CN106967830B - Application of ZFP gene as internal reference gene in quantitative detection of gene expression level of trichogramma borer - Google Patents

Abstract

The invention relates to the field of molecular biology, and provides application of a ZFP gene as an internal reference gene in quantitative detection of gene expression quantity of a trichogramma. When the borer trichogramma is stressed by high temperature or low temperature, the ZFP gene can be stably expressed in the borer trichogramma, so that the gene is used as an internal reference gene to accurately research the expression condition of the related gene in the borer trichogramma under the condition of temperature stress.

Description

Application of ZFP gene as internal reference gene in quantitative detection of gene expression level of trichogramma borer

Technical Field

The invention relates to the field of molecular biology, in particular to application of a ZFP gene as an internal reference gene in quantitative detection of gene expression quantity of a trichogramma.

Background

The Trichogramma chilonis belongs to the Trichogramma melittis family of hymenoptera and is an important natural enemy of pests. The imagoes lay eggs in host eggs, and the imagoes feed and develop in the host eggs to cause the death of the host eggs, thereby achieving the purpose of killing pests before harm. Although studies on the borer yellow-eye wasps are ecologically extensive, there are very few studies on molecular mechanisms. If researches show that the high temperature resistance or low temperature resistance of different geographical species of trichogramma, the mechanism of how the trichogramma is suitable for high temperature and low temperature needs to be further researched. If the mechanism of high and low temperature resistance of the trichogramma can be determined, breakthrough can be brought to the screening of the population and the improvement of the bee releasing effect.

The method is used for researching the functions of related genes in vivo after the borer trichogramma is stressed by different temperatures, wherein the most basic technical method is to carry out simple, rapid and accurate expression quantitative analysis on the functional genes. Compared with the traditional quantitative analysis methods such as blot hybridization and semi-quantitative RT-PCR, the real-time fluorescence quantitative PCR has the advantages of simple operation, strong specificity, high sensitivity, good linear relationship, low cost and the like, and is the most favored gene expression quantitative method by researchers in recent years. However, the accuracy of real-time fluorescence quantitative PCR detection depends greatly on the selection of internal reference genes, and the effect of the detection is to correct the sample amount and errors existing in the experimental process and ensure the accuracy of the experimental result. By measuring the amount of the reference in each sample, it is possible to correct for errors between sample amounts, so that the experimental results obtained are more reliable. The commonly used reference genes in insects are RPS3, Actin, GAPDH, Tublin, RPL10, 18SrRNA, 28SrRNA, etc., but actually none of the reference genes has mRNA expression level which is constant under all external or internal conditions, and ideally the reference genes do not exist, and the difference between different species is large. Therefore, it is generally necessary to select a gene which is relatively stably expressed under the action of the processing factor as an internal reference gene or internal reference standard, which is the key to the success of real-time fluorescence quantitative PCR.

Therefore, to perform the related high temperature and low temperature resistant mechanism research on the yellow-eyed moth larvae and to determine the genes related to high temperature and low temperature resistance, a proper reference gene must be screened out first. Heat shock protein genes in the insect body are important genes related to temperature stress and comprise heat shock protein genes hsp20, hsp40, hsp70 and hsp90, but the reaction of the genes to the temperature stress in the snout moth's larva trichogramma is not reported, and related reports about the stable internal reference genes in the snout moth's larva trichogramma under the temperature stress are not researched.

Disclosure of Invention

The invention aims to provide application of a ZFP gene as an internal reference gene in quantitative detection of the expression quantity of a gene related to temperature regulation in a trichogramma, and provides a basis for selecting a proper internal reference gene in real-time fluorescent quantitative PCR reaction of the trichogramma under different temperature stresses.

On one hand, the ZFP gene is used as an internal reference gene to quantitatively detect the expression quantity of the gene related to temperature regulation in the body of the aphrodisiac.

Preferably, the ZFP gene is used as an internal reference gene for quantitatively detecting the expression quantity of the gene related to the adaptation of temperature regulation in vivo of the trichogramma borer under the temperature stress.

Wherein, the quantitative detection method is preferably real-time fluorescence quantitative PCR.

In the invention, the nucleotide sequence of the ZFP gene is shown as SEQ ID NO. 1.

Preferably, when the expression quantity of the gene related to adaptive temperature regulation in the body of the trichogramma piniperus is quantitatively detected, the primer sequence for amplifying the ZFP gene is shown as SEQ ID NO. 12 and SEQ ID NO. 13.

In the present invention, the gene involved in temperature regulation is preferably a heat shock protein gene. Further preferably, the heat shock protein gene is hsp20, and the gene sequence of hsp20 is shown in SEQ ID NO. 11.

Preferably, when the hsp20 gene in the trichogramma borer is quantitatively detected, the primer sequence for amplifying the hsp20 gene is shown as SEQ ID NO:32 and SEQ ID NO: 33.

In another aspect, the invention provides a method for quantitatively detecting the expression level of a heat shock protein hsp20 gene after a borer trichogramma is stressed by temperature, which comprises the following steps: and (3) detecting the quantitative expression quantity of the hsp20 gene after the temperature stress of the trichogramma pyralis by taking the ZFP gene as an internal reference gene, wherein the method for quantitatively detecting the expression quantity is real-time fluorescence quantitative PCR.

