CN115044693A - Real-time fluorescence quantitative PCR (polymerase chain reaction) internal reference gene of black-drug parabagin and application thereof - Google Patents

Abstract

The invention discloses a real-time fluorescence quantitative PCR reference gene of yew, which can be stably expressed under drought, high-temperature and low-temperature treatment of yew, the black medicine. Compared with the prior general internal reference gene on other species, the internal reference gene has the advantages of good specificity, high stability and the like, and simultaneously has stable expression level under the drought, high-temperature and low-temperature treatment conditions of the Taxus brevifolia, but the prior internal reference gene can not realize stable expression level under the drought, high-temperature and low-temperature treatment conditions of the Taxus brevifolia, so that the internal reference gene has better correction capability than the prior general internal reference gene, fills the blank that the research field of the Taxus brevifolia lacks a proper and general fluorescence quantitative PCR internal reference gene, and provides an effective internal reference gene correction tool for the gene expression analysis, screening and verification work of the Taxus brevifolia and other wheat plants in the future. Is suitable for popularization and application in the field of internal reference genes.

Description

Real-time fluorescence quantitative PCR (polymerase chain reaction) internal reference gene of black-drug parabagin and application thereof

Technical Field

The invention belongs to the field of internal reference genes, and particularly relates to a real-time fluorescence quantitative PCR (polymerase chain reaction) internal reference gene of yew, which is a black drug, and application thereof.

Background

Perennial allophexaploid self-pollinated plants of K.melanthera (K.melanthera) genus Poaeae (Triticueae) genus Taxillus (Kengyilia) are mainly distributed on dry and semidry hills, valleys, grasslands and meadows of Qinghai-Tibet plateau with the altitude of 3300-. In addition, it was found that the black drug, Taxus brevifolia, has a strong resistance to wheat scab. The excellent characteristics are traits needing to be improved in the genetic improvement of wheat crops and pasture grasses, and the gene transfer of the excellent traits into the genetic background of the wheat crops and the pasture grasses is completely possible by modern genetic and biotechnological methods such as distant hybridization, chromosome engineering, genetic engineering and the like. Therefore, the yew medicine has important significance as an important gene resource for breeding wheat crops and pasture.

The real-time fluorescent quantitative PCR (qRT-PCR) has the advantages of high sensitivity, strong specificity, repeated dynamic quantitative range, high flux and the like, and is one of the common technologies for researching the gene expression level in the field of plant science. However, the quality and yield of RNA, the difference in reverse transcription efficiency, and other factors that hinder the analysis of RNA have an effect on the accuracy of the analysis result of the expression of the target gene. Therefore, it is necessary to select an appropriate reference gene for correction so as to reduce the difference between test samples. An ideal reference gene should have a stable expression level under various conditions, such as different tissues, different developmental stages, and various biotic and abiotic stresses. In plant qRT-PCR analysis, common reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor-1 a (EF-1 α), Ubiquitin (UBQ), ACTIN (ACTIN), α -Tubulin (TUA), β -Tubulin (TUB), 18S rRNA, and Cyclophilin (CYP). Recent studies have found that the expression of these common reference genes is not constant under different environmental conditions, at different developmental stages and in tissues and organs. Meanwhile, different plants have the most suitable reference genes, and the stability of the reference genes among different tissues of the same plant is different and can only be relatively stable within a certain test range. Incorrect analysis results are often obtained when inappropriate reference genes are selected for data normalization. Therefore, selection of a reference gene that is stably expressed for a particular species under particular experimental conditions is critical for analysis of the expression level of the gene of interest.

However, at present, no report of an internal reference gene of the yew medicine yew at home and abroad exists, and the excavation and utilization of the excellent resistance gene are severely restricted. The most stable internal reference gene of the Taxus chinensis, which is a black medicine, is developed under different abiotic stress (drought, high temperature and low temperature) treatments based on full-length transcriptome data, and is verified by a stress-related gene Catalase (CAT). Aims to find the most stable and suitable internal reference gene for the real-time fluorescent quantitative PCR research of the black medicine yew, and lays a foundation for exploring and utilizing the resistance gene of the black medicine yew.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a real-time fluorescence quantitative PCR internal reference gene of the yew, which can be stably expressed under drought, high-temperature and low-temperature treatment of the yew, which is a black medicine.

The technical scheme adopted by the invention for solving the technical problems is as follows: the real-time fluorescence quantitative PCR internal reference gene of the black medicine, which is Tript-28482; the cDNA SEQUENCE of the Transcript-28482 reference gene is shown in the SEQUENCE table SEQUENCE ID NO. 1.

The invention also finds the application of the real-time fluorescence quantitative PCR internal reference gene of the Taxus brevifolia in the gene expression analysis of the Taxus brevifolia after drought, high-temperature and low-temperature treatment.

