CN106957922B - Application of TMEM209 gene as reference gene in quantitative detection of gene expression level of rice borer trichogramma - Google Patents

Abstract

The invention relates to the field of molecular biology, and provides application of a TMEM209 gene as an internal reference gene in quantitative detection of gene expression level of aphelenchoides farinae. When the rice borer trichogramma is stressed by different insecticides, the TMEM209 gene can be stably expressed in the rice borer trichogramma, so that the gene is used as an internal reference gene to accurately research the expression condition of the related gene in the rice borer trichogramma under the stress of the insecticides.

Description

Application of TMEM209 gene as reference gene in quantitative detection of gene expression level of rice borer trichogramma

Technical Field

The invention relates to the field of molecular biology, in particular to application of a TMEM209 gene as an internal reference gene in quantitative detection of gene expression quantity of a rice borer trichogramma.

Background

The Trichogramma trichomonas Ashmead belongs to the Trichogramma family of hymenoptera and is an important natural enemy of pests. The imagoes lay eggs in host eggs, and the imagoes feed and develop in the host eggs to cause the death of the host eggs, thereby achieving the purpose of killing pests before harm. Although many studies have been made on the trichogramma, the studies on molecular mechanism are very rare. If researches show that the high-temperature resistance or low-temperature resistance of different geographical populations to the trichogramma pyriella hubner is different, the mechanism of how the trichogramma pyriella hubner can cope with the high temperature and the low temperature is still to be further researched. If the mechanism of high and low temperature resistance of the aphelesia angustifolia can be determined, breakthrough can be brought to the screening of the population and the improvement of the bee releasing effect.

The most basic technical method is to carry out simple, rapid and accurate expression quantitative analysis on functional genes. Compared with the traditional quantitative analysis methods such as blot hybridization and semi-quantitative RT-PCR, the real-time fluorescence quantitative PCR has the advantages of simple operation, strong specificity, high sensitivity, good linear relationship, low cost and the like, and is the most favored gene expression quantitative method by researchers in recent years. However, the accuracy of real-time fluorescence quantitative PCR detection depends greatly on the selection of internal reference genes, and the effect of the detection is to correct the sample amount and errors existing in the experimental process and ensure the accuracy of the experimental result. By measuring the amount of the reference in each sample, it is possible to correct for errors between sample amounts, so that the experimental results obtained are more reliable. The commonly used reference genes in insects are RPS3, Actin, GAPDH, Tublin, RPL10, 18S rRNA, 28S rRNA, etc., but practically none of the reference genes has mRNA expression level which is constant under all external or internal conditions, and ideally the reference genes do not exist, and the difference between different species is large. Therefore, it is generally necessary to select a gene which is relatively stably expressed under the action of the processing factor as an internal reference gene or internal reference standard, which is the key to the success of real-time fluorescence quantitative PCR.

Therefore, in order to study the pesticide-resistant mechanism of the rice borer trichogramma and to determine the genes related to pesticide resistance, a suitable reference gene must be screened out. The P450 genes in the insect body are important genes related to pesticide stress, and comprise CYP4G15, CYP4C1, CYP49A1, CYP18A1, CYP6A1, CYP6A2, CYP9P3, CYP9E2 and the like, but the reaction of the genes to the pesticide stress in the rice borer trichogramma is not reported, and no related report about stable internal reference genes in the rice borer trichogramma under the pesticide stress is researched.

Disclosure of Invention

The invention aims to provide application of TMEM209 gene as an internal reference gene in quantitative detection of the expression quantity of genes related to pesticide detoxification metabolism in the rice borer trichogramma, and provides a basis for selecting a proper internal reference gene in real-time fluorescent quantitative PCR reaction of the rice borer trichogramma under pesticide stress.

On the one hand, the TMEM209 gene is used as an internal reference gene for quantitatively detecting the expression level of the genes related to the detoxification and metabolism of the pesticide in the rice borer trichogramma.

Preferably, the TMEM209 gene is used as an internal reference gene for quantitatively detecting the expression level of the genes related to detoxication metabolism in the rice borer trichogramma under the stress of insecticides.

Wherein, the quantitative detection method is preferably real-time fluorescence quantitative PCR.

In the invention, the nucleotide sequence of the TMEM209 gene is shown as SEQ ID NO. 8.