Wherein the temperature stress comprises high temperature stress and low temperature stress, the temperature of the high temperature stress is preferably 30-40 ℃, and the temperature of the low temperature stress is preferably 4-10 ℃. The time of the temperature stress is preferably 0.5-4 hours.

Preferably, the gene sequence of the ZFP gene is shown as SEQ ID NO. 1.

When the invention is used for quantitatively detecting the expression quantity of the hsp20 gene in the body of the snout moth larva, the primer sequence for amplifying the ZFP gene is preferably the sequence shown by SEQ ID NO. 12 and SEQ ID NO. 13. The primer sequence for amplifying the hsp20 gene is preferably the sequence shown in SEQ ID NO. 32 and SEQ ID NO. 33.

Compared with the prior art, the invention has the following advantages:

the invention provides stable reference gene reference for analyzing the gene expression profile in the trichogramma borer, and provides reference for screening the real-time fluorescence quantitative PCR reference gene of other species under specific experimental conditions. The method can be established under different temperature stresses, and the method for detecting each gene in the trichogramma borer by using real-time fluorescent quantitative PCR reduces detection errors and enables the detection result to be more accurate and reliable.

Drawings

FIG. 1: RefFinder software analyzes the stability of the reference gene expression of the trichogramma borer under different temperature stresses, and the smaller the average stability value is, the more stable the stability is.

FIG. 2: and (3) analyzing the relative quantitative expression level of the hsp20 gene in the trichogramma crocea body after different temperature stresses by using the ZFP as an internal reference gene and utilizing a real-time fluorescent quantitative PCR method.

Detailed Description

The invention adopts the following method to screen and quantitatively detect the reference gene of the gene expression quantity related to the temperature regulation in the body of the snout moth larva. The method can screen out proper reference genes and can be used for researching the expression quantity of related functional genes in the body of the borer trichogramma under the temperature stress.

The method comprises the following steps: providing an alternative reference gene; taking untreated ostrinia nubilalis as a control, carrying out stress treatment on the ostrinia nubilalis imagoes at low temperature and high temperature, collecting ostrinia nubilalis samples after treatment, immediately extracting total RNA, determining the concentration of the RNA, carrying out reverse transcription on the RNA to synthesize cDNA, then taking cDNA of each sample as a template, verifying alternative internal reference genes by utilizing real-time fluorescence quantitative PCR, and carrying out data analysis by adopting RefFinder software, thereby screening the internal reference genes which are most stably expressed by the ostrinia nubilalis under the condition of temperature stress.

In the invention, the functional gene related to temperature in the body of the borer trichogramma is preferably a heat shock protein gene, such as heat shock protein genes hsp20, hsp40, hsp70, hsp90 and the like. In a preferred embodiment of the invention the functional target gene is hsp20 gene, the nucleotide sequence of which is shown in SEQ ID NO. 11.

In the screening process of the internal reference genes, the alternative internal reference genes are 10 genes as follows:

1. a Zinc finger protein (Zinc-finger-P, ZFP), the nucleotide sequence of which is shown in SEQ ID NO: 1;

2. an Elongation factor (Elongation factor2, EF2), the nucleotide sequence of which is shown in SEQ ID NO: 2;

3. ribosomal protein S23(Ribosomal protein S23, RPS23), the nucleotide sequence of which is shown in SEQ ID NO: 3;

4. ribosomal protein L13(Ribosomal protein L13, RPL13), the nucleotide sequence of which is shown in SEQ ID NO: 4;

5. actin 11(Actin related protein 11, ARP11), the nucleotide sequence of which is shown in SEQ ID NO. 5;

6. malate Dehydrogenase (MDH) with the nucleotide sequence shown in SEQ ID NO. 6;

7. ribosomal protein L44(Ribosomal protein L44, RPL44), the nucleotide sequence of which is shown in SEQ ID NO: 7;

8. myoglobin 20(Muscle specific protein 20, MP20), the nucleotide sequence of which is shown in SEQ ID NO: 8;

9. RNA polymerase I (RNA polymerase I, Pol I), the nucleotide sequence of which is shown in SEQ ID NO. 9;

10. ATP synthetase (ATP synthsase), the nucleotide sequence of which is shown in SEQ ID NO: 10.

The preferred trichogramma borer selected by the invention is the trichogramma borer in the same physiological state. In the specific embodiment of the invention, the trichogramma borer bred indoors under the same condition is adopted, and the breeding conditions are as follows: indoor population of the yellow-eyed moth larvae in a climatic chamber: temperature 25 ℃, humidity 75%, illumination: dark-14 hours: and (3) expanding propagation by using the rice moth eggs under the condition of 10 hours, and carrying out temperature stress treatment by using the primarily emerged adult bees.