The invention also provides a gene expression analysis method after drought, high-temperature and low-temperature treatment of the Taxus brevifolia by using the real-time fluorescence quantitative PCR internal reference gene of the Taxus brevifolia, which comprises the following steps:

1) and material culture and treatment: selecting Bin seed as black drug, sterilizing with 1% sodium hypochlorite, washing with sterile distilled water for 5 times, sowing the seed in 20 × 15 × 5cm plastic pots (1.5 g per pot), covering with quartz sand, and casting 1/2 timesThe Hoagland nutrient solution has a light cycle of 12h, a relative humidity of 75% and a light intensity of 250 umol.m at day and night temperatures of 23 deg.C and 19 deg.C respectively ^-2 ·s ^-1 After culturing in a growth chamber for 21 days, dividing the plant of the Taxus brevifolia into three treatment groups, respectively placing the plants of the three treatment groups in an incubator at 4 ℃ for cold stress, an incubator at 38 ℃ in daytime/33 ℃ at night for high-temperature treatment and drought stress with 20% concentration PEG-6000, respectively collecting leaf samples 0 hour, 12 hours, 24 hours, 48 hours and 96 hours after the beginning of each treatment, immediately freezing the collected samples in liquid nitrogen, and storing the samples in a refrigerator at-80 ℃ for RNA extraction;

2) extracting total RNA of yew midwood of black medicine: extracting total RNA by using an RNA extraction kit, detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and performing purity detection and concentration quantification on the extracted RNA by using NanoDrop;

3) and synthesizing cDNA: synthesizing cDNA of qualified samples by adopting an Evo M-MLVRTMix kit, and storing at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:

first, 20uL of the total reaction solution was prepared in a PCR tube, and the reaction procedure was as follows: firstly reacting at 37 ℃ for 15min, then reacting at 85 ℃ for 5s, and then keeping at 4 ℃; the reverse transcription reaction liquid system is shown in table 1:

TABLE 1 reverse transcription reaction solution System

4) qRT-PCR reaction of target gene and reference gene:

qRT-PCR was performed using 2 × SYBR Green Pro Taq HS Premix, and the reference gene and the target gene were spotted on the same PCR plate and the reaction was performed on a CFX96TM Real Time System fluorescence quantifier, and the PCR reaction System is shown in Table 2:

TABLE 2 PCR reaction System

The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, 40 cycles, performing 65-95 ℃ dissolution curve analysis, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain melting temperature, collecting the fluorescence signal of the dissolution curve, and obtaining the Ct value data from CFX96 ^TM Reading automatically by a Real Time System fluorescent quantitative PCR instrument;

5) the Ct value obtained was defined as 2 ^-△△Ct The method calculates the relative expression quantity, and comprises the following specific steps:

Δ Ct (target gene) -Ct (reference gene)

Δ Ct ═ Δ Ct (treatment) - Δct (control)

2 ^-△△Ct Relative expression amount.

The invention has the beneficial effects that: the real-time fluorescence quantitative PCR internal reference gene of the taxus cuspidata is based on full-length transcriptome data, an optimal internal reference gene is screened out, and the real-time fluorescence quantitative PCR internal reference gene has the advantages of good specificity, high stability and the like compared with the prior general internal reference gene on other species, and meanwhile, the expression analysis research of the internal reference gene under different processing conditions of high temperature, low temperature and drought stress of the taxus cuspidata better verifies that the internal reference gene has stable expression levels under the drought, high temperature and low temperature processing conditions of the taxus cuspidata, but the prior internal reference gene can not realize the stable expression levels under the drought, high temperature and low temperature processing conditions of the taxus cuspidata, therefore, the internal reference gene of the invention has better correction capability compared with the prior general internal reference gene, fills the blank that the proper and general fluorescence quantitative PCR internal reference gene is lacked in the research field of the taxus cuspidata, provides an effective reference gene correction tool for the gene expression analysis, screening and verification of the plant of the Taxus brevifolia and other wheat families in future.

Drawings

FIG. 1 is an electrophoretogram of sequences of 14 internal reference genes amplified using Taxus brevifolia cDNA as a template in example 1;

FIG. 2 shows Ct values of 14 reference genes in all samples in example 1;

FIG. 3 is a melting curve of 14 reference genes in example 1;

FIG. 4 is a graph showing the sequence of expression stability values M of 14 reference genes calculated by GeNorm software in example 1;

FIG. 5 is a graph showing the analysis of the change in the expression level of a target CAT gene of Taxus nigra under a low-temperature treatment condition by using Transcript-28482, TCIP and TUA;

FIG. 6 is a graph showing the analysis of the change in the expression level of a target CAT gene of Taxus nigra under high temperature treatment conditions using Transcript-28482, F-BOX, and TUB;

FIG. 7 is a graph showing the analysis of the change in the expression level of a target CAT gene of Taxus chinensis, which is a black drug, under drought conditions, using Transcript-28482, F-BOX, and ABC.