Preferably, when the expression quantity of the genes related to the detoxification metabolism of the pesticide in the rice borer trichogramma is quantitatively detected, the primer sequences of the amplified TMEM209 gene are shown as SEQ ID NO. 26 and SEQ ID NO. 27.

In the present invention, the gene involved in detoxification metabolism of the pesticide is preferably a P450 gene. Further preferably, the P450 gene is CYP4G15, and the gene sequence of CYP4G15 is shown in SEQ ID NO: 11.

Preferably, when the CYP4G15 gene in the trichogramma piniperca is quantitatively detected, the primer sequence for amplifying the CYP4G15 gene is shown as SEQ ID NO:32 and SEQ ID NO: 33.

In another aspect, the present invention provides a method for quantitatively detecting an expression level of a P450 gene after a rice borer trichogramma is stressed by an insecticide, the method comprising: taking TMEM209 gene as an internal reference gene, and detecting the quantitative expression quantity of the P450 gene after the rice borer trichogramma is stressed by the pesticide, wherein the method for quantitatively detecting the expression quantity is real-time fluorescence quantitative PCR.

Preferably, the pesticide is imidacloprid and/or pymetrozine. The stress time of the insecticide is preferably 0.5-4 hours.

Preferably, the gene sequence of the TMEM209 gene is shown as SEQ ID NO. 8.

Preferably, the P450 gene is CYP4G 15. When the invention is used for quantitatively detecting the CYP4G15 gene expression level in the rice borer trichogramma, the primer sequence for amplifying the TMEM209 gene is preferably the sequence shown in SEQ ID NO. 26 and SEQ ID NO. 27. The preferred sequences of the primers for amplifying the CYP4G15 gene are the sequences shown in SEQ ID NO. 32 and SEQ ID NO. 33.

Compared with the prior art, the invention has the following advantages:

the invention provides stable reference gene reference for gene expression profile analysis in the trichogramma walker, and provides reference for screening of real-time fluorescence quantitative PCR reference genes of other species under specific experimental conditions. The method can be established under the stress of different insecticides, and can be used for detecting each gene in the trichogramma paddy borer by using real-time fluorescent quantitative PCR, so that the detection error is reduced, and the detection result is more accurate and reliable.

Drawings

FIG. 1: RefFinder software analyzes the stability of the reference gene expression of the trichogramma graminis under the stress of imidacloprid or pymetrozine, and the smaller the average stability value is, the more stable the stability is.

FIG. 2: and (3) analyzing the relative quantitative expression level of the CYP4G15 gene in the rice borer trichogramma after the imidacloprid or pymetrozine is stressed by using a real-time fluorescent quantitative PCR method by using TMEM209 as an internal reference gene.

Detailed Description

The invention adopts the following method to screen and quantitatively detect the reference gene of the gene expression quantity related to the detoxification metabolism of the pesticide in the rice borer trichogramma. The method can screen out proper reference genes and can be used for researching the expression quantity of related functional genes in the bodies of the rice borers trichogramma under the stress of different insecticides.

The method comprises the following steps: providing an alternative reference gene; taking untreated rice borer trichogramma as a contrast, carrying out stress treatment on the rice borer trichogramma imagoes by adopting different insecticides, collecting rice borer trichogramma samples after treatment, immediately extracting total RNA, determining the concentration of the RNA, carrying out reverse transcription on the RNA to synthesize cDNA, then taking cDNA of each sample as a template, verifying alternative internal reference genes by utilizing real-time fluorescence quantitative PCR, and carrying out data analysis by adopting RefFinder software, thereby screening the internal reference genes which are most stably expressed by the rice borer trichogramma under the condition of insecticide stress.

In the invention, the functional gene related to detoxification and metabolism of the pesticide in the trichogramma walker is preferably a P450 gene, such as CYP4G15, CYP4C1, CYP49A1, CYP18A1, CYP6A1, CYP6A2, CYP9P3 and CYP9E 2. In a preferred embodiment of the present invention, the preferred functional gene is CYP4G15 gene, the nucleotide sequence of which is shown in SEQ ID NO: 11.