In the invention, the method for carrying out stress treatment on the trichogramma boreri at different temperatures comprises the following steps: selecting the borer trichogramma treated under the conditions of low temperature stress, high temperature stress and normal temperature as experimental materials, wherein the temperature of the low temperature stress is preferably 4-10 ℃, and more preferably 5-7 ℃; the temperature of the high-temperature stress is preferably 30-40 ℃, and more preferably 35-38 ℃. In the invention, the time for carrying out low-temperature or high-temperature stress on the trichogramma borer is at least 0.5 hour, preferably, the time for carrying out low-temperature or high-temperature stress is 0.5-4 hours, and more preferably 1-2 hours. In the invention, the temperature of the normal-temperature treated trichogramma borer is 24-26 ℃, and preferably 25 ℃. The temperature stress device is not particularly limited, and in the specific embodiment of the invention, the illumination incubator and the refrigerator are adopted to respectively carry out high-temperature and low-temperature stress treatment on the phascolosoma. The invention has no special limitation on the temperature stress operation mode, and can place the borer trichogramma in the container for temperature stress. The preferred method is to place the yellow-eye moth in a glass tube, seal the glass tube with a cotton plug, and treat the glass tube at a stress temperature. To ensure the accuracy of the screening assay, the present invention preferably sets at least 3 biological replicates per treatment.

Collecting the temperature-stressed yellow-eyed moth bees, extracting the total RNA, measuring the concentration of the RNA, and performing reverse transcription to synthesize cDNA. The present invention is not limited to this step, and the operation may be performed by a conventional method in the art.

And (3) verifying the alternative reference genes by using the cDNA of each sample as a template and utilizing real-time fluorescent quantitative PCR.

The primers corresponding to the 10 alternative reference genes are subjected to a real-time fluorescent quantitative PCR method

Zinc-finger-P(ZFP)：

TGGATTCTGAACAGCCATGCA, reverse: TTGAATCTGGTGCAGCGGTT, respectively;

Elongation factor 2(EF2)：

positive: CGTGGCGTGCGATTTAACAT, reverse: GTTCCATGAGCCTCGGTGAA, respectively;

Ribosomal protein S23(RPS23)：

positive: TGCCATCCGAAAGTGTGTCA, reverse: TACGACCGAATCCTGCAACC, respectively;

Ribosomal protein L13(RPL13)：

positive: GTATGTCCGCACCTGGTTCA, reverse: CAGCGATGCCAATGGTCATG, respectively;

Actin related protein 11(ARP11)：

positive: AGCATGGCAAGCTCTTCCTT, reverse: TTGGTGGAGGAGTTGGAGGA, respectively;

Malate dehydrogenase(MDH)：

positive: GCCTTCCAGCCCAAGATCTT, reverse: TTTGGGCAGCTCGTCTTGAT, respectively;

Ribosomal protein L44(RPL44)：

positive: GCAAGGAAAGGCATGCTAGC, reverse: TGCATTCCATCCTCAGCACA, respectively;

Muscle specific protein 20(MP20)：

positive: GAGAGCATCATCGGCAGGAA, reverse: GGTGTCTGTATGTCTCGCGA, respectively;

RNA polymeraseI(PolI)：

positive: CAAGGGCGATTACATGCAGC, reverse: TTACCCGACCACATCTGCAC, respectively;

ATP synthase：

positive: ATCGACACGGTCTGCAATGT, respectively; and (3) carrying out the following steps: TTGTCCGTCTTGTAGCCGAC are provided.

In the invention, the primer sequence of the hsp20 gene is as follows: positive: AACGTAGTGAGCGATGGTGG, reverse: CATTGAAGTAAGCCGGCACG are provided.

Preferably, the real-time fluorescent quantitative PCR system and conditions are respectively as follows: reaction system of real-time fluorescence quantitative PCR: the quantitative PCR reaction system is 20 μ L in total, and comprises 1 μ L of cDNA (containing 3 μ g of total RNA), 10 μ L of SYBR fluorescent reagent (iTaqUniversal SYBR Green Supermix), 1 μ L of each forward/reverse primer, and 7 μ L of double distilled water; reaction conditions of real-time fluorescent quantitative PCR: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃. In the present invention, preferably 2 technical repeats are set per sample.

And analyzing the Ct value obtained by real-time fluorescent quantitative PCR by using RefFinder software, and screening to obtain the internal reference gene with the most stable expression quantity as a proper internal reference gene for quantitatively detecting the gene expression quantity related to temperature regulation in the trichogramma.

refFinder (http:// http:// fulxie.0 genes. us/? type ═ reference & i ═ 1) is a free tool for comprehensive evaluation of the stability of the internal reference genes from a large set of experimental data, which can evaluate and screen the internal reference genes from a large set of experimental data, it can synthesize the results of the four methods bestkeper, GeNorm, Normfender and Δ Ct to rank the candidate internal reference genes finally for stability, wherein the Δ Ct method is simpler, the appropriate internal reference genes are determined by comparing the relative expression of each pair of housekeeping genes in each sample, bestkeper determines the appropriate internal reference genes by the original Ct values and the amplification efficiency (E) of the primers, and ranks them in turn.

The result shows that the ZFP gene has the most stable expression under different temperature stresses of the aphrodisiac, so that the ZFP gene is used as an internal reference gene for quantitatively detecting the expression of the gene related to temperature regulation in the aphrodisiac.