Detailed Description

The present invention will be further described with reference to the following examples.

The internal reference gene of the real-time fluorescence quantitative PCR internal reference gene of the black medicine, the yearborinia littoralis is Transcript-28482; the cDNA sequence of the internal reference gene of the Transcript-28482 is shown as follows:

GATTCTGGAAAACACACACGAAAAAGCGCTCCTGGACGGGGAAGACGACTTGGTGCTCGTGCCTCC CCTGCCCCGAGATCTACCAAAACCCGCGCCCCCGTCAATCCCGTTCCTCCTCCTCACCGTCCGGCGA GCCCCGAGCACACCAGATCGCCCGCTACGACCTGTAGCTGGCGGCGCACCGTGCAAACGCGAGCCA GTTAAGGGTGGTGGTGGTCCCAGGCGCTCGAGCGGGGCGCGGGCGACGCGGAGACGATGCCGGTGG CGGCGTCGGCCATCTACTTCCTCAACCTCCGCGGGGACGTCCTCATCAACCGCCTATACCGCGACGA TGTCGGGGGAAATATGGTTGATGCATTCAGGATGCACATTATGCAAACAAAAGAACTTGGTACATG CCCTGTTCGACAAATAGGAGGCTGTTCCTTCCTTTACATGAGGATCAGTAATGTTTACATTGTGATCG TTGTTAGCAGCAATGCTAATGTTTCTTGTGCTTTCAAGTTTGTTGTGGAGGCAGTGGCCCTCTTCAAG TCCTACTTTGGTGGAACTTTTGATGAAGATGCTATCAGGAATAACTTTGTGTTAATATACGAACTTCT TGATGAGATTATGGACTTCGGTTATCCTCAGAATCTTTCACCTGAAATTTTGAAGTTATATATAACCC AGGAAGGCGTACGGTCGCCATTTTCCTCCAAGCCTTCGGATAAGCCTGTTCCAAATGCGACCCTGCA AGTTACCGGCGCTGTTGGTTGGAGAAGAGAGGGTCTTGTGTACAAGAAGAATGAGGTTTTCTTGGAC ATTGTTGAGAGTGTAAACCTTCTTATGTCTTCTAAAGGGAGTGTTCTACGATGTGACGTGACGGGAA AGATTCTTATGAAGTGTTTCCTTTCTGGAATGCCTGATCTGAAGTTGGGACTAAATGACAAGATTGG ACTTGAAAAGGAAGCCCAACTGAAGTCCAGGCCTTCAAAGAGTGGGAAGACCATAGAACTCGATGA TGTCACGTTCCACCAGTGCGTCAACCTAACAAGATTTAACTCAGAAAAAACAGTCAGCTTTGTGCCA CCAGATGGTGAATTCGAATTGATGAAATATCGAATCACGGAGGGCGTAAATCTTCCTTTCCGGGTTC TGCCCACAATTAAGGAGTTGGGCCGAACACGCATGGAGATTAACGTGAAAGTTAAGAGTGTTTTTG GTGCTAAGATGTTTGCACTTGGTGTTGTGGTCAAAGTTCCAGTTCCAAAGCAGACAGCAAAGACGAG TTTCCAAACAACATCTGGCAAAGCCAAATATAATGCTTCGATTGATTCCCTGGTGTGGAAGATCAGG AAATTCCCTGGACAGACCGAGGCAACGATGAGTGCAGAAGTTGAACTGATCTCTACAATGGGGGAA AAGAAGTTAGCGAACAGGCCACCGATTCAGATGGAATTCCAGGTTCCGATGTTCACCTGCTTCTGGT TTACGTGTTCGGTTCCTCAAGGTGTGGGAGAAGAGTGGCTACAACACCGTTGAGTGGGTTCGCTACA TCACAAGGGCTGGATCATACGAAATCAGGTGTTAGTGACCAAGAAAAATGGCGTGGGCTCCTTATTT CGTGGATTCGTGGAGCTCTTTTTGTACGCAGCATGATTGATCGGAAGCACGTAAATTATGACCCAGT TCTCTGTGAGTTTGTACTAGCAGAGGGCAGATCAGAGCAGGCAGTTTTCCGATGTTCCTTATTTTCAT GTTGACATGGGATATGTATTCTCCCCCCATGTCCTGTTTGTGTCATAGGGCATATTTTTATTGTATATT TGACAGTAGCATTCGTTATCGTTGACCAATACACCCCTTGCCGGCTCGTGCTGTTTTCTCGTTGAACG GGTGTCAAATCTCTTGCAAAACGGTGTATAAATATATGATGATAATGTTGTTGGCTTGCTGTGGCTGT GTTTGACGTAAGTCCATCGTTGAG