In the screening process of the internal reference genes, the alternative internal reference genes are 10 genes as follows:

1. polyadenylate binding protein 1 (PABPC 1), the nucleotide sequence of which is shown in SEQ ID NO: 1;

2. the nucleotide sequence of the cleavage factor (SF) is shown in SEQ ID NO. 2;

3. elongation factor 1 (Elongation factor 1, EF1), the nucleotide sequence of which is shown in SEQ ID NO. 3;

4. casein kinase (Casein kinase 1 alpha, CK1a), the nucleotide sequence of which is shown in SEQ ID NO: 4;

5. an elongation factor 1Delta (Elongation factor 1 Deta, EF1D), the nucleotide sequence of which is shown in SEQ ID NO: 5;

6. glyceraldehyde-3-phosphate dehydrogenase (GAPDH), the nucleotide sequence of which is shown in SEQ ID NO. 6;

7. actin 11(Actin related protein2, ARP2), whose nucleotide sequence is shown in SEQ ID NO. 7;

8. transmembrane protein 209 (TMEM 209), the nucleotide sequence of which is shown in SEQ ID NO: 8;

9. actin 213 (expressed protein 213, ARP213), whose nucleotide sequence is shown in SEQ ID NO. 9;

10. ATP synthetase (ATP synthsase), the nucleotide sequence of which is shown in SEQ ID NO: 10.

The preferred trichogramma of the rice borer selected by the invention is the trichogramma of the rice borer in the same physiological state. In the specific embodiment of the invention, the pink moth larvae bred indoors under the same condition are adopted, and the breeding conditions are as follows: indoor population of rice borer trichogramma in the climatic chamber: temperature 25 ℃, humidity 75%, illumination: dark-14 hours: and (3) expanding propagation by using the rice moth eggs under the condition of 10 hours, and carrying out different pesticide stress treatment by using the primarily emerged adult bees.

The invention has no special limitation on the specific mode of pesticide stress, and can place the rice borer trichogramma in the pesticide environment for pesticide stress. Preferably, the rice borer trichogramma is placed in a pesticide film tube containing pesticide, and pesticide stress treatment is carried out after the pesticide film tube is sealed. The insecticides used in the embodiments of the present invention are imidacloprid and pymetrozine, respectively, and those skilled in the art can select other insecticides in the field, such as organophosphates, pyrethroids or other novel insecticides, according to the purpose of the study. The concentration of the stress on the insecticide is not particularly limited, and the concentration of the stress on the insecticide is conventional in the field according to different types of the insecticides. In the invention, the time for carrying out different pesticide stresses on the aphelesia punctatus is at least 0.5 hour, preferably, the stress time of the pesticide is 0.5 to 4 hours, and more preferably 1 to 2 hours. To ensure the accuracy of the screening assay, the present invention preferably sets at least 3 biological replicates per treatment.

Collecting rice borer trichogramma stressed by different insecticides, extracting total RNA of the rice borer trichogramma, measuring the concentration of the RNA, and synthesizing cDNA through reverse transcription. The present invention is not limited to this step, and the operation may be performed by a conventional method in the art.

And (3) verifying the alternative reference genes by using the cDNA of each sample as a template and utilizing real-time fluorescent quantitative PCR.

The primers corresponding to the 10 candidate reference genes by the real-time fluorescent quantitative PCR method are as follows:

Polyadenylate bindingprotein 1(PABPC1)：

GCGACAACATCACCAGGAGA, reverse: GAAGAGATGGATCGCGCTGA, respectively;

Splicing factor(SF)：

positive: TTATGTTCGGGAGCGTGGAG, reverse: TCAGGTCTGCTTCTCGATCAC, respectively;

Elonggation factor 1(EF1)：

positive: GCCATGGTTCAAGGGATGGA, reverse: ACCGTTCCAATACCGCCAAT, respectively;

Casein kinase 1alpha(CK1a)：

positive: GGCAGACCTTTGGAACTCGT, reverse: ACATGACCTCCACCGTTCAC, respectively;

Elonggation factor 1Deta(EF1D)：

positive: AACTTACGACAGGGCTGAGC, reverse: CAAGAGCTGCAATGCCATCC, respectively;

Glyceraldehyde-3-phosphate dehydrogenase(GAPDH)：

positive: CACCACCATCGAGAAGGCTT, reverse: TGGGTCGTACGAGTCGAGAT, respectively;

