gtccgaccta ctaccagcgt ctcaagcaca tggtggacga caagattcac 3540 tcgcgtgcac gtggtccagt gcagatcctc acgcgtcagc cagttgaggg tcgtagtcgc 3600 gacggtggtc tgcggttcgg agagatggag cgtgattgta tgatttcgca tggtgtggcg 3660 gcattcttga aggagcgtct gtttgaggcc agcgatgcct atcgactgca cgtctgtgat 3720 atgtacgtcc acaggccgtc atcaccgtat tgaccactaa tttcttttta tagttgtggt 3780 cttaccgcca tcgccaacct cgttagtatt tcaaccatgt cttgtgtcat agacgctaac 3840 cgctctcaca gaaaaagcaa acgttcgagt gccgagcatg caagaacaag actgcatgtt 3900 cacagatata cattccttat gccgcgaagt tgcttttcca ggtgaggatt gcccgttgct 3960 tgaacccgct cattatttgt taataacacc ctctaggaat tgcaatctat gaacatcgca 4020 gcacggttgt acacgacatc cacaggacgg attcgagact aa 4062 <210> 10 <211> 987 <212> DNA <213> Unknown <220> <223> Ganoderma boninense G3 <400> 10 gtccatgttt gggactttca cttcacagtc gtcggtccag gtgcccatca tgctgcggtc 60 cacatactgt atcctccacg agcttggcga aaaggagctg ttcgatctca acgagtgtcc 120 ctacgactcc ggaggatatt tcattatcaa cggttctgag aaggtactca ttgcccaaga 180 gcgtatggcg acaaaccacg tctacgtctt cgccaaggca cagccttccc cgatcagttt 240 cctcgccgag attcgaagtg cggtcgagaa gggtgggaag accatcagcc agttccaggt 300 taagctttac cataggagcc aggagcgttc ggtacgtggc atgtcttttg tgcttgcgca 360 accgccgtag caaagcccct taccctgttt cacagctcgg gaatgtaatg aaggctacaa 420 ttccctacat caaggtcgac atccctatct gggtcgtctt ccgcgcgctg ggggtcatct 480 cagaccgcga catcctggag catatctgct atgatatgca ggacaaccag atgctcgaga 540 tgctgaagcc ttgtatcgac gagggtttcg ttattcagga ccgcgaggtt ggtggggacg 600 ttttgcatcg ggaactcttt gttgaatctt ttttagattg cactggacta catcggtaat 660 cgtgggacga caacaggctt gaaccgcgaa cgtcgtctgc gttacgcaca agagatcctt 720 cagaaggaaa tgctgcccca cgtctccatg gcagagggtt ctgagtccaa gaaggcgtac 780 ttcttcggct atatgatcca tcgtctcctg ctcgctgctt tggaacggag agacctcgac 840 gatcgcgatc acttcggtaa aaagcgcctt gatcttgcgg gcccacttct cgccaacctg 900 ttccgcatgt tgttccgcaa gcttaccaag gatgtatacc gctaccttca gaaggtgagc 960 cattatactt gtgtggtcac agctgat 987 <210> 11 <211> 987 <212> DNA <213> Unknown <220> <223> Ganoderma boninense <400> 11 gaatccatgt gtgggacgtt cgcttcagtc ttctccccag gtgcccatca tgctgcggtc 60 cacatactgc atcctccacg agcttggcga caaagagctg tttgatctca atgagtgtcc 120 ctacgactct ggaggatatt tcattatcaa cggctctgag aaggtgctca ttgctcagga 180 gcgcatggca acaaatcatg tctacgtctt cgccaaggcc cagccatccc ctatcagttt 240 cctcgccgag attcgaagtg cggtcgaaaa gggtgggaag accatcagcc agttccaggt 300 taagctttat cacaggagcc aggagcgttc ggtatgtggg atgtcttgtg tgcaaccgct 360 gtaacaacgc accttactct atgccacagc tcgggaatgt aatgaaggcc acaattccct 420 acattaaggt cgacatccct atctgggtcg tcttccgtgc actgggggtc atctccgacc 480 gcgacatatt ggagcatatc tgctacgata tgcaagacaa ccagatgctg gagatgttga 540 aaccttgtat cgacgagggc ttcgttattc aggaccgcga ggttggtggg gacgctttgc 600 atcgtgatcc ctcttttgag actttcttag attgcccttg actacatcgg taatcgtggg 660 acgacgacgg gcttgaaccg cgaacgtcgc ctacggtacg cacaagagat ccttcagaag 720 gagatgctac cccacgtctc catggccgag gggtccgagt ccaagaaggc gtacttcttc 780 ggctacatga tccatcgtct cctccttgct gcattggaac ggagagacct cgacgaccgt 840 gatcacttcg gtaaaaagcg tcttgacctc gcaggcccac ttctcgccaa cctgttccgc 900 atgctgttcc gcaaacttac caaagatgtg taccgctacc ttcagaaggt gagccattgt 960 gcatgtgtgg tcagtgtagg aaactaa 987 <210> 12 <211> 985 <212> DNA <213> Unknown <220> <223> Ganoderma boninense NJ3 <400> 12 gtccatgtgc gggactttca cttcatagtc gtcggtccag gtgcccatca tgctgcgatc 60 cacatactgt atcctccacg agcttggcga aaaggagctg ttcgatctca acgagtgtcc 120 ctacgactct ggaggatatt tcattatcaa cggttctgag aaggtactca ttgcccaaga 180 gcgtatggcg acaaaccacg tctacgtctt cgccaaggca cagccttccc cgatcagttt 240 cctcgccgag attcgaagtg cggtcgagaa gggcgggaaa accatcagcc agttccaggt 300 taagctttac cataggagcc aggagcgttc ggtacgtggc atgtcttttg tcttgcgcaa 360 ccgctgtagc aaagccctta ccccgttcca cagctcggga atgtaatgaa ggctacaatt 420 ccctacatca aggtcgacat ccctatctgg gtcgttttcc gcgcgctggg ggtcatctca 480 gaccgcgaca tattggagca tatctgttat gatatgcagg acaaccagat gctcgagatg 540 ctgaaacctt gtatcgacga gggtttcgtt attcaggacc gcgaggttgg tggggacgtt 600 ttgcatcggg aactctttgt tgaatctttt ttagattgca ctggactaca tcggtaatcg 660 tgggacgaca acaggcttga accgcgaacg tcgtctgcgt tacgcacaag agatccttca 720 gaaggaaatg ctgccccacg tctccatggc agagggttct gagtccaaga aggcgtactt 780 cttcggctat atgatacatc gtctcctgct cgctgctttg gaacggagag acctcgacga 840 tcgcgatcac ttcggtaaaa agcgccttga tcttgcgggc ccacttctcg ccaacctgtt 900 ccgcatgttg ttccgcaagc ttaccaagga tgtataccgc taccttcaga aggtgagcca 960 ttatacttgt gtggtcaaag ctgat 985 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 13 gtccatgttt gggactttca ct 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 14 atcagctgtg accacacaag t 21