the real-time fluorescence quantitative PCR internal reference gene of the taxus cuspidata is based on full-length transcriptome data, an optimal internal reference gene is screened out, and the real-time fluorescence quantitative PCR internal reference gene has the advantages of good specificity, high stability and the like compared with the prior general internal reference gene on other species, and meanwhile, the expression analysis research of the internal reference gene under different processing conditions of high temperature, low temperature and drought stress of the taxus cuspidata better verifies that the optimal internal reference gene has stable expression levels under the processing conditions of high temperature, drought and low temperature of the taxus cuspidata, but the prior internal reference gene can not realize the stable expression levels under the processing conditions of drought, high temperature and low temperature of the taxus cuspidata, therefore, the internal reference gene of the invention has better correction capability compared with the prior general internal reference gene, fills the blank that the proper and general fluorescence quantitative PCR internal reference gene is lacked in the research field of the taxus cuspidata, provides an effective reference gene correction tool for the gene expression analysis, screening and verification of the plant of the Taxus brevifolia and other wheat families in future.

The invention also finds the application of the real-time fluorescence quantitative PCR internal reference gene of the yew in gene expression analysis after drought, high-temperature and low-temperature treatment of the yew.

The invention also provides a gene expression analysis method after drought, high-temperature and low-temperature treatment of the Taxus brevifolia by using the real-time fluorescence quantitative PCR internal reference gene of the Taxus brevifolia, which comprises the following steps:

1) material cultivation and treatment: selecting seeds of Taxus brevifolia, sterilizing with 1% sodium hypochlorite, washing with sterile distilled water for 5 times, sowing the seeds in 20 × 15 × 5cm plastic pots with 1.5g each, covering with quartz sand, pouring 1/2 times of Hoagland nutrient solution, and keeping the temperature at 23 deg.C and 19 deg.C, light period of 12h, relative humidity of 75%, and illumination intensity of 250 umol.m ^-2 ·s ^-1 After culturing in a growth chamber for 21 days, dividing the plant of the Taxus brevifolia into three treatment groups, respectively placing the plants of the three treatment groups in an incubator at 4 ℃ for cold stress, an incubator at 38 ℃ in daytime/33 ℃ at night for high-temperature treatment and drought stress with 20% concentration PEG-6000, respectively collecting leaf samples 0 hour, 12 hours, 24 hours, 48 hours and 96 hours after the beginning of each treatment, immediately freezing the collected samples in liquid nitrogen, and storing the samples in a refrigerator at-80 ℃ for RNA extraction;

2) extracting total RNA of the general yew: extracting total RNA by using an RNA extraction kit (Tiangen Biotech, Beijing, China), detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and detecting the purity and quantifying the concentration of the extracted RNA by using NanoDrop (Eppendorf, Germany);

3) and cDNA synthesis: synthesizing cDNA (complementary deoxyribonucleic acid) of a qualified sample by adopting an Evo M-MLV RT Mix kit (Accurate Biotech, Hunan, China), and storing the cDNA at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:

first, 20uL of the total reaction solution was prepared in a PCR tube, and the reaction procedure was as follows: firstly reacting at 37 ℃ for 15min, then reacting at 85 ℃ for 5s, and then keeping at 4 ℃; the reverse transcription reaction liquid system is shown in table 3:

TABLE 3 reverse transcription reaction solution System

4) qRT-PCR reaction of target gene and reference gene:

qRT-PCR was performed using 2 × SYBR Green Pro Taq HS Premix (Accurate Biotech, Hunan, China), the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on a CFX96TM Real Time System fluorescence quantifier, and the PCR reaction System is shown in Table 4:

TABLE 4 PCR reaction System

The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, 40 cycles, performing 65-95 ℃ dissolution curve analysis, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain melting temperature, collecting the fluorescence signal of the dissolution curve, and obtaining the Ct value data from CFX96 ^TM Reading automatically by a Real Time System fluorescent quantitative PCR instrument;

5) calculating the relative expression quantity of the obtained Ct value by using a 2-delta Ct method, and specifically comprising the following steps of:

Δ Ct (target gene) -Ct (reference gene)

Δ Ct ═ Δ Ct (treatment) - Δct (control)

2 ^-△△Ct Relative expression amount.