Actinrelatedprotein 2(ARP2)：

positive: TCCGCTGACTTTGAAACCGT, reverse: GAGCAGCAAACCTTTCACCG, respectively;

Transmembrane protein 209(TMEM209)：

positive: ACTCACAGCCAGGATCAGTG, reverse: TGGGGCTTCAAGTTGTGTGT, respectively;

Actinrelatedprotein 213(ARP213)：

positive: GACCATCCGCTCTTAGTGCA, reverse: CAGTGGAAGGTTCAGCGTCT, respectively;

ATP synthase：

positive: ACAGACAGCGGTGCCATTAA, respectively; and (3) carrying out the following steps: GAATTCACCCATGGCGCATC are provided.

In the present invention, the primer sequence of the CYP4G15 gene is:

positive: TGGGTCGAAAGTACGCGATG, reverse: CGCGACCAATGTCTCGTTTC are provided.

Preferably, the real-time fluorescent quantitative PCR system and conditions are respectively as follows: reaction system of real-time fluorescence quantitative PCR: the quantitative PCR reaction system is 20 μ L in total, and comprises 1 μ L of cDNA (containing 3 μ g of total RNA), 10 μ L of SYBR fluorescent reagent (iTaqUniversal SYBR Green Supermix), 1 μ L of each forward/reverse primer, and 7 μ L of double distilled water; reaction conditions of real-time fluorescent quantitative PCR: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃. In the present invention, preferably 2 technical repeats are set per sample.

And analyzing the Ct value obtained by real-time fluorescent quantitative PCR by using RefFinder software, and screening to obtain the reference gene with the most stable expression quantity as a suitable reference gene for quantitatively detecting the gene expression quantity related to the detoxification metabolism of the pesticide in the rice borer trichogramma.

refFinder (http:// http:// fulxie.0 genes. us/? type ═ reference & i ═ 1) is a free tool for comprehensive evaluation of the stability of the internal reference genes from a large set of experimental data, which can evaluate and screen the internal reference genes from a large set of experimental data, it can synthesize the results of the four methods bestkeper, GeNorm, Normfender and Δ Ct to rank the candidate internal reference genes finally for stability, wherein the Δ Ct method is simpler, the appropriate internal reference genes are determined by comparing the relative expression of each pair of housekeeping genes in each sample, bestkeper determines the appropriate internal reference genes by the original Ct values and the amplification efficiency (E) of the primers, and ranks them in turn.

The result shows that the expression level of the TMEM209 gene is most stable under the stress of different insecticides of the rice borer trichogramma, so that the TMEM209 gene is used as an internal reference gene for quantitatively detecting the gene expression level related to the detoxification metabolism of the insecticide in the rice borer trichogramma.

The present invention will be described in detail with reference to the following examples and drawings for better understanding of the objects, technical solutions and advantages of the present invention, but they should not be construed as limiting the scope of the present invention. The application of the RefFinder software for analyzing the stability of the internal reference gene is carried out according to the application instructions.

Example 1 screening of reference Gene

First, the breeding of the rice borer trichogramma.

A rice borer trichogramma laboratory population, in a climatic chamber: temperature 25 ℃, humidity 75%, illumination: dark-14 hours: under the condition of 10 hours, the rice moth eggs are used for expanding propagation, and the primarily emerged adult bees are used for carrying out different pesticide stress treatments.

Second, insecticide stress treatment

The preparation method comprises the following steps of respectively preparing a medicinal membrane tube by using water, acetone, imidacloprid and pymetrozine, wherein the preparation process comprises the following steps: adding 1mL of water, acetone, 10ppm of imidacloprid and 25mg/L of pymetrozine into a finger-shaped tube (diameter is 2.5cm, height is 6cm), rapidly rotating the finger-shaped tube to uniformly coat the liquid medicine on the inner wall of the tube, immediately pouring out the redundant liquid medicine, inverting the finger-shaped tube, and naturally drying in the air to obtain the medicinal membrane tube.

Introducing the aphelesia punctatus into a medicine film tube, sealing the opening of the medicine film tube by using a cotton plug, and collecting a sample to extract total RNA after 1 hour of treatment; each treatment set 3 biological replicates.