The present invention will be described in detail with reference to the following examples and drawings for better understanding of the objects, technical solutions and advantages of the present invention, but they should not be construed as limiting the scope of the present invention. The application of the RefFinder software for analyzing the stability of the internal reference gene is carried out according to the application instructions.

Example 1 screening of reference Gene

First, feeding the yellow-eye wasp.

A borer trichogramma laboratory population, in a climatic chamber: temperature 25 ℃, humidity 75%, illumination: dark-14 hours: under the condition of 10 hours, the rice moth eggs are used for propagation, and the temperature stress treatment is carried out on the primarily emerged adult bees.

Second, temperature stress treatment

The temperature of the light incubator was set at 25 deg.C, 30 deg.C, 35 deg.C, and 40 deg.C, respectively, and the temperature of the refrigerator was set at 4 deg.C and 10 deg.C. Adult ostrinia nubilalis were placed in a glass tube, sealed with a cotton plug, and treated at the above temperatures for 1 hour, respectively. Collecting samples to extract total RNA; each treatment set 3 biological replicates.

And thirdly, carrying out real-time fluorescent quantitative PCR analysis on primer design and amplification efficiency of all genes.

1. Primer design

10 candidate reference genes and 1 gene related to adaptive temperature regulation were selected as target genes, and specific amplification primers were designed using primer3.0 software (Table 1).

RNA extraction Process

200-headed borer trichogramma were placed in a 2.0mL glass homogenizer, 500. mu.L of Trizol reagent was added, and homogenization was performed manually for 5min, after which the procedure was completed with reference to the Trizol reagent (Invitrogen, lot: 15596026) instructions. RNA quality and concentration detection: taking a 1 mu LRNA sample, detecting OD260/280 and concentration by using NanoDrop2000, wherein the OD260/280 value is between 1.8 and 2.2, and taking a qualified sample. First strand cDNA Synthesis: reverse transcription was performed using 3. mu.g of gRNA, and the procedure was performed according to the instructions of Thermo Fisher reverse transcription kit (Thermo Fisher, batch No. K1622).

TABLE 1 primer sequences and amplification efficiencies of the candidate reference gene and the target gene.

3. Amplification of reverse transcribed synthetic cDNA

And (2) taking the cDNA synthesized by reverse transcription as a template, utilizing a designed and synthesized specific primer (table 1) to amplify the alternative reference gene and the target gene by PCR, detecting whether the length of an amplified fragment is consistent with that of the selected target fragment by agarose gel electrophoresis, and then recovering a PCR product and sequencing for verification. The primers designed above can be used for effectively amplifying target fragments, and the target fragments have the same size as the target fragments designed by the people, are single in band and have no specific amplification. PCR amplification System: a20. mu.L reaction system contained 10. mu.L of 2 XPCR buffer Mix, 1. mu.L each of the forward/reverse primers, 1. mu.L of cDNA template, and 7. mu.L of sterile water.

4. Investigation of primer amplification efficiency

The cDNA synthesized by the reverse transcription is diluted into 5 cDNAs with different concentrations according to 5 times of equal ratio and is used as a template, and the designed and synthesized specific primers (table 1) are utilized to carry out fluorescence quantitative PCR amplification on the alternative reference gene and the target gene. The reaction system of the real-time fluorescent quantitative PCR is 20 mu L, and comprises 1 mu L of cDNA (containing 3 mu g of total RNA), 10 mu L of 2 xiTaq SYBR Green fluorescent reagent (2 xiTaq Universal SYBR Green Supermix), 1 mu L of each forward/reverse primer and 7 mu L of double distilled water, wherein the SYBRGreen fluorescent reagent is purchased from Bio-Rad company; reaction conditions are as follows: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃. The amplification efficiency of the primers is given by the software of the real-time fluorescent quantitative PCR instrument, and whether the primers are proper or not is judged according to whether the amplification efficiency E (%) is between 90% and 110% (Table 1). The fluorescent quantitative PCR instrument is CFX96, Bio-Rad.

5. Real-time fluorescent quantitative PCR

The cDNA is used as a template to perform fluorescent quantitative PCR amplification on an alternative reference gene and a target gene (Table 1), and the reaction system and the reaction conditions are referred to [ 4 ] investigation of primer amplification efficiency. The reaction system of the real-time fluorescence quantitative PCR is 20 mu L, and comprises 1 mu L of cDNA (containing 3 mu g of total RNA), 10 mu L of 2 xiTaq fluorescent reagent, 1 mu L of each forward/reverse primer and 7 mu L of double distilled water, wherein the SYBRGreen fluorescent reagent is purchased from Bio-Rad company; reaction conditions are as follows: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃.

And inputting the Ct value obtained by the real-time fluorescence quantitative PCR into RefFinder software for analysis according to the format requirements of the analysis software. The results of the internal reference gene stability analysis are shown in FIG. 1. As can be seen from fig. 1, the stability of the 10 different candidate genes is: ZFP > ARP11> RPL13> EF2> MDH > ATP synthsase > RPS23> RPL44> MP20> PolI, where ZFP is most stable.