Example 1

This example is a comparative application of the real-time fluorescence quantitative PCR internal reference gene of Taxus cuspidata of the present invention in expression stability analysis after drought, high temperature and low temperature treatment of Taxus cuspidata and 13 conventional internal reference genes, for comparison of the effects of developing new reference genes, the following 13 commonly used conventional reference genes EF-1 alpha (excitation factor 1-alpha), GAPDH (Glyceraldehyde-3-phosphate dehydrogenase 2), ACTIN (Actin-1), UBI (polyquitin), TUB (Tubulin beta-3chain), TIP41(TIP41-like Protein), PP2A (Protein phophatase 2A), TUA (Tubulin alpha-1chain), eIF4A (Eukaryotic information factor 4A), CYP (cyclophilin A-3), TCT (transgenic BOX), ABC (ATP-binding cassette transporter), F-Protein (F-cassette 6) were selected as controls. Sequence information of common internal reference genes comes from an NCBI database, primers are designed on line by using primer3.0 after homologous gene sequence comparison, and relevant information of the primers is shown in a table 7; the specific steps are as follows:

1) and material culture and treatment: selecting seeds of Taxus brevifolia, sterilizing with 1% sodium hypochlorite, washing with sterile distilled water for 5 times, sowing the seeds in 20 × 15 × 5cm plastic pots with 1.5g each, covering with quartz sand, pouring 1/2 times of Hoagland nutrient solution, and keeping the temperature at 23 deg.C and 19 deg.C, light period of 12h, relative humidity of 75%, and illumination intensity of 250 umol.m ^-2 ·s ^-1 After culturing in a growth chamber for 21 days, dividing the plant of the Taxus brevifolia into three treatment groups, respectively placing the plants of the three treatment groups in an incubator at 4 ℃ for cold stress, an incubator at 38 ℃/33 ℃ in the daytime for high temperature treatment at night and a 20% concentration PEG-6000 for drought stress, respectively collecting leaf samples 0 hour, 12 hours, 24 hours, 48 hours and 96 hours after the beginning of each treatment, immediately freezing the collected samples in liquid nitrogen, and storing the samples in a refrigerator at-80 ℃ for RNA extraction;

2) extracting total RNA of the general yew: extracting total RNA by using an RNA extraction kit (Tiangen Biotech, Beijing, China), detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and detecting the purity and quantifying the concentration of the extracted RNA by using NanoDrop (Eppendorf, Germany);

3) and cDNA synthesis: synthesizing cDNA (complementary deoxyribonucleic acid) of a qualified sample by adopting an Evo M-MLV RT Mix kit (Accurate Biotech, Hunan, China), and storing the cDNA at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:

first, 20uL of the total reaction solution was prepared in a PCR tube, and the reaction procedure was as follows: firstly reacting at 37 ℃ for 15min, then reacting at 85 ℃ for 5s, and then keeping at 4 ℃; the reverse transcription reaction liquid system is shown in table 5:

TABLE 5 reverse transcription reaction solution System

4) qRT-PCR reaction of target gene and reference gene:

qRT-PCR was performed using 2 × SYBR Green Pro Taq HS Premix (Accurate Biotech, Hunan, China), the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on CFX96TM Real Time System fluorometer, the PCR reaction System is shown in Table 6:

TABLE 6 PCR reaction System

The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, 40 cycles, performing 65-95 ℃ dissolution curve analysis, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain melting temperature, collecting the fluorescence signal of the dissolution curve, and obtaining the Ct value data from CFX96 ^TM Reading automatically by a Real Time System fluorescent quantitative PCR instrument; FIG. 1 is an amplification electrophoretogram of 14 internal reference genes, wherein M is DL2000DNA marker,1 is EF-1 α,2 is GAPDH,3 is ACTIN,4 is UBI,5 is TUB,6 is TIP41, 7 is Transcript-28482,8 is PP2A,9 is TUA,10 is eIF4A,11 is CYP,12 is TCT, 13 is ABC, 14 is F-BOX; FIG. 2 shows Ct values of 14 reference genes of all samples, the central line of each box represents the Ct median of each reference, the two ends of the box represent the range of 25% -75% of data, and the upper and lower edges represent the maximum and minimum values; FIG. 3 is a melting curve of 14 reference genes; the primers for the reference gene used in the reaction are shown in Table 7:

TABLE 7 qRT-PCR reference Gene primer sequences

5) Calculating the relative expression quantity of the obtained Ct value by using a 2-delta Ct method, and specifically comprising the following steps of:

Δ Ct (target gene) -Ct (reference gene)

Δ Ct ═ Δ Ct (treatment) - Δct (control)

2 ^-△△Ct Relative expression amount.

According to the data of 14 reference genes, calculating an expression stability value M sequencing chart of the 14 reference genes by utilizing GeNorm software, and as shown in FIG. 4, FIG. 4A is a low-temperature treatment condition; FIG. 4B shows high temperature treatment conditions, FIG. 4C shows drought treatment conditions, and FIG. 4D shows comprehensive analysis of all stress treatments; the stability of the expression level of the candidate reference genes was analyzed by using GeNorm (V3.5), BestKeeper (V1.0) and Normfinder (V0.953)3 software programs, and finally the reference genes were subjected to comprehensive ranking by using RefFinder (http:// www.leonxie.com/referrence. php), as shown in Table 8:

TABLE 8 sequencing after analysis of reference genes

As can be seen from FIG. 1, FIG. 2, FIG. 3, FIG. 4 and Table 8, the top-ranked reference gene in the final composite ranking was Transcript-28482. The result shows that the newly developed internal reference gene Transcript-28482 has the advantages of good specificity, high stability and the like compared with the prior general internal reference gene on other species, and simultaneously, through the expression analysis research on the internal reference gene under different processing conditions of high temperature, low temperature and drought stress of the black-drug fir, the optimal internal reference gene has stable expression level under the processing conditions of the black-drug fir, drought and low temperature, but the existing internal reference gene can not realize stable expression level under the processing conditions of the black-drug fir, drought, high temperature and low temperature, therefore, the internal reference gene of the invention has better correction capability compared with the existing general internal reference gene, fills the blank that the appropriate and general fluorescence quantitative PCR internal reference gene is lacked in the research field of the black-drug fir, and is used for the gene expression analysis and analysis of the black-drug fir and other wheat families plants, The screening and verification work provides an effective reference gene correction tool.

Example 2

In this example, to verify the effect of the application of the reference gene, Catalase (CAT) gene is selected as the target gene, CAT is a common antioxidant enzyme in plants, and can help plants to scavenge active oxygen in vivo and protect cells from oxidative damage, and the expression level of CAT is usually increased after stress. Therefore, in this example, the internal reference gene Transcript-28482 and the universal internal reference genes of other species (see Table 11) provided by the present invention were selected respectively, and the expression level of CAT gene of Taxus brevicornus was verified and compared by qRT-PCR method under drought, high temperature and low temperature treatment. The method comprises the following specific steps:

1) and material culture and treatment: selecting seeds of Bin grass, sterilizing with 1% sodium hypochlorite, washing with sterile distilled water for 5 times, sowing the seeds in 20 × 15 × 5cm plastic pots (1.5 g per pot), covering with quartz sand, pouring 1/2 times of Hoagland nutrient solution at day and night of 23 deg.C and 19 deg.C, light cycle of 12h, relative humidity of 75%, and illumination intensity of 250 umol.m ^-2 ·s ^-1 After culturing in a growth chamber for 21 days, dividing the plant of the Taxus brevifolia into three treatment groups, respectively placing the plants of the three treatment groups in an incubator at 4 ℃ for cold stress, an incubator at 38 ℃ in daytime/33 ℃ at night for high-temperature treatment and drought stress with 20% concentration PEG-6000, respectively collecting leaf samples 0 hour, 12 hours, 24 hours, 48 hours and 96 hours after the beginning of each treatment, immediately freezing the collected samples in liquid nitrogen, and storing in a refrigerator at-80 ℃ for RNA extraction;

2) extracting total RNA of the general yew: extracting total RNA by using an RNA extraction kit (Tiangen Biotech, Beijing, China), detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and detecting the purity and quantifying the concentration of the extracted RNA by using NanoDrop (Eppendorf, Germany);

3) and cDNA synthesis: synthesizing cDNA (complementary deoxyribonucleic acid) of a qualified sample by adopting an Evo M-MLV RT Mix kit (Accurate Biotech, Hunan, China), and storing the cDNA at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:

first, 20uL of the total reaction solution was prepared in a PCR tube, and the reaction procedure was as follows: reacting at 37 deg.C for 15min, reacting at 85 deg.C for 5s, and keeping at 4 deg.C; the reverse transcription reaction liquid system is shown in table 9:

TABLE 9 reverse transcription reaction liquid System

4) qRT-PCR reaction of target gene and reference gene:

qRT-PCR was performed using 2 × SYBR Green Pro Taq HS Premix (Accurate Biotech, Hunan, China), the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on a CFX96TM Real Time System fluorescence quantifier, and the PCR reaction System is shown in Table 10:

TABLE 10PCR reaction System

The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, 40 cycles, performing 65-95 ℃ dissolution curve analysis, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain melting temperature, collecting the fluorescence signal of the dissolution curve, and obtaining the Ct value data from CFX96 ^TM Reading automatically by a Real Time System fluorescent quantitative PCR instrument; the primer sequences of the qRT-PCR reference gene and CAT gene are shown in Table 11:

TABLE 11 qRT-PCR reference Gene and CAT Gene primer sequences

5) Calculating the relative expression quantity of the obtained Ct value by using a 2-delta Ct method, and specifically comprising the following steps of:

Δ Ct (target gene) -Ct (reference gene)

Δ Ct ═ Δ Ct (treatment) - Δct (control)

2 ^-△△Ct Relative expression amount.