And thirdly, carrying out real-time fluorescent quantitative PCR analysis on primer design and amplification efficiency of all genes.

1. Primer design

10 candidate reference genes and 1 gene related to the detoxification metabolism of the pesticide were selected as target genes, and specific amplification primers were designed using primer3.0 software (table 1).

RNA extraction Process

200 rice borer trichogramma were placed in a 2.0mL glass homogenizer, 500. mu.L Trizol reagent was added, and homogenization was performed manually for 5min, after which the procedure was completed with reference to the Trizol reagent (Invitrogen, batch No.: 15596026) instructions. RNA quality and concentration detection: taking a1 mu LRNA sample, detecting OD260/280 and concentration by using NanoDrop2000, wherein the OD260/280 value is between 1.8 and 2.2, and taking a qualified sample. First strand cDNA Synthesis: reverse transcription was performed using 3. mu.g of RNA, and the procedure was performed according to the instructions of Thermo Fisher reverse transcription kit (Thermo Fisher, batch No.: K1622).

TABLE 1 primer sequences and amplification efficiencies of the candidate reference gene and the target gene.

3. Amplification of reverse transcribed synthetic cDNA

And (2) taking the cDNA synthesized by reverse transcription as a template, utilizing a designed and synthesized specific primer (table 1) to amplify the alternative reference gene and the target gene by PCR, detecting whether the length of an amplified fragment is consistent with that of the selected target fragment by agarose gel electrophoresis, and then recovering a PCR product and sequencing for verification. The primers designed above can be used for effectively amplifying target fragments, and the target fragments have the same size as the target fragments designed by the people, are single in band and have no specific amplification. PCR amplification System: a20. mu.L reaction system contained 10. mu.L of 2 XPCR buffer Mix, 1. mu.L each of the forward/reverse primers, 1. mu.L of cDNA template, and 7. mu.L of sterile water.

4. Investigation of primer amplification efficiency

The cDNA synthesized by the reverse transcription is diluted into 5 cDNAs with different concentrations according to 5 times of equal ratio and is used as a template, and the designed and synthesized specific primers (table 1) are utilized to carry out fluorescence quantitative PCR amplification on the alternative reference gene and the target gene. The reaction system of the real-time fluorescent quantitative PCR is 20 mu L, and comprises 1 mu L of cDNA (containing 3 mu g of total RNA), 10 mu L of 2 xiTaq SYBR Green fluorescent reagent (2 xiTaq Universal SYBR Green Supermix), 1 mu L of each forward/reverse primer and 7 mu L of double distilled water, wherein the SYBRGreen fluorescent reagent is purchased from Bio-Rad company; reaction conditions are as follows: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃. The amplification efficiency of the primers is given by the software of the real-time fluorescent quantitative PCR instrument, and whether the primers are proper or not is judged according to whether the amplification efficiency E (%) is between 90% and 110% (Table 1). The fluorescent quantitative PCR instrument is CFX96, Bio-Rad.

5. Real-time fluorescent quantitative PCR

The cDNA is used as a template to perform fluorescent quantitative PCR amplification on an alternative reference gene and a target gene (Table 1), and the reaction system and the reaction conditions are referred to [ 4 ] investigation of primer amplification efficiency. The reaction system of the real-time fluorescence quantitative PCR is 20 mu L, and comprises 1 mu L of cDNA (containing 3 mu g of total RNA), 10 mu L of 2 xiTaq fluorescent reagent, 1 mu L of each forward/reverse primer and 7 mu L of double distilled water, wherein SYBR Green fluorescent reagent is purchased from Bio-Rad company; reaction conditions are as follows: 30S at 95 ℃, 10S at 95 ℃ and 30S at 55 ℃ for 40 cycles. Melting curve: fluorescence signals were collected every 0.5 ℃ from 55 ℃ to 95 ℃.

And inputting the Ct value obtained by the real-time fluorescence quantitative PCR into RefFinder software for analysis according to the format requirements of the analysis software. The results of the internal reference gene stability analysis are shown in FIG. 1. As can be seen from fig. 1, the stability of the 10 different candidate genes is: TMEM209> PABPC1> CK1a > ARP213> ATP synthsase > EF1D > SF > EF1> ARP2> GAPDH, with TMEM209 being the most stable.

