CN106544438A - A kind of application of genetic marker in purpleapricot identification - Google Patents
A kind of application of genetic marker in purpleapricot identification Download PDFInfo
- Publication number
- CN106544438A CN106544438A CN201611079643.5A CN201611079643A CN106544438A CN 106544438 A CN106544438 A CN 106544438A CN 201611079643 A CN201611079643 A CN 201611079643A CN 106544438 A CN106544438 A CN 106544438A
- Authority
- CN
- China
- Prior art keywords
- purpleapricot
- sequence
- electrophoresis
- identification
- fructus pruni
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention belongs to plant genetic labelling preparation and application technical field.Application of specifically related to a kind of genetic marker in purpleapricot identification, the present invention utilizes DNA bar code gene order, set up the characteristic bands of PCR amplification method and the agarose gel electrophoretogram direct detection purpleapricot (P.dasycarpa Ehrh.) using 0.5%, can interpolate that it is purpleapricot if occurring 2 molecular size ranges about 750bp and 720bp fragments on a swimming lane simultaneously, if the fragment of an only 720bp is judged to common cultivation Fructus Pruni.The present invention quickly, accurately can carry out Molecular Identification to purpleapricot and other cultivation Fructus Prunis, this invention simplifies evaluation program, reduces appraisal cost.
Description
Technical field
The invention belongs to plant species molecular identification technical field.Specifically related to a kind of genetic marker is in purpleapricot
Application in (P.dasycarpa Ehrh.) identification, which includes the amplification of DNA bar code gene order PCR and uses 0.5% agarose
Gel electrophoresiss inspection directly carries out the characteristic bands for detecting purpleapricot, quickly, simply, accurately can carry out Molecular Identification to purpleapricot.
The present invention can realize economy, discriminating species quickly and efficiently, effectively identify species, improve nursery stock purity,
Reduce appraisal cost.By expanding ITS sequence PCR, directly carry out studying and judging the size sum of characteristic fragment by electrophoresis pattern
Amount, can interpolate that it is purpleapricot, if occurring 2 molecular size ranges about 750bp and 720bp fragments on a swimming lane simultaneously if only
The fragment of an only 720bp is judged to common cultivation Fructus Pruni.
Background technology
Southern Xinjiang is one of important primary area of origin of China's cultivation Fructus Pruni, has long cultivation history and abundant something lost
Pass multiformity.There are two kinds of purpleapricot (P.dasycarpa Ehrh.) and common Fructus Pruni (P.armeniacavulgaris L.) in Xinjiang,
And purpleapricot (P.dasycarpa Ehrh.) has only been distributed in Xinjiang, its variations under species type is enriched, existing authentication method master
If to relying solely on leaf, fruit shape, fruit color, fruit surface and floral organ official rank morphological index identification purpleapricot, the side of this identification
Method is easily affected by environment and vegetation season, and time-consuming, while early stage rapid screening can't be carried out to purpleapricot.
Fructus Pruni (Asia) the platymiscium resource variation in Xinjiang is abundant, and the classification of various fruit tree plants and different species are reflected
It is fixed, the development and utilization of this research and wild resource beneficial to species genetic diversity, phylogenetic systematicses and genetic improvement.
DNA bar code is the new technique that the application risen in recent years is short, standardized DNA sequence identifies species.From Paul in 2003
Since Hebert proposes this concept, (Hebert et al., 2003), multiple fragments or fragment combination are suggested can be used as plant
The candidate segment of quasi-group classification.Sass etc., 2007, the research to Gymnospermae Cycadales showed, although ITS sequencings are present
Certain difficulty, but with its higher variation feature, remain 7 DNA fragmentations (matK, ndhJ, rpoC1, accD, ycf5,
PsbA-trnH, ITS) in most potential bar code.It is well known that ITS sequence is relatively guarded, the calendar year 2001 such as Lee is just right
Phylogeny of the sequence in cherry studied (Lee et al., 2001).
At present, many molecular marking techniques are applied in the research of the genetic diversity and Idioplasm identification of Fructus Pruni.For example
Yuan etc. utilizes Fluorescent AFLP (Amplified Fragment Length Polymorphism) marker research new for 2007
The genetic diversity of tri- regional 86 part apricot cultivars (being) in boundary Keshen and field and Ku Che；He etc. utilizes SSR in 2007
(simple sequence repeat) labelling is ground to 22 parts of Fructus Pruni germplasm genetic diversities of Kashi and field and Ku Che areas
Study carefully；Liu etc. utilizes ISSR (Inter-Simple Sequence repeats) labeled analysis part South Sinkiang apricot cultivars in 2016
The nineteen nineties such as the genetic diversity of (being), Williams are marked using RAPD (Random Amplified Polymorphic DNA)
Note have studied wild apricot, the sibship of north of China cultivation Fructus Pruni resource and Idioplasm identification.These results show that China is new
The main genetic diversity for planting apricot cultivars (being) of boundary relatively enriches.Recently, such as Zhang etc. studies China's cultivation using SSR marker in 2014
The genetic diversity of training Fructus Pruni, also indicates that the genetic diversity of China's South Sinkiang Fructus Pruni enriches the most；Li etc. 2014 using ISSR and
SRAP (sequence-related amplified polymorphism) marker research northern China cultivates the genetic diversity of Fructus Pruni
Property and sibship, it is found that the genetic diversity of China South Sinkiang Fructus Pruni enriches the most.But these labellings are anonymous marker, so far,
The related molecular marker of identification purpleapricot is not also provided.