Traditionally, a single common internal reference gene is generally adopted in the real-time fluorescence quantitative PCR development, and the fact proves that the operation method is not preferable, and any external condition or change of the internal condition influences the stability of the expression of the internal reference gene. In addition, the expression quantity variation difference of the same target gene is analyzed by using different internal reference genes, and some differences can even reach dozens of times, so that the reliability of an experimental result is seriously influenced. Therefore, the screening method of the reference gene of the sesamia inferens trichogramma under different temperature stresses screens the ZFP with the most stable expression level as the reference gene for quantitatively detecting the gene expression level related to temperature regulation in the sesamia inferens trichogramma.

Example 2 use of ZFP as an reference Gene

1. Temperature stress

The method comprises the steps of taking the borer trichogramma stressed for 1 hour at different temperatures as an experimental sample, taking the borer trichogramma test insect at 25 ℃ as a control sample, taking ZFP as an internal reference gene, and detecting the expression level of hsp20 gene of the borer trichogramma by utilizing real-time fluorescent quantitative PCR. Temperature stress method, reaction system and reaction conditions the operation process, conditions and system of low and high temperature stress, real-time fluorescence quantitative PCR in example 1 were referred to. Each treatment was set up with 2 technical replicates and 3 biological replicates. Data processing uses 2^-△△CtProcessing by the method, processing the sample-delta Ct control sample by the delta-delta Ct, and processing the target gene-delta Ct reference gene by the delta-delta Ct. The significance of the difference between the treatments was statistically analyzed using the DPS software.

The results show that: the low-temperature treatment has no obvious influence on the expression quantity of the hsp20 gene of the aphrodisiac trichogramma; the expression level was not significantly affected by 30 ℃ in the high temperature treatment, but the expression level of hsp20 was significantly increased by 3.8-fold and 9.6-fold as compared to the control sample as the temperature was increased to 35 ℃ and 40 ℃.

The method utilizes real-time fluorescent quantitative PCR to carry out quantitative amplification on 10 alternative internal reference genes and 1 target gene in the trichogramma borer under different temperature stress conditions, and adopts RefFinder software to analyze the stability of the internal reference genes, thereby screening out the most stable internal reference gene ZFP in the trichogramma borer under different temperature stress conditions. On the basis, the expression rule of the borer trichogramma hsp20 gene under different temperature stress conditions is determined by taking the borer trichogramma heat shock protein gene hsp20 as a target gene and ZFP as an internal reference gene. The internal reference gene ZFP screened by the invention is suitable for the expression profile analysis of the target gene in the trichogramma boreri under the stress of different temperature conditions, and provides reference for the quantitative PCR experiment of the trichogramma boreri under the stress of temperature.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Zhejiang province academy of agricultural sciences

Application of <120> ZFP gene as internal reference gene in quantitative detection of gene expression level of trichogramma borer