Traditionally, a single common internal reference gene is generally adopted in the real-time fluorescence quantitative PCR development, and the fact proves that the operation method is not preferable, and any external condition or change of the internal condition influences the stability of the expression of the internal reference gene. In addition, the expression quantity variation difference of the same target gene is analyzed by using different internal reference genes, and some differences can even reach dozens of times, so that the reliability of an experimental result is seriously influenced. Therefore, the screening method of the reference gene of the rice borer trichogramma under different pesticide stresses screens the TMEM209 with the most stable expression level as the reference gene for quantitatively detecting the gene expression level related to the detoxification metabolism of the pesticide in the rice borer trichogramma.

Example 2 application of TMEM209 as reference Gene

1. Stress of pesticides

The method comprises the steps of respectively taking the rice borer trichogramma stressed by imidacloprid and pymetrozine for 1 hour as an experimental sample, taking the water-and-acetone-treated rice borer trichogramma test insect as a control sample, taking TMEM209 as an internal reference gene, and detecting the expression level of the CYP4G15 gene of the rice borer trichogramma by utilizing real-time fluorescent quantitative PCR. Pesticide stress method, reaction system and reaction conditions the pesticide stress method, the operation process, conditions and system of real-time fluorescent quantitative PCR in example 1 were referenced. Each treatment was set up with 2 technical replicates and 3 biological replicates. Data processing uses 2^-△△CtProcessing by the method, processing the sample-delta Ct control sample by the delta-delta Ct, and processing the target gene-delta Ct reference gene by the delta-delta Ct. The significance of the difference between the treatments was statistically analyzed using the DPS software.

The results show that: the treatment of different insecticides has significant influence on the expression level of the CYP4G15 gene of the trichogramma canker; the acetone control treatment and the water control treatment of the pesticide have no obvious difference, and the imidacloprid and the pymetrozine treatment obviously improve the expression quantity of the CYP4G15 gene of the aphelesia punctifera by 56.5 times and 45.7 times respectively.

The invention utilizes real-time fluorescent quantitative PCR to carry out quantitative amplification on 10 alternative internal reference genes and 1 target gene in the rice borer trichogramma under different pesticide stress conditions, and adopts RefFinder software to analyze the stability of the internal reference genes, thereby screening out the most stable internal reference gene TMEM209 in the rice borer trichogramma under different pesticide stress conditions. On the basis, the expression rule of the P450 gene of the rice borer trichogramma under the stress condition of the insecticide imidacloprid or pymetrozine is determined by taking the P450 gene CYP4G15 of the rice borer trichogramma as a target gene and TMEM209 as an internal reference gene. The screened reference gene TMEM209 is suitable for the expression profile analysis of the target gene in the rice borer trichogramma under the stress of imidacloprid or pymetrozine, and provides reference for quantitative PCR experiments of the rice borer trichogramma gene under other pesticide stress conditions.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Zhejiang province academy of agricultural sciences

Application of <120> TMEM209 gene as reference gene in quantitative detection of gene expression level of rice borer trichogramma