Therefore the applicant belongs to material to existing Fructus Pruni carries out ITS sequence amplification, and combines integrated database NCBI
(https://www.ncbi.nlm.nih.gov/genbank), bioinformatic analysis are carried out by sequencing result, institute is found
There is a long sequence (number of logging in KX890450, the about number of logging in KX890452,750bp) and short (to log in having purpleapricot material
Number KX890451, KX890449；720bp) two ITS sequences, that is, find that a long sequence is specific sequence, therefore directly profit
With the effect of the molecular sieve of 0.5% agarose gel electrophoresiies, it is possible to purpleapricot is made a distinction and is identified, effectively save can reflect
Fix time and funds.
The content of the invention
It is an object of the invention to overcome the defect of prior art, there is provided a kind of purpleapricot early stage rapid molecular authentication method,
Technical scheme is mainly characterized by organically combining DNA bar code gene order PCR amplification technique and species identification, from
And Molecular Identification can be carried out to purpleapricot quickly, simply, accurately.This method is after to the amplification of ITS sequence PCR, directly sharp
Detected with the inspection of 0.5% agarose gel electrophoresiies, by judge purpleapricot characteristic bands size with whether there is identifying species, if
Simultaneously there are 2 molecular size ranges about 750bp and 720bp fragments just to can interpolate that as purpleapricot on one swimming lane, if only one
The fragment of bar 720bp is judged to common cultivation Fructus Pruni.
The present invention can realize economy, discriminating species quickly and efficiently, effectively identify purpleapricot, improve nursery stock purity,
Reduce appraisal cost.This method reduces appraisal cost than direct Sequencing or cloning and sequencing method, has saved the time.
Technical scheme is as described below：
A kind of method for identifying molecules of purpleapricot (P.dasycarpa Ehrh.), described method comprise the following steps：
(1) genomic DNA is extracted from Fructus Pruni material to be measured；
(2) with the number of logging in be the KX890450 and number of logging in KX890452 and the number of logging in be KX890451 and KX890449 two
ITS sequence is template design primer, enters performing PCR amplification：
The sequence of described primer is as described below：
ITS-5 5 '-GGAAGTAAAAGTCGTAACAAGG-3 ',
ITS-4 5’-TCCTCCGCTTATTGATATGC-3’；
(2) reaction system is as follows：
Contain 1 × Buffer, 1.5mmol/L Mg in 50 μ L systems2+, 0.20mmol/L dNTPs, primer I TS-5 and
The each 0.20mmol/L of ITS-4, Taq archaeal dna polymerase 1U, 0.1mg/mL BSA, 4%DMSO, 30-50ng template DNA；
(3) amplification program is as follows
96 DEG C of denaturations 5min, 96 DEG C of degeneration 30s, 50 DEG C of annealing 45s, 72 DEG C extend to 1min, circulate 30 times, and last 72
DEG C extend to 7min；
(4) PCR primer of gained is detected with 0.5% sepharose electrophoresis；Its step is as follows：
1) treat that gel solidifies completely, carefully take out comb；
2) electrophoresis Sample is sequentially added in loading wells；
3) glue plate is put in electrophoresis tank (electrophoretic buffer flooded gel about 1mm and is advisable), opens electrophresis apparatuses, make nucleic acid
From negative pole to positive pole swimming, electrophoresis time is 35min to sample；
4) cut off the electricity supply after the completion of electrophoresis, take out gel, in being put into gel imaging system, observe electrophoresis result, and note of taking a picture
Record.Race adhesive tape is studied and judged, if the fragment for occurring 2 molecular size range about 750bp and 720bp on a swimming lane is true simultaneously
It is set to purpleapricot, if the fragment of an only 720bp is judged to common cultivation Fructus Pruni.
A kind of molecular marker suitable for purpleapricot Molecular Identification is applicant provided, the nucleotide sequence of the molecular marker is such as
SEQ ID NO：2 and SEQ ID NO：Shown in 3.(number of logging in of this molecular marker for KX890450 with the number of logging in is
KX890452)。
Compared with prior art, the present invention has advantages below：
(1) the invention provides a kind of particularity of utilization purpleapricot ITS sequence, with existing identification purpleapricot (P.dasycarpa
Ehrh. morphologic observation method) is compared, and is not required to sequencing, it is not necessary to by identifying period (florescence, fruiting period, fructescence
Restriction), it is thus more directly perceived quick..
(2) present invention utilizes agarose gel electrophoresiies direct detection, simple and clear, contracts than direct Sequencing or cloning and sequencing
Short time, reduce appraisal cost.
(3) Molecular Identification is carried out using core bar code ITS sequence fragment, it is more more feasible and can than with Morphological Identification
Letter.
More detailed technical scheme and invention effect referring to《Specific implementation process》.
Description of the drawings
Sequence table SEQ ID NO：1 is a short ITS sequence of the following material ' purpleapricot ' of purpleapricot taxonomy kind.
Sequence table SEQ ID NO：2 is a long ITS sequence of the following material ' purpleapricot ' of purpleapricot taxonomy kind, the sequence
There is the sequence insertion of one section of 22bp.
Sequence table SEQ ID NO：3 is a long ITS sequence of the following kind of purpleapricot taxonomy kind " Ali's vara ", should
Sequence has the sequence insertion of one section of 22bp.
Sequence table SEQ ID NO：4 is a short ITS sequence of the following kind of purpleapricot taxonomy kind " Ali's vara ".
Sequence table SEQ ID NO：5 is the ITS sequence of the kind " steamed bread jade Lv Ke " of below the taxonomy kind of common Fructus Pruni.
Sequence table SEQ ID NO：6 is the ITS sequence of the kind " Ku Chetuo is gathered around " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：7 is the ITS sequence of the kind " buy and carry in storehouse " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：8 is the ITS sequence of the kind " special gram of Shache county flood " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：9 is the ITS sequence of the kind " spy carries storehouse " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：10 is the ITS sequence of the kind " Guo Xi jade Lv Ke " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：11 is the ITS sequence of the kind " golden mother " of below common Fructus Pruni taxonomy kind.