<130> GW2017I0814

<160> 33

<170> PatentIn version 3.5

<210> 1

<211> 642

<212> DNA

<213> Artificial sequence

<400> 1

atggagggat ccaacggact gagtacttct acaaaatctt atccaattgc ctatcctgta 60

aaagaagaga ttaaggatcc agcaaaaact attgttcaac atcaagtcgc aggaaatgaa 120

gtcaaaatgc ttgttatttt gaagaatggg gaacaaagac tcattacatt tactcttgct 180

aataatgagt gcacagttgc tgagttattg gaacaagcaa atatactgga ttctgaacag 240

ccatgcattt cattagtatc ggatccaaac ttgaactaca ttgttaattt cacaccacag 300

tcatcaaata ataacaacga agacaaacaa tcgtttgaag agcctaaaaa cttagttaat 360

catgataaaa ctgcttcgtc aaccgctgca ccagattcaa caagctcaat tacagagttg 420

gcaaaacctg caaagaaaaa agtgtatgtt aacggttttc tggcagtttg ctcatattgt 480

ggaatgaatt cagcagactt taattattgt attagatgta aaaggaaaat acctgataaa 540

gttaaggcaa tgtctatatc aacgggtgtc ataacaaaac tagacaaccc atgtcttaat 600

atgccattat tagctcaaaa agaaaattct gcggtattat aa 642

<210> 2

<211> 996

<212> DNA

<213> Artificial sequence

<400> 2

gccaagtcag atcctatggt acaatgtatc attgaagaat ctggagagca tatcattgcc 60

ggtgctggtg aactccatct tgaaatttgt ctgaaagatc ttgaagaaga tcacgcttgt 120

attccaatta agaagtcgga tccagttgta tcatacagag aaactgtttc tgaagaatca 180

gaccagatgt gtctgtctaa gtcacctaat aagcacaacc gtctgttcat gaagccccaa 240

ccaatgcctg atggtcttgc tgaagacatc gacaagggtg atgtaaatcc tcgagatgac 300

ttcaaggttc gtgctcgtta tctgagcgaa aaatacgatt acgatgtaac agaagccagg 360

aaaatctggt gctttggccc tgacggaact ggacctaaca tccttgtcga ttgcaccaag 420

ggagtgcaat atcttaatga aattaaagat tcagtcgtcg ctggattcca atgggctgct 480

aaagaaggtg tgctctcgga agaaaatctt cgtggcgtgc gatttaacat ttatgatgtt 540

acgttacacg ctgacgctat ccatagaggt ggtggacaga ttatccccac aactagacgt 600

tgtctctatg cttgccttct tactgcttca ccgaggctca tggaacccgt ctatctgtgc 660

gaaattcagt gccctgaagt tgccgttggt ggtatctatg gtgtcctcaa tcgcagacgt 720

ggtcacgttt ttgaagaaca acaggtggct ggtacgccta tgttcgtcgt aagagcatac 780

ttgcccgtaa acgagtcctt cggctttaca gctgacttgc gttccaacac tggcggtcaa 840

gccttcccac agtgcgtgtt cgaccattgg caaatccttc caggagatcc aactgaacct 900

ggaactcgcc cataccaagt tgtacaggat acacgtaaaa ggaaaggatt gaaggacggt 960

cttccagact tggcttcata tttggataaa ttgtaa 996

<210> 3

<211> 561

<212> DNA

<213> Artificial sequence

<400> 3

gaacagctac tcgttactta tgcgctacag cgggtgcgcg aagcgaaaat tctaaccaag 60

gccttcagac tctggcaacg tgagagaccg cttctctttt acgattcttc ctcttactac 120

tcggcaacga tgggtaagcc tcacggtatt cgtactgcac gtaaatacgt caaccaccga 180

cgtgaacaac ggtggaacga caaagactac aagaaagccc atttgggtac tcgctggaag 240

gccaatccct ttggaggagc ttcccatgct aagggaatcg tcctcgagaa agttggtgtc 300

gaggctaaac agcccaactc tgccatccga aagtgtgtca gggtacagct tatcaaaaat 360

ggcaagaaaa tcacggcgtt cgtacctcgt gacggttgct taaacagcat tgaagagaac 420

gacgaagttt tggttgcagg attcggtcgt aaaggtcacg ccgttggtga cattcccggt 480

gtcagattca aggttgtcaa ggttgccaat gtttcattgt tggctttgta taaggagaag 540

aaagaacgac caaggtcgta a 561

<210> 4

<211> 654

<212> DNA

<213> Artificial sequence

<400> 4

atgggtaagg gtaataacat tatcccaaat gtccattgcc acaaggactg gcaaaggtat 60

gtccgcacct ggttcaacca gcctatgaga aagatccgcc gaaggactaa tcggatcaag 120

aaagcacgag ctgttgcccc aaggccactt aaggatctga gaccagtagt acactgccca 180

acccagcgtt accacaagaa ggtcaggcaa ggtagaggat tcacccttgc tgaactgaaa 240

gcttgtgggc tcaacaaacg ctatgccatg accattggca tcgctgtaga tccccgtagg 300

aggaacaagt cagttgaaag cctccaacaa aatgtccaaa ggctaaagga acatcagaca 360

aaactcattt tgttccctct gaatcccaaa aagatcaaga agggagagac tgaacagtca 420

caagctgtaa ctcaactgaa gggcaaagtg atgccagagg gtgttaaggc tccatccgcc 480

aaagcaatgg cccgagtcat cactgaagat gaaaagaaat tcaatgctta tgttgcattg 540

agagttgcca gagccgatgc tcgtcttgtt ggcattcgag caaaacgtgt caaggatgca 600

tctgaaaatc cagatgatgt tactaaagtc aaggacaaga aagcaaaaaa ataa 654

<210> 5

<211> 618

<212> DNA

<213> Artificial sequence

<400> 5

atgttcgtac agtgtaaaaa tgatgcatca atagagagac taaagcatgc attcaaggag 60

ggctgtcata tttatggtta catggaagtc aatcgcgtag gaggtagttt tcatatagct 120

ccaggacaaa gtttttctat caatcatgtt catgtacatg atgttcaacc atattcttca 180

tctgctttca atttgtcgta taaaatccgt cacttgagtt ttggtacaaa tattgcagga 240

gttacaaatc ctatagataa cacacaagtc attagctcgg gcgcgatgat gttccaacat 300

tttatcaaaa tagttccaac gacgtacgtg aagctggatg gttcggtgct acacacgaat 360

cagttctcca tgacgaagct cgatcgcgac gtgtcgggcg gaatcggcga gggcggcatg 420

cccggcatat tcttctccta cgagatgagc ccgctgatgg tcaagtacac tcagacctcg 480