<130> GW2017I0813

<160> 33

<170> PatentIn version 3.5

<210> 1

<211> 361

<212> DNA

<213> Artificial sequence

<400> 1

gcgacaacat caccaggaga tcgctcggat atgcctacgt gaattttcaa caaccggctg 60

atgccgaaag agctttggat accatgaact ttgacatgat caaaggcaga cctattagaa 120

taatgtggtc tcagcgcgat ccatctcttc gccgctcagg cgttggaaat gttttcatca 180

ggaacttgga caaaaacatt gataacaagg ccatgtatga tactttctca gcttttggca 240

acattcttag ttgcaaagtt gctcaggatg agaaaggttc ctccaaaggg tacggattcg 300

ttcattttga aaccgaagaa gctgccaaca agtccatcga caaggtcaat ggtatgctgc 360

t 361

<210> 2

<211> 285

<212> DNA

<213> Artificial sequence

<400> 2

atgtttcagc tttgttttat atcagtatgt catcttaaac aagttataac cagacgtttt 60

atcgtgccgt tttcgcttat gttcgggagc gtggagttcc agacctggat ctgcgtggtg 120

tgcggcttct tggggatctg gacttgctta acgtccttgg gcgaccatta cggctacgtg 180

aacggctgcg agataaagat cgtgagtagg aacgcctggc tccagtggct ccacgggccc 240

gtgaacgaga tcgtgagcgt gatcgtgatc gagaagcaga cctga 285

<210> 3

<211> 294

<212> DNA

<213> Artificial sequence

<400> 3

atgggaaagg aaaagatcca tattaacatc gtcgtcattg gacacgtaga ttcaggagcc 60

atggttcaag ggatggaacg ttgagcgcaa agaaggcaaa gctgacggca aatgcctcat 120

cgaagccctc gatgccatcc tcccaccatc caggccaacc gacaaagccc tccgtctccc 180

actccaggac gtctacaaaa ttggcggtat tggaacggta ccagtcggtc gtgtcgaaac 240

tggtgtgttg aaaccaggta tggttgtcac cttcgcccca gctggtttga ccac 294

<210> 4

<211> 453

<212> DNA

<213> Artificial sequence

<400> 4

atgcagcaaa aaaagcagaa gaagcctcag atccaatccg tccaggtgtt cggacgtaaa 60

aaaaccgcca cggctgttgc ctactgcaag agaggatccg gtctccttaa ggtcaatggc 120

agacctttgg aactcgtcga gcccaagatg ctccaataca aactccagga accaatcctg 180

cttcttggca aggacaagtt caaggatgtt gatattcgtg tcagagtgaa cggtggaggt 240

catgttgcac agatctatgc catcaggcaa gcaattgcca aggctgtagt tgccttctat 300

cagaaatttg ttgatgaggc aagcaagaag gaaatcaaag atatccttat tcagtacgat 360

aggactctct tggttgctga tcctagaagg tgcgaaccta agaagtttgg tggtccgggt 420

gctcgtgccc gttaccaaaa atcttaccgt taa 453

<210> 5

<211> 257

<212> DNA

<213> Artificial sequence

<400> 5

atggccgcgg tttcgatgca agaaaaggtt tggtccgaaa aatcaactta cgacagggct 60

gagcgcctgc accacgaaag acttgccaag gaattagata tcacaatgtc tggaagttta 120

gctgctgaag ttgccaaggc acgccaacac atcaagctgt ccttgcaagt tatggatggc 180

attgcagctc ttgctggttt gtctgttgaa aaagaagtcc cagacaaaga agtttctggc 240

agactagttt cattgga 257

<210> 6

<211> 204

<212> DNA

<213> Artificial sequence

<400> 6

accatcgaga aggcttcggc tcatttggaa ggtggtgcca agaaggtcat catctccgct 60

ccatcggccg acgcacccat gtacgtgtgc ggtgtgaatc tcgactcgta cgacccaagc 120

cacaaagtcg tgtccaacgc ctcgtgcacg accaactgct tggctcccct cgccaaggtc 180

atccacgaca acttcgagat cgtc 204

<210> 7

<211> 315

<212> DNA

<213> Artificial sequence

<400> 7

cattccgctg actttgaaac cgtaagaatg atcaaagaaa agctgtgtta tattggttat 60

gatattgaga ccgaagaaaa actagcactc gagactacag ttctagtaga atcctataca 120

ttacctgatg gtagagttat caaagttggc ggtgaaaggt ttgctgctcc tgaagcactt 180

tttcaaccac accttatcaa tgtggaggct cagggtatcg cagaacttgt tttcaataca 240

attcaatctg cagacattga tatgcgtagc gagctttaca aacacattgt tctcagtggt 300

ggtagtacta tgtat 315

<210> 8

<211> 298

<212> DNA

<213> Artificial sequence

<400> 8

tagtgactca cagccaggat cagtgggact agacaaactt agaaaacttg ctcaatcttt 60

ttcggcttca cttatcccta ctctgcctac attggttcca tttttagaat tatgcagcaa 120

tcaagattat ttagttaatc gcataaaaac tcttgcaaaa ggtggatcaa tgagtgaatt 180

taaatggaac tcaggtggat ctcataatgg caaagagtgg gatactagtc ttccaacaga 240

tactgctatt gtaatgcatc tagttgcaac atacatggac acacaacttg aagcccca 298

<210> 9

<211> 261

<212> DNA

<213> Artificial sequence

<400> 9

gaccatccgc tcttagtgca gttgccaata gttctacttc tccgccaaaa agcagtgctg 60

aaacaactaa aataagcaat ccttttgcaa aagttgacaa aaagtcagac gatgaaccag 120

aagataaagc tcaaaaggtg tccaatgaag acaataaaac aggtgaatca gaaaaaccca 180

gtgcagaaga aaaaaacaca gagcagccaa aatttttgcc tttgaataat acgtcaagca 240

aagacgctga accttccact g 261

<210> 10

<211> 278

<212> DNA

<213> Artificial sequence

<400> 10