Sequence table SEQ ID NO：12 is the ITS sequence of the kind " egg Fructus Pruni " of below common Fructus Pruni taxonomy kind.
After above-mentioned material amplification, find only have an ITS sequence in common Fructus Pruni after sequencing and comparison, from NCBI
Data base (https://www.ncbi.nlm.nih.gov/genbank) in combine the ITS sequence that bigger monoid Fructus Pruni belongs to material
Bioinformatic analysis, obtain only purpleapricot and there are 2 sequences, sequencing result is consistent with internet retrieval result.Therefore, profit
With the above results, the species that can effectively carry out purpleapricot are identified.
Fig. 1：It is the techniqueflow chart of the present invention.
Fig. 2：The electrophoretogram of expert evidence is carried out using the present invention.Description of reference numerals：In Fig. 2,1 and 2 swimming lanes are purpleapricot
Material under two kinds, be respectively：" spy carries storehouse for " Ali's vara ", " purpleapricot " and other 8 parts common Fructus Prunis, " Ku Chetuo is gathered around "
All ", " Guo Xi jade Lv Ke ", " steamed bread jade Lv Ke ", " special gram of Shache county flood ", " wheat carries in storehouse ", " golden mother " and " egg Fructus Pruni ".
Fig. 3：The Fructus Pruni of all sequences of purpleapricot and bigger monoid belongs to the Multiple Sequence Alignment figure of material.Description of reference numerals：By
In the material that the Fructus Pruni (Asia) announced now belongs to, only purpleapricot is most special, and it not only only has two sequences for this explanation,
Simultaneously two long sequences all have an insertion short-movie section of 22bp, and other Fructus Prunis belong to material with such insertion, only
It is the snp variant sites of a limited number of, therefore material can also be belonged to other kinds of Fructus Pruni (Asia) by this characteristic sequence
Make a distinction and identify.
Fig. 4：It is the purpleapricot (P.dasycarpa Ehrh.) based on ITS sequence and the Fructus Pruni of bigger monoid of present invention structure
The systematic evolution tree of (Asia) platymiscium.
By this systematic evolution tree, find to guard very much in the ITS sequence of Fructus Pruni (Asia) platymiscium, ITS sequence can not
Other Fructus Pruni platymisciums are effectively identified, and only purpleapricot has very big difference, this is not only the phylogeny of Fructus Pruni (Asia) platymiscium
There is provided reference, and a distinctive sequence as identify the category provide effective clue.
Specific embodiment
Embodiment 1
1. the collection of expert evidence
The present embodiment belongs to the collection of material to apricot in Xinjiang (Asia) and ncbi database material is collected and is shown in Table 1.
By on-the-spot investigation, applicant collects what Fructus Pruni (Asia) belonged in Xinjiang Agricultural Sciences institute Luntai Fruit Tree Resources garden
All vegetable materials, after blade is dried with silica gel rapidly, take back laboratory.
From NCBI (https://www.ncbi.nlm.nih.gov/genbank) ITS of Fructus Pruni platymiscium is collected in data base
Sequence, by bioinformatic analysis, it is found that the ITS sequence of Fructus Pruni platymiscium is guarded very much, determines general drawing according to these sequences
Thing sequence, synthetic primer.Therefore, to selecting the vegetable material with typical representative to be expanded and surveyed in the material of collection
Sequence.
2. genomic DNA (modified CTAB method) being extracted from Fructus Pruni material to be measured, primer feature, sieve are analyzed from sequence information
Select primer
(1) petiole of Folium Pruni is removed, 20mg blades are weighed, 0.001 gram of PVP-40T is added, liquid nitrogen is added, blade is ground
Fine powdered is worn into, fine powder is added in the centrifuge tube of 2.0mL；
(2) the buffering lixiviating solution of 1mL pre-coolings is added, ice bath 15 minutes after mixing overturn during ice bath and mix 2-3 time；
(3) 10min is centrifuged under 7 000g, abandons supernatant；
(4) repeat step (2) and (3), until supernatant is not sticky；
(5) often pipe is rapidly added the CTAB Buffer that 0.8mL is preheated to boiling, mixes, 65 DEG C of water-bath 0.5-1h, interval
15min shakes up once；
(6) 0.01mL 100mg/L RNase, 37 DEG C of 30-60min of water-bath are added；
(7) room temperature is cooled to after taking out, it is 25 that often pipe adds the volume ratio of 0.8mL:24:1 phenol：Chloroform：Isoamyl alcohol,
4 DEG C of preservations, gently overturn and fully mix 15 minutes, 10 000g centrifugations 10min under room temperature；
(8) suct and be placed in new 2.0mL centrifuge tubes clearly, add the chloroform of 0.7mL：Isoamyl alcohol is 24 by volume：1
Chloroform isoamyl alcohol solution, overturn mix 15 minutes, 10 000g centrifugation 10min, be placed in another 1.5mL centrifuge tubes；
(9) isopropanol of 0.5mL-20 DEG C of pre-cooling is added, -20 DEG C are disposed vertically 30min after gently mixing；
(10) 10min is centrifuged in 10 000g, abandons supernatant, then it is of short duration remaining liq is collected by centrifugation, absorbed with liquid-transfering gun remaining
Liquid；
(11) ethanol solution of 75% concentration of 0.5mL, precipitation of gently upspringing is added 2min to be centrifuged in 10 000 × g, abandons
Supernatant；
(12) repeat step (11)；
(13) ethanol is air-dried, adds 0.1mL TE dissolving DNAs；
(14) concentration and purity of DNA are determined, DNA sample is obtained.