aagccgttcg gacacttttt gaccaatgct tgcgccatta tggggggcat tttctccgtg 540

gctagcattc tcgatggtct tgtctacgcc tcggtcaagg ccattcagaa gaaaatcgaa 600

ttaggcaaaa ttagctaa 618

<210> 6

<211> 699

<212> DNA

<213> Artificial sequence

<400> 6

atgcgcctag acccggaagt ccagcgcgcc gaggagttgg ccgcgcgcca tcccgagctc 60

gcgcagcagc agcagcagca gcgcatggtg cgtctgcgac ccgagcgatt catgcaggag 120

gaccacctga cccatccgga gcgcgactgg ctgcacttgc actttggcgg cgccgacgcg 180

gcccgcgaca agcacagcat cgtcgtgacg cccctgatgc tggtgggcac cgtctccatg 240

gaggacgacg tgacgcagta cgactgcatc gagatgctgc gcgagctcgc tgccaggaag 300

cacaatacgt tcaacatgag caccaggagt atcttgctgc agttcgccgc cttccagccc 360

aagatctttc gggccgttca acccgagaac aactcgccgg ccaacaactc gagcctgggc 420

ctgtcgatgg actgctgggt caagtactac gccttcaaac cgaattacag tacggaatac 480

gaaggcgtcg tcaagaatct gtctcccacc tcgatcggcc ttaagatgaa caatttcacc 540

aacctctacg tgaacatcga gagggactgc aacaagcatc aagacgagct gcccaaaaaa 600

aagtgctgca aagtcaccaa agacgaggtc atcaagttca ggttcgtgaa gttcggcgtg 660

catccgcaca gcgtcttcat ttacggcgcc atggtatga 699

<210> 7

<211> 315

<212> DNA

<213> Artificial sequence

<400> 7

atggtgaacg taccaaagca gaggcgcact ttctgccaaa agtgcaaagt gcacaagacc 60

cataaggtca cccagtacaa aaagagcaag gaaaggcatg ctagccaggg tcgcagacgt 120

tacgaccgca aacagcaagg ttttggaggt caaactaagc ccatcttcag aaagaaggct 180

aagaccacca agaaaattgt gctgaggatg gaatgcactg agtgcaagta cagaaagcaa 240

gttcctctta agaggtgcaa acatttcgaa cttggaggtg acaagaagag gaagggacaa 300

atgatccagt tctaa 315

<210> 8

<211> 549

<212> DNA

<213> Artificial sequence

<400> 8

atgactctcg aacgtcaagt ccgcgctaag atcgccgcga agcgcgaccc ccagatggag 60

gccgaggcca aggaatgggt cgagagcatc atcggcagga agttcacatc ccccttcgag 120

gagtacctgc gcgacggcca agtgctctgc gagcttatga acatcatcaa gcccggctcc 180

attcccaaaa tcaacacctc cggcggtgaa ttcaaaatga tggagaacat caccaaattc 240

caaaaggctt tgagagatta cggtgtcgca gacatagatg tttttcaaac tgtcgagcta 300

tgggaaaaga aggtcattgg acaggtcatc acgacacttt tcgccctcgg tcgcgagaca 360

tacagacacc ccgaatggaa aggaccttcc ctgggaccca agcccgccga cgagcacaag 420

cgcgacttca cggaggagca gctcagagcc ggcgagtcgg tgatcggtct ccaggctggc 480

agcaacaaag gcgccaccca ggcaggacaa aacatgggcg cttcccgcaa gatcctccta 540

ggaaaatga 549

<210> 9

<211> 733

<212> DNA

<213> Artificial sequence

<400> 9

caggatcacg ttatctcggg cgtaaagctc actttgcgcg gcaacttctt caccaagggc 60

gattacatgc agctcgtctt ctcagcgctg tcggacgtcc cgggcaaact gagcctgctg 120

ccaccaagca tcatcaagcc cgtgcagatg tggtcgggta agcaggtcat ctcgaccatc 180

atcatcaatc tgataccgcg gggaaaggcc aagataaatc tcgaggccac gtccaagatc 240

ggcgccaaag agtggctggc gggtaaatcg cgcaaatggg agtgcggcac agagttccgc 300

aatgacaaca ccatgtccga ggccgaggtc atcttccgtg acggcgagtt gctctgcggc 360

gtgctcgaca agaagcacta cggtgcgacg gcctacggcc tcgtgcactg cgcccacgag 420

ctctacggcg gcactacgtc cggccaatta ctcagcgcct tcggtaaggt gttcatggcc 480

tatttgcgaa tcacaggatt taccctgggg ccgcgcgata ttctcgtcaa gagtcgtgcc 540

gacgcgaaac gtgcgaagat catcgagcaa tgccgaagca ttggcaagag cattcacaga 600

tcgatcttgc agctgcccga ggacacgcct gacgaggaag tcgccgccaa gatggaagaa 660

tcttactata aaattccaaa attctccaac aaagtcgatc gcgagtacaa attccagctg 720

gataagttca cca 733

<210> 10

<211> 449

<212> DNA

<213> Artificial sequence

<400> 10

atggtcgtgc agcgattgct agcgcaaact tttcgtcact taaaatgtca caatttcgac 60

tcgctcgttc aaagatcttt ggcacctcgg ctgttgagct gccagtcgaa gctgagctgg 120

agcagaaaac gcttctattg ccaagccatc gacacggtct gcaatgtcgg cacgattgga 180

catgttgatc atggcaaaac caccttgacg gccgctgtca ccaagtacct ggccgagaag 240

aacaaaagtt gtaaatatgt gtcgtacgac gaaatcgaca aagctcccga ggagaaagct 300

cgcggaatca ccatcaacat agcccacgtc ggctacaaga cggacaaacg tcgctatgcc 360

cacacagact gtccaggaca tttggatttt atcaaaaata tgatcagcgg tgcttcacaa 420

atggatggtg ccattctgat tgttgctgc 449

<210> 11

<211> 1052

<212> DNA

<213> Artificial sequence

<400> 11

ctggatgcag ccgaccgagc ccgagcttcc ggagcatcct ccgttgcagc tgctcgagca 60

gcctcccgag cagccacccg agcatccacc ggcgcaggga gccggtacct ggtgaactat 120

cagaggcata ggcgagcagc cagagttgca gtgggagtcg gtgctgcagc cggtgttgca 180

gctggatgca ccgttgttgt tgcagttgga ctggcagacg gactcctgga cgcatgtgtc 240

ctggcacgag cagccaccgt tgccgccgca gcctacgctg ccaccgcagc ctacgttgcc 300

accgcagtca ccgccaccga tctgggcggt ttcctcgacg cagacgagcc tcttgacctg 360

gccggtggtc tgggtgcctt gggagcaggt gctgcccgtt tgggtgccta ccgagcatgt 420

gctgactccg gtctgggtgc cgacgttgca ggtgctggcg caggtctgcg tgccgacgct 480