Figure 5 is an analysis diagram of the change of the target CAT gene expression quantity of the Biancao target of the black drug under the low-temperature treatment condition by applying Transcript-28482, TCIP and TUA; FIG. 6 is a graph showing the analysis of the change in the expression level of a target CAT gene of Taxus nigra under high temperature treatment conditions using Transcript-28482, F-BOX, and TUB; FIG. 7 is a graph showing the analysis of the change in the expression level of a target CAT gene of Taxus chinensis, which is a black drug, under drought conditions, using Transcript-28482, F-BOX, ABC;

as can be seen from FIG. 5, under the low temperature treatment conditions, among them, the stability of Transcript-28482 is the best, TCIP is the more stable internal reference gene, and TUA is less stable; as can be seen from the results of qRT-PCR, the relative unstable TUA gene is used, the change of the expression quantity of CAT is large when the TUA gene is processed at low temperature for 24h, 48h and 96h, the trend is opposite to that when other reference genes are used, and the trend is consistent and the repeatability is good when CYP2 and ACT with good stability are used.

As can be seen from FIG. 6, under the high temperature treatment condition, among them, Transcript-28482 is the most stable, F-BOX is the reference gene with good relative stability, and TUB is poor in stability; as seen from the qRT-PCR results, the CAT expression level after high temperature treatment was inconsistent with the unstable TUB gene, and the opposite trend appeared in 12h, while the CAT expression trend was consistent with that of using the stable Transcript-28482 and F-BOX, and the results were more reliable.

As can be seen from FIG. 7, in the drought conditions, among them, Transcript-28482 is the most stable, F-BOX is the reference gene with better relative stability, and ABC is relatively poor in stability; as seen in the qRT-PCR result, the change of CAT expression level after drought treatment is inconsistent by using unstable ABC genes, and opposite trends appear at 12h,24h and 48h, while the CAT expression trends are consistent by using Transcript-28482 and F-BOX with better stability, and the result is more reliable.

As can be seen from FIGS. 5 to 7, the internal reference gene Transcript-28482 developed by the invention has better effects on the analysis of the expression of the target gene under low-temperature stress, high-temperature stress and drought stress compared with the common internal reference, and clearly shows the expression change conditions of the target gene CAT after the target gene CAT is treated for 12h,24h, 48h and 96h under different stresses; when used alone, the test operation is simple and convenient, and the cost is reduced.

In conclusion, the internal reference gene sequence is from a full-length transcription group sequence of the black medicine yew, has the advantages of good specificity, high stability and the like compared with the prior general internal reference genes on other species, and simultaneously, through expression analysis research of Catalase (CAT) genes under different treatments of the black medicine yew, the stable internal reference gene developed by the invention is better verified to have better correction capability, thereby providing an effective internal reference gene correction tool for the expression analysis and verification work of the resistance genes of the black medicine yew and other wheat plants in the future.

Sequence listing

<110> Sichuan university of agriculture

<120> real-time fluorescence quantitative PCR internal reference gene of Taxus brevifolia and application thereof