The sequence information that its sequences relevant information and NCBI of Fructus Pruni (Asia) the category material that the amplification sequencing of table 1 is obtained is downloaded
3., with ITS genes as template design primer, performing PCR amplification is entered：
The DNA sequence of described primer is as follows：
ITS-5 5 '-GGAAGTAAAAGTCGTAACAAGG-3 ',
ITS-4 5’-TCCTCCGCTTATTGATATGC-3’；
4. reaction system is as follows：
Contain 1 × Buffer, 1.5mmol/L Mg in 50 μ L systems2+, 0.20mmol/L dNTPs, primer I TS-5 and
The each 0.20mmol/L of ITS-4, Taq archaeal dna polymerase 1U, 0.1mg/mL BSA, 4%DMSO, 30-50ng template DNA；
(3) amplification program is as follows
96 DEG C of denaturations 5min, 96 DEG C of degeneration 30s, 50 DEG C of annealing 45s, 72 DEG C extend to 1min, circulate 30 times, and last 72
DEG C extend to 7min；
5. with 0.5% sepharose electrophoresis, the PCR primer of pair gained detects that step is as follows：
Treat that gel solidifies completely, carefully take out comb.
Electrophoresis Sample is sequentially added in loading wells.
Glue plate is put in electrophoresis tank (electrophoretic buffer flooded gel about 1mm and is advisable), electrophresis apparatuses is opened, is made nucleic acid
Sample is from negative pole to positive pole swimming, electrophoresis time 35min.
Cut off the electricity supply after the completion of electrophoresis, take out gel, in being put into gel imaging system, observe electrophoresis result, and note of taking a picture
Record.
6. pair electrophoresis runs adhesive tape band and studies and judges, if occur on a swimming lane simultaneously 2 molecular size range about 750bp and
720bp fragments are defined as purpleapricot, if the fragment of an only 720bp is judged to as other kinds of Fructus Pruni.
SEQUENCE LISTING
<110>Tarim University
<120>A kind of application of genetic marker in purpleapricot identification
<130>
<141> 2016-11-19
<160> 12
<170> PatentIn version 3.1
<210> 1
<211> 723
<212> DNA
<213> Prunus dasycarpa Ehrh.Zixing.1
<220>
<221> gene
<222> (1)..(723)
<223>
<400> 1
ttcctccgct tattgatatg cttaaattca gcgggtaacc ccgcctgacc tggggtcgcg 60
ttgaaagccg aaacagagcc cggcaatttt ttcgagccct cgatgcgcga cgaccgcaca 120
cgacgggcaa ccgaggtttc gcaaccaccg attgtcgtgg cgtgcgtcgc cgaggacttg 180
gcatttatgc caaccgcacg acgaggcgca cgggaggcca tcatccgccc cccgcaatcc 240
cgaaggagta gatggggggg caacgacgtg tgacgcccag gcaggcgtgc cctcggccta 300
atggcttcgg gcgcaacttg cgttcaaaga ctcgatggtt cacgggattc tgcaattcac 360
accaagtatc gcatttcgct acgttcttca tcgatgcgag agccgagata tccgttgccg 420
agagtcgttt tgacatattt gaagatgacg acgccgccat cgcacaccgt ttccggggcg 480
acggggacgc gctctctcgt tcaagttcct tggcgcaatt cgcgccggtg ttcgtttgta 540
cgcccggaag ggtatgaacc cccccgagat aaagggacga ggagcacgcc gagacggccc 600
ctcgtccccc gctttgaaac tagttctcgg gtcgttctgc taggcaggtt tcgacaatga 660
tccttccgca ggttcaccta cggaaacctt gttacgactt ctccttcctc taaatgataa 720
gga 723
<210> 2
<211> 742
<212> DNA
<213> Prunus dasycarpa Ehrh.Zixing.2 .
<220>
<221> gene
<222> (1)..(742)
<223>
<400> 2
ttcctccgct tattgatatg cttaaattca gcgggtaacc ccgcctgacc tggggtcgcg 60
ttgaaagccg agccggagcc cggcaatttt ttcgagccct cgatgcgcga cgaccgcaca 120
cgacgggcaa ccgaggtttc gcaaccaccg attgtcgtgg cgtgcgtcgc cgaggacttg 180
gcatttatgc caaccgcgcg acgaggcgca cgggaggcca tcatccgccc cccgcaatcc 240
cgaaggagta gatggggggg caacgacgtg tgacgcccag gcaggcgtgc cctcggccta 300
atggcttcgg gcgcaacttg cgttcaaaga ctcgatggtt cacgggattc tgcaattcac 360
accaagtatc gcatttcgct acgttcttca tcgatgcgag agccgagata tccgttgccg 420
agagtcgttt tgacatattt gaagatgacg acgccgcccg cgcacaccgt ttccggggcg 480
acggggacgc gctctctcgt tcaagttcct tggcgcaatt cgcgccggtg ttcgtttgta 540
cgcccggaag gggccggctg cgcgagcgca acgcaacccc cccgagataa agggacgagg 600
agcacgccga gacggcccct cgtcccccgc tttgaaacta gttctcgggt cgttctgcta 660
ggcaggtttc gacaatgatc cttccgcagg ttcacctacg gaaaccttgt tacgacttct 720
ccttcctcta aatgataagg aa 742
<210> 3
<211> 741
<212> DNA
<213> Prunus dasycarpa Ehrh.Aliwala. 2
<220>
<221> gene
<222> (1)..(741)
<223>
<400> 3
ttcctccgct tattgatatg cttaaattca gcgggtaacc ccgcctgacc tggggtcgcg 60
ttgaaagccg agccggagcc cggcaatttt ttcgagccct cgatgcgcga cgaccgcaca 120
cgacgggcaa ccgaggtttc gcaaccaccg attgtcgtgg cgtgcgtcgc cgaggacttg 180
gcatttatgc caaccgcgcg acgaggcgca cgggaggcca tcatccgccc cccgcaatcc 240