gctgctgcat cccgtctggg tgcctacgct acatccaccg ccaacgggca acagtacttg 540

gccgacgtgg gtcttgatgc agtgggcatc gctgctcgag cagacgatcg cgccgaccag 600

agccaaagta agggcggttt tcagggaaaa cgtcatcttt gtgcttgggt actcgtatac 660

ttgttatact actgtctaga tcgctggccc acctcgcttc gtccctaccg agcatgtgct 720

gactccggtc tgggtgccga cgttgcaggt gctggcgcag gtctgcgtgc cgacgctgct 780

gctgcatccc gtctgggtgc ctacgctaca tccaccgcca acgggcaaca gtacttggcc 840

gacgtgggtc ttgatgcagt gggcatcgct gctcgagcag acgatcgcgc cgaccagagc 900

caaagtaagg gcggttttca gggaaaacgt catctttgtg cttgggtact cgtatactcg 960

ttactactgt ctagatcgct ggcccacctc gcttcgtggc gattcggaaa agtcgccggc 1020

tttactcgat tttcggccac ttccgtttct ga 1052

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

tggattctga acagccatgc a 21

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

ttgaatctgg tgcagcggtt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

cgtggcgtgc gatttaacat 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

gttccatgag cctcggtgaa 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

tgccatccga aagtgtgtca 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

tacgaccgaa tcctgcaacc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

gtatgtccgc acctggttca 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

cagcgatgcc aatggtcatg 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

agcatggcaa gctcttcctt 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

ttggtggagg agttggagga 20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<400> 22

gccttccagc ccaagatctt 20

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence

<400> 23

tttgggcagc tcgtcttgat 20

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<400> 24

gcaaggaaag gcatgctagc 20

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<400> 25

tgcattccat cctcagcaca 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence

<400> 26

gagagcatca tcggcaggaa 20

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence

<400> 27

ggtgtctgta tgtctcgcga 20

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<400> 28

caagggcgat tacatgcagc 20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<400> 29

ttacccgacc acatctgcac 20

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence

<400> 30

atcgacacgg tctgcaatgt 20

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence

<400> 31

ttgtccgtct tgtagccgac 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<400> 32

tgtcccagat cgttcgcaag 20

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence

<400> 33

cggactcgtc ctcgtaatcc 20

Claims (10)

1. The application of ZFP gene as reference gene in quantitatively detecting the expression quantity of the temperature regulation related gene in the body of the post-temperature-stress aphrodisiac.
2. 2. The use according to claim 1, wherein the quantitative detection method is real-time fluorescent quantitative PCR.
3. 3. The use of claim 1, wherein the nucleic acid sequence of the ZFP gene is shown in SEQ ID N0: l.
4. 4. The use of claim 1 or 3, wherein the primer sequence for amplifying the ZFP gene is shown as SEQ ID N0:12 and SEQ ID NO 13.
5. 5. The use of claim 1, wherein the gene involved in thermoregulation is a heat shock protein gene.
6. 6. The use of claim 5, wherein the heat shock protein gene is hsp20, and the gene sequence of hsp20 is shown in SEQ ID NO. 11.
7. 7. The use of claim 6, wherein the primer sequences for amplifying the hsp20 gene are shown in SEQ ID NO. 32 and SEQ ID NO. 33.
8. 8. A method for quantitatively detecting the expression quantity of a heat shock protein hsp20 gene after a borer trichogramma is stressed by temperature comprises the following steps: and (3) detecting the quantitative expression quantity of the hsp20 gene after the temperature stress of the trichogramma pyralis by taking the ZFP gene as an internal reference gene, wherein the method for quantitatively detecting the expression quantity is real-time fluorescence quantitative PCR.
9. 9. The method according to claim 8, wherein the temperature stress includes a high temperature stress and a low temperature stress, the temperature of the high temperature stress is 30 to 40 ℃, and the temperature of the low temperature stress is 4 to 10 ℃.
10. 10. The method according to claim 8, wherein the temperature stress is carried out for 0.5 to 4 hours.