<130> 2022

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1969

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 1

gattctggaa aacacacacg aaaaagcgct cctggacggg gaagacgact tggtgctcgt 60

gcctcccctg ccccgagatc taccaaaacc cgcgcccccg tcaatcccgt tcctcctcct 120

caccgtccgg cgagccccga gcacaccaga tcgcccgcta cgacctgtag ctggcggcgc 180

accgtgcaaa cgcgagccag ttaagggtgg tggtggtccc aggcgctcga gcggggcgcg 240

ggcgacgcgg agacgatgcc ggtggcggcg tcggccatct acttcctcaa cctccgcggg 300

gacgtcctca tcaaccgcct ataccgcgac gatgtcgggg gaaatatggt tgatgcattc 360

aggatgcaca ttatgcaaac aaaagaactt ggtacatgcc ctgttcgaca aataggaggc 420

tgttccttcc tttacatgag gatcagtaat gtttacattg tgatcgttgt tagcagcaat 480

gctaatgttt cttgtgcttt caagtttgtt gtggaggcag tggccctctt caagtcctac 540

tttggtggaa cttttgatga agatgctatc aggaataact ttgtgttaat atacgaactt 600

cttgatgaga ttatggactt cggttatcct cagaatcttt cacctgaaat tttgaagtta 660

tatataaccc aggaaggcgt acggtcgcca ttttcctcca agccttcgga taagcctgtt 720

ccaaatgcga ccctgcaagt taccggcgct gttggttgga gaagagaggg tcttgtgtac 780

aagaagaatg aggttttctt ggacattgtt gagagtgtaa accttcttat gtcttctaaa 840

gggagtgttc tacgatgtga cgtgacggga aagattctta tgaagtgttt cctttctgga 900

atgcctgatc tgaagttggg actaaatgac aagattggac ttgaaaagga agcccaactg 960

aagtccaggc cttcaaagag tgggaagacc atagaactcg atgatgtcac gttccaccag 1020

tgcgtcaacc taacaagatt taactcagaa aaaacagtca gctttgtgcc accagatggt 1080

gaattcgaat tgatgaaata tcgaatcacg gagggcgtaa atcttccttt ccgggttctg 1140

cccacaatta aggagttggg ccgaacacgc atggagatta acgtgaaagt taagagtgtt 1200

tttggtgcta agatgtttgc acttggtgtt gtggtcaaag ttccagttcc aaagcagaca 1260

gcaaagacga gtttccaaac aacatctggc aaagccaaat ataatgcttc gattgattcc 1320

ctggtgtgga agatcaggaa attccctgga cagaccgagg caacgatgag tgcagaagtt 1380

gaactgatct ctacaatggg ggaaaagaag ttagcgaaca ggccaccgat tcagatggaa 1440

ttccaggttc cgatgttcac ctgcttctgg tttacgtgtt cggttcctca aggtgtggga 1500

gaagagtggc tacaacaccg ttgagtgggt tcgctacatc acaagggctg gatcatacga 1560

aatcaggtgt tagtgaccaa gaaaaatggc gtgggctcct tatttcgtgg attcgtggag 1620

ctctttttgt acgcagcatg attgatcgga agcacgtaaa ttatgaccca gttctctgtg 1680

agtttgtact agcagagggc agatcagagc aggcagtttt ccgatgttcc ttattttcat 1740

gttgacatgg gatatgtatt ctccccccat gtcctgtttg tgtcataggg catattttta 1800

ttgtatattt gacagtagca ttcgttatcg ttgaccaata caccccttgc cggctcgtgc 1860

tgttttctcg ttgaacgggt gtcaaatctc ttgcaaaacg gtgtataaat atatgatgat 1920

aatgttgttg gcttgctgtg gctgtgtttg acgtaagtcc atcgttgag 1969

Claims (3)

1. The real-time fluorescence quantitative PCR internal reference gene of the black medicine, the yew, is characterized in that: the internal reference gene is Transcript-28482; the cDNA SEQUENCE of the internal reference gene of the Transcript-28482 is shown in a SEQUENCE table SEQUENCE ID NO. 1.

2. Use of the real-time fluorescence quantitative PCR internal reference gene of Taxus nigra according to claim 1 in gene expression analysis after drought, hyperthermia and hypothermia treatment of Taxus nigra.

3. A method for analyzing gene expression of real-time fluorescence quantitative PCR internal reference gene of Taxus nigra according to claim 1 after drought, high temperature and low temperature treatment of Taxus nigra, comprising the steps of:

1) material cultivation and treatment: selecting seeds of Taxus brevifolia, sterilizing with 1% sodium hypochlorite, washing with sterile distilled water for 5 times, sowing the seeds in 20 × 15 × 5cm plastic pots with 1.5g each, covering with quartz sand, pouring 1/2 times of Hoagland nutrient solution, and keeping the temperature at 23 deg.C and 19 deg.C, light period of 12h, relative humidity of 75%, and illumination intensity of 250 umol.m ^-2 ·s ^-1 After 21 days of culture in the growth chamber, the Taxus cuspidata plant was divided into three treatment groups, which were then divided into three treatment groupsThe plants are respectively placed in an incubator at 4 ℃ for cold stress, an incubator at 38/night at 33 ℃ in the day for high-temperature treatment and drought stress with PEG-6000 with the concentration of 20 percent, leaf samples are respectively collected 0 hour, 12 hours, 24 hours, 48 hours and 96 hours after the beginning of each treatment, the collected samples are immediately frozen in liquid nitrogen and stored in a refrigerator at-80 ℃ for RNA extraction;

2) extracting total RNA of the general yew: extracting total RNA by using an RNA extraction kit, detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and performing purity detection and concentration quantification on the extracted RNA by using NanoDrop;

3) and cDNA synthesis: synthesizing cDNA of qualified samples by adopting an Evo M-MLVRTMix kit, and storing at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:

first, 20uL of the total reaction solution was prepared in a PCR tube, and the reaction procedure was as follows: firstly reacting at 37 ℃ for 15min, then reacting at 85 ℃ for 5s, and then keeping at 4 ℃; the reverse transcription reaction liquid system is shown in table 1:

TABLE 1 reverse transcription reaction solution System

4) qRT-PCR reaction of target gene and reference gene:

qRT-PCR was performed using 2 × SYBR Green Pro Taq HS Premix, and the reference gene and the target gene were spotted on the same PCR plate and reacted in CFX96 ^TM Real Time System fluorescence quantification, the PCR reaction System as shown in Table 2:

TABLE 2 PCR reaction System

The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, and performing 40 cycles, then performing dissolution curve analysis at 65-95 ℃, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain a melting temperature, collecting a dissolution curve fluorescence signal, and automatically reading Ct value data by a CFX96TM Real Time System fluorescent quantitative PCR instrument;

5) the Ct value obtained was defined as 2 ^-△△Ct The method calculates the relative expression quantity, and comprises the following specific steps:

Δ Ct (target gene) -Ct (reference gene)

Δ Ct ═ Δ Ct (treatment) - Δct (control)

2 ^-△△Ct Relative expression amount.

Images