cgaaggagta gatggggggg caacgacgtg tgacgcccag gcaggcgtgc cctcggccta 300
atggcttcgg gcgcaacttg cgttcaaaga ctcgatggtt cacgggattc tgcaattcac 360
accaagtatc gcatttcgct acgttcttca tcgatgcgag agccgagata tccgttgccg 420
agagtcgttt tgacatattt gaagatgacg acgccgcccg cgcacaccgt ttccggggcg 480
acggggacgc gctctctcgt tcaagttcct tggcgcaatt cgcgccggtg ttcgtttgta 540
cgcccggaag gggccggctg cgcgagcgca acgcaacccc cccgagataa agggacgagg 600
agcacgccga gacggcccct cgtcccccgc tttgaaacta gttctcgggt cgttctgcta 660
ggcaggtttc gacaatgatc cttccgcagg ttcacctacg gaaaccttgt tacgacttct 720
ccttcctcta aatgataagg a 741
<210> 4
<211> 723
<212> DNA
<213> Prunus dasycarpa Ehrh.Aliwala.1
<220>
<221> gene
<222> (1)..(723)
<223>
<400> 4
ttcctccgct tattgatatg cttaaattca gcgggtaacc ccgcctgacc tggggtcgcg 60
ttgaaagccg agccggagcc cggcaatttt ttcgagccct cgatgcgcga cgaccgcaca 120
cgacgggcaa ccgaggtttc gcaaccaccg attgtcgtgg cgtgcgtcgc cgaggacttg 180
gcatttatgc caaccgcgcg acgaggcgca cgggaggcca tcatccgccc cccgcaatcc 240
cgaaggagta gatggggggg caacgacgtg tgacgcccag gcaggcgtgc cctcggccta 300
atggcttcgg gcgcaacttg cgttcaaaga ctcgatggtt cacgggattc tgcaattcac 360
accaagtatc gcatttcgct acgttcttca tcgatgcgag agccgagata tccgttgccg 420
agagtcgttt tgacatattt gaagatgacg acgccgcccg cgcacaccgt ttccggggcg 480
acggggacgc gctctctcgt tcaagttcct tggcgcaatt cgcgccggtg ttcgtttgta 540
cgcccggaag ggtatgaacc cccccgagat aaagggacga ggagcacgcc gagacggccc 600
ctcgtccccc gctttgaaac tagttctcgg gtcgttctgc taggcaggtt tcgacaatga 660
tccttccgca ggttcaccta cggaaacctt gttacgactt ctccttcctc taaatgataa 720
gga 723
<210> 5
<211> 646
<212> DNA
<213> Prunus armeniaca Mantouyuluke
<220>
<221> gene
<222> (1)..(646)
<223>
<400> 5
cgggtaccgc ctgactgggg tcgcgttgaa gccgagccgg agcccggcaa ttttttcgag 60
ccctcgatgc gcgacgaccg cacacgacgg gcaaccgagg tttcgcaacc accgattgtc 120
gtggcgtgcg tcgccgagga cttggcattt atgccaaccg cgcgacgagg cgcacgggag 180
gccatcatcc gccccccgca atcccgaagg agtagatggg ggggcaacga cgtgtgacgc 240
ccaggcaggc gtgccctcgg cctaatggct tcgggcgcaa cttgcgttca aagactcgat 300
ggttcacggg attctgcaat tcacaccaag tatcgcattt cgctacgttc ttcatcgatg 360
cgagagccga gatatccgtt gccgagagtc gttttgacat atttgaagat gacgacgccg 420
cccgcgcaca ccgtttccgg ggcgacgggg acgcgctctc tcgttcaagt tccttggcgc 480
aattcgcgcc ggtgttcgtt tgtacgcccg gaagggtatg aacccccccg ggataaaggg 540
acgaggagca cgccgagacg gcccctcgtc ccccgctttg aaactagttc tcgggtcgtt 600
ctgctaggca ggtttcgaca atgatcctcc gcaggtcact acgcag 646
<210> 6
<211> 646
<212> DNA
<213> Prunus armeniaca Kuchetuoyong
<220>
<221> gene
<222> (1)..(646)
<223>
<400> 6
gctgactggg gtcgcgttga agccgagccg gagcccggca attttttcga gccctcgatg 60
cgcgacgacc gcacacgacg ggcaaccgag gtttcgcaac caccgattgt cgtggcgtgc 120
gtcgccgagg acttggcatt tatgccaacc gcgcgacgag gcgcacggga ggccatcatc 180
cgccccccgc aatcccgaag gagtagatgg gggggcaacg acgtgtgacg cccaggcagg 240
cgtgccctcg gcctaatggc ttcgggcgca acttgcgttc aaagactcga tggttcacgg 300
gattctgcaa ttcacaccaa gtatcgcatt tcgctacgtt cttcatcgat gcgagagccg 360
agatatccgt tgccgagagt cgttttgaca tatttgaaga tgacgacgcc gcccgcgcac 420
accgtttccg gggcgacggg gacgcgctct ctcgttcaag ttccttggcg caattcgcgc 480
cggtgttcgt ttgtacgccc ggaagggtat gaaccccccc gagataaagg gacgaggagc 540
acgccgagac ggcccctcgt cccccgcttt gaaactagtt ctcgggtcgt tctgctaggc 600
aggtttcgac aatgatcctc cgcaggtcac tacgaatcag aaacgg 646
<210> 7
<211> 637
<212> DNA
<213> Prunus armeniaca Kumaiti
<220>
<221> gene
<222> (1)..(637)
<223>
<400> 7
acccgctgac tggggtcgcg ttgaagccga gccggagccc ggcaattttt tcgagccctc 60
gatgcgcgac gaccgcacac gacgggcaac cgaggtttcg caaccaccga ttgtcgtggc 120
gtgcgtcgcc gaggacttgg catttatgcc aaccgcgcga cgaggcgcac gggaggccat 180
catccgcccc ccgcaatccc gaaggagtag atgggggggc aacgacgtgt gacgcccagg 240
caggcgtgcc ctcggcctaa tggcttcggg cgcaacttgc gttcaaagac tcgatggttc 300
acgggattct gcaattcaca ccaagtatcg catttcgcta cgttcttcat cgatgcgaga 360
gccgagatat ccgttgccga gagtcgtttt gacatatttg aagatgacga cgccgcccgc 420
gcacaccgtt tccggggcga cggggacgcg ctctctcgtt caagttcctt ggcgcaattc 480
gcgccggtgt tcgtttgtac gcccggaagg gtatgaaccc ccccgggata aagggacgag 540
gagcacgccg agacggcccc tcgtcccccg ctttgaaact agttctcggg tcgttctgct 600
aggcaggttt cgacaatgat cctccgcagg tcactac 637
<210> 8
<211> 713
<212> DNA
<213> Prunus armeniaca Kumaiti
<220>
<221> gene
<222> (1)..(713)
<223>
<400> 8
ttttgatatg cttaaattca gcgggtaacc ccgcctgacc tggggtcgcg ttgaagccga 60
gccggagccc gacaattttt tcgagccctc gatgcgcgac gaccgcacac gacgggcaac 120