acagacagcg gtgccattaa ctacaccatc attgtgtcgg ctaccgcctc tgatgccgcc 60

cctctgcagt accttgcccc atactctgga tgcgccatgg gtgaattctt cagagataac 120

ggcaaacacg ccctcatcat ctacgacgat ttgtcgaaac aggccgtagc ctaccgtcaa 180

atgtccctgt tgctgcgaag acccccaggt cgtgaggcct accccggtga tgtcttctac 240

ctccactctc gtctccttga gcgtgccgcc aagatgaa 278

<210> 11

<211> 196

<212> DNA

<213> Artificial sequence

<400> 11

tgggtcgaaa gtacgcgatg ttgaagctga aaatcttact gtcaacggtg ctgagaaatt 60

acaaagtgac ctcggatctg aaggaggaag attacaaact gcaggtcgac attattttga 120

agaggtccga cggattcaga ataaaaatcg agccacgaaa cgagacattg gtcgcgtga 179

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

gcgacaacat caccaggaga 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

gaagagatgg atcgcgctga 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

ttatgttcgg gagcgtggag 20

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

tcaggtctgc ttctcgatca c 21

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

gccatggttc aagggatgga 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

accgttccaa taccgccaat 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

ggcagacctt tggaactcgt 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

acatgacctc caccgttcac 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

aacttacgac agggctgagc 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

caagagctgc aatgccatcc 20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<400> 22

caccaccatc gagaaggctt 20

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence

<400> 23

tgggtcgtac gagtcgagat 20

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<400> 24

tccgctgact ttgaaaccgt 20

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<400> 25

gagcagcaaa cctttcaccg 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence

<400> 26

actcacagcc aggatcagtg 20

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence

<400> 27

tggggcttca agttgtgtgt 20

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<400> 28

gaccatccgc tcttagtgca 20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<400> 29

cagtggaagg ttcagcgtct 20

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence

<400> 30

acagacagcg gtgccattaa 20

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence

<400> 31

gaattcaccc atggcgcatc 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<400> 32

tgggtcgaaa gtacgcgatg 20

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence

<400> 33

cgcgaccaat gtctcgtttc 20

Claims (7)

1. The application of TMEM209 gene as reference gene in quantitative detection of the expression level of pesticide detoxification metabolism related gene in rice borer trichogramma; the nucleotide sequence of the TMEM209 gene is shown as SEQ ID NO. 8; the pesticide is imidacloprid and/or pymetrozine; the stress time of the insecticide is 0.5-4 hours.
2. 2. The use according to claim 1, wherein the quantitative detection method is real-time fluorescent quantitative PCR.
3. 3. The use according to claim 1 or 2, wherein the primer sequence for amplifying the TMEM209 gene is shown as SEQ ID NO. 26 and SEQ ID NO. 27.
4. 4. The use of claim 1, wherein the gene associated with detoxification metabolism of the pesticide is the P450 gene.
5. 5. The use of claim 4, wherein the P450 gene is CYP4G15, and the gene sequence of CYP4G15 is shown in SEQ ID NO. 11.
6. 6. The use of claim 5, wherein the primer sequences for amplifying the CYP4G15 gene are set forth in SEQ ID NO. 32 and SEQ ID NO. 33.
7. 7. A method for quantitatively detecting the expression level of a P450 gene after a rice borer trichogramma is stressed by an insecticide comprises the following steps: taking TMEM209 gene as an internal reference gene, and detecting the quantitative expression quantity of the P450 gene after the rice borer trichogramma is stressed by the pesticide, wherein the method for quantitatively detecting the expression quantity is real-time fluorescence quantitative PCR.