Claims (17)

A composition for diagnosing root rot disease, comprising an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof,
The root rot is caused by microorganisms in the genus Ganoderma ,
The fragment is that the microorganism of the genus Ganoderma specifically has, the composition.
The composition of claim 1, wherein the gene represented by the nucleotide sequence of SEQ ID NO: 1 or the gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1 is specifically possessed by microorganisms of the genus Ganoderma .
The composition of claim 1, wherein the gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1 contains any one nucleotide sequence of SEQ ID NO: 2 to 9.
The composition of claim 1, wherein the agent is any one selected from the group consisting of probes, primer pairs, antibodies, aptamers, and oligonucleotides.
The composition of claim 1, wherein the fragment contains the nucleotide sequence of any one of SEQ ID NOs: 10 to 12.
The composition of claim 4, wherein the primer pair is a primer pair consisting of nucleotide sequences of SEQ ID NOs: 13 and 14.
delete The method of claim 1, wherein the microorganisms in the genus Ganoderma are Ganoderma alba, Ganoderma annularis, Ganoderma atrum, Ganoderma aurea, Ganoderma austral, Ganoderma amboinense, Ganoderma applanatum, Ganoderma boninense, Ganoderma brownie, Ganoderma colossus, Ganoderma formiinum, Ganoderma formiinum, Ganoderma formiinum, Ganoderma formiinum, Ganoderma incrassatum, Ganoderma lobatum, Ganoderma lucidum, Ganoderma meredithiae, Ganoderma miniatocinctum, Ganoderma multipileum, Ganoderma nigrolucidum, Ganoderma orbiforme, Ganoderma oregonense, Ganoderma purpurea, Ganoderma philipum, Ganoderma philippii, Ganoderma pseudo ppurea, Ganoderma philipp , Ganoderma steyaertanum, Ganoderma tornatum, Ganoderma tsugae, Ganoderma viridis, Ganoderma weberianum, and Ganoderma zonatum that is selected from the group consisting of.
A kit for diagnosing root rot disease comprising the composition of any one of claims 1 to 6 and 8.
A chip for diagnosing root rot disease comprising the composition of any one of claims 1 to 6 and 8.
A method for diagnosing root rot disease, comprising the step of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample,
The root rot is caused by microorganisms in the genus Ganoderma ,
The fragment is that the microorganism of the genus Ganoderma specifically has.
The method of claim 11, wherein the gene having at least 86% or more homology with the nucleotide sequence of SEQ ID NO: 1 comprises any one nucleotide sequence of SEQ ID NO: 2 to 9.
The method of claim 11, wherein the fragment contains the nucleotide sequence of any one of SEQ ID NOs: 10 to 12.
The method of claim 11, wherein the step of detecting the gene or fragment thereof is performed through a polymerase chain reaction (PCR) using a primer pair consisting of nucleotide sequences of SEQ ID NOs: 13 and 14.
The method of claim 11, wherein the method further comprises comparing the amount of amplified gene or fragment thereof in the control sample and the collected sample.
A composition for detecting microorganisms in the genus Ganoderma, comprising an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof,
The fragment is that the microorganism of the genus Ganoderma specifically has, the composition.
As a method for detecting microorganisms in the genus Ganoderma comprising the step of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 86% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample ,
The fragment is that the microorganism of the genus Ganoderma specifically has.

Images