cgaggtttcg caaccaccga ttgtcgtggc gtgcgtcgcc gaggacttgg catttatgcc 180
aaccgcgcga cgaggcgcac gggaggccat catccgcccc ccgcaatccc gaaggagtag 240
atgggggggc aacgacgtgt gacgcccagg caggcgtgcc ctcggcctaa tggcttcggg 300
cgcaacttgc gttcaaagac tcgatggttc acgggattct gcaattcaca ccaagtatcg 360
catttcgcta cgttcttcat cgatgcgaga gccgagatat ccgttgccga gagtcgtttt 420
gacatatttg aagatgacga cgccgcccgc gcacaccgtt tccggggcra cggggacgcg 480
ctctctcgtt caagttcctt ggcgcaattc gcgccggtgt tcgtttgtac gcccggaagg 540
gtatgaaccc ccccgggata aagggacgag gagcacgccg agacggcccc tcgtcccccg 600
ctttgaaact agttctcggg tcgttctgct aggcaggttt cgacaatgat ccttccgcag 660
gttcacctac ggaaaccttg ttacgacttc tccttcctct aaattgataa gga 713
<210> 9
<211> 646
<212> DNA
<213> Prunus armeniaca Tehutikudu
<220>
<221> gene
<222> (1)..(646)
<223>
<400> 9
tcgggtaccg cctgactggg gtcgcgttga agccgagcag gagcccggca attttttcga 60
gccctcgatg cgcgacgacc gcacacgacg ggcaaccgag gtttcgcaac caccgattgt 120
cgtggcgtgc gtcgccgagg acttggcatt tatgccaacc gcgcgacgag gcgcacggga 180
ggccatcatc cgccccccgc aatcccgaag gagtagatgg gggggcaacg acgtgtgacg 240
cccaggcagg cgtgccctcg gcctaatggc ttcgggcgca acttgcgttc aaagactcga 300
tggttcacgg gattctgcaa ttcacaccaa gtatcgcatt tcgctacgtt cttcatcgat 360
gcgagagccg agatatccgt tgccgagagt cgttttgaca tatttgaaga tgacgacgcc 420
gcccgcgcac accgtttccg gggcgacggg gacgcgctct ctcgttcaag ttccttggcg 480
caattcgcgc cggtgttcgt ttgtacgccc ggaagggtat gaaccccccc gagataaagg 540
gacgaggagc acgccgagac ggcccctcgt cccccgcttt gaaactagtt ctcgggtcgt 600
tctgctaggc aggtttcgac aatgatcctc cgcaggtcac tacgaa 646
<210> 10
<211> 645
<212> DNA
<213> Prunus armeniaca Guoxiyuluke
<220>
<221> gene
<222> (1)..(645)
<223>
<400> 10
gcctgactgg ggtcgcgttg aagccgagcc ggagcccgac aattttttcg agccctcgat 60
gcgcgacgac cgcacacgac gggcaaccga ggtttcgcaa ccaccgattg tcgtggcgtg 120
cgtcgccgag gacttggcat ttatgccaac cgcgcgacga ggcgcacggg aggccatcat 180
ccgccccccg caatcccgaa ggagtagatg ggggggcaac gacgtgtgac gcccaggcag 240
gcgtgccctc ggcctaatgg cttcgggcgc aacttgcgtt caaagactcg atggttcacg 300
ggattctgca attcacacca agtatcgcat ttcgctacgt tcttcatcga tgcgagagcc 360
gagatatccg ttgccgagag tcgttttgac atatttgaag atgacgacgc cgcccgcgca 420
caccgtttcc ggggcaacgg ggacgcgctc tctcgttcaa gttccttggc gcaattcgcg 480
ccggtgttcg tttgtacgcc cggaagggta tgaacccccc cgggataaag ggacgaggag 540
cacgccgaga cggcccctcg tcccccgctt tgaaactagt tctcgggtcg ttctgctagg 600
caggtttcga caatgatcct ccgcaggtca ctacgatcga aacgt 645
<210> 11
<211> 668
<212> DNA
<213> Prunus armeniaca Jingmama
<220>
<221> gene
<222> (1)..(668)
<223>
<400> 11
ttagatatgc ttaaattcag cgggtaaccc cgcctgacct ggggtcgcgt tgaaagccga 60
gccggagccc ggcaattttt tcgagccctc gatgcgcgac gaccgcacac gacgggcaac 120
cgaggtttcg caaccaccga ttgtcgtggc gtgcgtcgcc gaggacttgg catttatgcc 180
aaccgcgcga cgaggcgcac gggaggccat catccgcccc ccgcaatccc gaaggagtag 240
atgggggggc aacgacgtgt gacgcccagg caggcgtgcc ctcggcctaa tggcttcggg 300
cgcaacttgc gttcaaagac tcgatggttc acgggattct gcaattcaca ccaagtatcg 360
catttcgcta cgttcttcat cgatgcgaga gccgagatat ccgttgccga gagtcgtttt 420
gacatatttg aagatgacga cgccgcccgc gcacaccgtt tccggggcga cggggacgcg 480
ctctctcgtt caagttcctt ggcgcaattc gcgccggtgt tcgtttgtac gcccggaagg 540
gtatgaaccc ccccgggata aagggacgag gagcacgccg agacggcccc tcgtcccccg 600
ctttgaaact agttctcggg tcgttctgct aggcaggttt cgacaatgat cctccgcagg 660
tcactacg 668
<210> 12
<211> 671
<212> DNA
<213> Prunus armeniaca Jidanxing
<220>
<221> gene
<222> (1)..(671)
<223>
<400> 12
ttttagatat gcttaaattc agcgggtaac cccgcctgac ctggggtcgc gttgaaagcc 60
gagccggagc ccggcaattt tttcgagccc tcgatgcgcg acgaccgcac acgacgggca 120
accgaggttt cgcaaccacc gattgtcgtg gcgtgcgtcg ccgaggactt ggcatttatg 180
ccaaccgcgc gacgaggcgc acgggaggcc atcatccgcc ccccgcaatc ccgaaggagt 240
agatgggggg gcaacgacgt gtgacgccca ggcaggcgtg ccctcggcct aatggcttcg 300
ggcgcaactt gcgttcaaag actcgatggt tcacgggatt ctgcaattca caccaagtat 360
cgcatttcgc tacgttcttc atcgatgcga gagccgagat atccgttgcc gagagtcgtt 420
ttgacatatt tgaagatgac gacgccgccc gcgcacaccg tttccggggc gacggggacg 480
cgctctctcg ttcaagttcc ttggcgcaat tcgcgccggt gttcgtttgt acgcccggaa 540
gggtatgaac ccccccggga taaagggacg aggagcacgc cgagacggcc cctcgtcccc 600
cgctttgaaa ctagttctcg ggtcgttctg ctaggcaggt ttcgacaatg atcctccgca 660
ggtcactacc g 671
Claims (1)
1. such as SEQ ID NO：2 and SEQ ID NO:Application of the genetic marker of sequence shown in 3 in purpleapricot identification, its feature exist
In described application comprises the following steps
(1) belong to from Fructus Pruni to be measured and extract in material genomic DNA；
(2) with the number of logging in be the KX890450 and number of logging in KX890452 and the number of logging in be KX890451 and two ITS of KX890449
Sequence enters performing PCR amplification as template design primer：
The sequence of the primer is as described below：
ITS-5：GGAAGTAAAAGTCGTAACAAGG-3,
ITS-4：TCCTCCGCTTATTGATATGC；
(3) carry out according to following reaction system：
Contain 1 × Buffer, 1.5mmol/L Mg in 50 μ L systems2+, 0.20mmol/L dNTPs, each 0.20mmol/ of primer
L, Taq archaeal dna polymerase 1U, 0.1mg/mL BSA, 4%DMSO, 30-50ng template DNA；
(4) expand according to following program：
96 DEG C of denaturations 5min, 96 DEG C of degeneration 30s, 50 DEG C of annealing 45s, 72 DEG C of extension 1min, circulate 30 times, last 72 DEG C of extensions
To 7min；
(5) PCR primer of gained is detected with 0.5% sepharose electrophoresis, is carried out in accordance with the following steps：
Treat that gel solidifies completely, carefully take out comb；
Electrophoresis Sample is sequentially added in loading wells；
Glue plate is put in electrophoresis tank, makes electrophoretic buffer flood gel 1mm, open electrophresis apparatuses, nucleic acid samples are made by bearing
To positive pole swimming, electrophoresis time is 35min for pole；
Cut off the electricity supply after the completion of electrophoresis, take out gel, in being put into gel imaging system, observe electrophoresis result, and film recording；
Race adhesive tape is studied and judged, if occur 2 molecular size ranges on a swimming lane reflect for 750bp and 720bp fragments simultaneously
It is set to purpleapricot, if only the segment identification of a 720bp is other kinds of Fructus Pruni.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611079643.5A CN106544438A (en) | 2016-11-29 | 2016-11-29 | A kind of application of genetic marker in purpleapricot identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611079643.5A CN106544438A (en) | 2016-11-29 | 2016-11-29 | A kind of application of genetic marker in purpleapricot identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106544438A true CN106544438A (en) | 2017-03-29 |
Family
ID=58396700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611079643.5A Pending CN106544438A (en) | 2016-11-29 | 2016-11-29 | A kind of application of genetic marker in purpleapricot identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544438A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129476A (en) * | 2019-05-10 | 2019-08-16 | 国家林业和草原局泡桐研究开发中心 | A kind of Early Identification primer, screening technique and the discrimination method at florescence Siberia apricot morning and evening |
| CN111826462A (en) * | 2020-08-21 | 2020-10-27 | 国家林业和草原局泡桐研究开发中心 | Marker related to early and late flowering period of Siberian apricot and detection primer, method and application thereof |
| CN110592265B (en) * | 2019-10-29 | 2023-11-24 | 江西省农业科学院蔬菜花卉研究所 | DNA bar code and method for rapid identification of solanum plants |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110135834A (en) * | 2010-06-11 | 2011-12-19 | 주식회사 향토유전자원연구소 | A method of classifying maesil by inter-simple sequence repeat analysis and its primers |
| CN105603106A (en) * | 2016-03-21 | 2016-05-25 | 中国中医科学院中药研究所 | PCR (polymerase chain reaction) method and kit for identifying peach kernel and bitter almond on basis of ITS sequence site |
| CN105671185A (en) * | 2016-03-29 | 2016-06-15 | 浙江省嘉兴市农业科学研究院（所） | Application of ITS (internal transcribed spacer) sequence as DNA barcode in identifying Jiaxing Zuili (Prunus salicina lindl.) and identifying method |
-
2016
- 2016-11-29 CN CN201611079643.5A patent/CN106544438A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110135834A (en) * | 2010-06-11 | 2011-12-19 | 주식회사 향토유전자원연구소 | A method of classifying maesil by inter-simple sequence repeat analysis and its primers |
| CN105603106A (en) * | 2016-03-21 | 2016-05-25 | 中国中医科学院中药研究所 | PCR (polymerase chain reaction) method and kit for identifying peach kernel and bitter almond on basis of ITS sequence site |
| CN105671185A (en) * | 2016-03-29 | 2016-06-15 | 浙江省嘉兴市农业科学研究院（所） | Application of ITS (internal transcribed spacer) sequence as DNA barcode in identifying Jiaxing Zuili (Prunus salicina lindl.) and identifying method |
Non-Patent Citations (1)
| Title |
|---|
| LING GUO等: "New insights into the genetic diversity and species identification of the native apricots in Southern Xinjiang of China", 《GENETICS AND MOLECULAR RESEARCH》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129476A (en) * | 2019-05-10 | 2019-08-16 | 国家林业和草原局泡桐研究开发中心 | A kind of Early Identification primer, screening technique and the discrimination method at florescence Siberia apricot morning and evening |
| CN110129476B (en) * | 2019-05-10 | 2023-05-05 | 中国林业科学研究院经济林研究所 | Early identification primer, screening method and identification method for early and late flowering period of Siberian apricots |
| CN110592265B (en) * | 2019-10-29 | 2023-11-24 | 江西省农业科学院蔬菜花卉研究所 | DNA bar code and method for rapid identification of solanum plants |
| CN111826462A (en) * | 2020-08-21 | 2020-10-27 | 国家林业和草原局泡桐研究开发中心 | Marker related to early and late flowering period of Siberian apricot and detection primer, method and application thereof |
| CN111826462B (en) * | 2020-08-21 | 2023-06-16 | 中国林业科学研究院经济林研究所 | Marker related to flowering phase of Siberian apricot in the morning and evening, detection primer, method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Osorio-Guarín et al. | Colombia a source of cacao genetic diversity as revealed by the population structure analysis of germplasm bank of Theobroma cacao L. | |
| Haling et al. | Direct measurement of roots in soil for single and mixed species using a quantitative DNA-based method | |
| Khadivi-Khub et al. | Phenotypic and genotypic variation in Iranian sour and duke cherries | |
| CN106987648B (en) | High-flux SSR molecular marking method related to plant organ development | |
| CN105385778A (en) | Primers and method for detecting SNP gene typing of AhFAD2B genes of peanuts in high throughput | |
| CN106544438A (en) | A kind of application of genetic marker in purpleapricot identification | |
| CN105063028B (en) | SSR primer sets and the method using primer sets structure malt finger-print | |
| CN113621731A (en) | Method for tracing and identifying origin of Guizhou blueberry honey | |
| KR101642702B1 (en) | A method for identifying pear varieties using microsatellites markers | |
| CN113699220A (en) | Method for identifying honey and tracing honey producing area by regional plant sources | |
| CN107058494B (en) | Method for simplifying purity identification of common vetch variety by adopting SCoT molecular marker | |
| CN116121445A (en) | KASP molecular marker for detecting grain weight and grain width of wheat in multiple environments and application | |
| CN110878376A (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| KR20140106815A (en) | Universal primer set COS0566 for discrimination of Brassicaceae sp. and molecular marker comprising the same | |
| KR20140095214A (en) | Universal primer set for discrimination of Brassicaceae sp. and molecular marker comprising the same | |
| JP5106743B2 (en) | Identification method of rice varieties using microsatellite markers | |
| CN108531642A (en) | One group of SSR molecular marker and its application for differentiating corn variety | |
| JP2015154772A (en) | Method for identifying habitat of insect | |
| GAMA et al. | Genetic variability of watermelon accessions based on microsatellite markers. | |
| Lee et al. | Development of PCR diagnostic system for detection of the seed-transmitted tobacco ringspot virus in quarantine | |
| Li et al. | Establishment of molecular identity cards for Cucumis melo cultivars using ssr markers | |
| CN106701917A (en) | Special primer for identifying gummy stem blight resistance of muskmelon and molecular marking method | |
| KR101695053B1 (en) | Universal primer set COS0264 for discrimination of Brassicaceae sp. and molecular marker comprising the same | |
| Mawalagedera et al. | DNA marker analysis reveals genomic diversity and putative QTL associated with drupe traits in Phyllanthus emblica L. | |
| KR101699518B1 (en) | Primer set for discrimination of a ginseng cultivar Gumpoong and a landrace Hwangsook and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170329 |
|
| WD01 | Invention patent application deemed withdrawn after publication |