CN109609685B - Reference gene developed based on miscanthus transcriptome sequence and application thereof - Google Patents
Reference gene developed based on miscanthus transcriptome sequence and application thereof Download PDFInfo
- Publication number
- CN109609685B CN109609685B CN201910095869.1A CN201910095869A CN109609685B CN 109609685 B CN109609685 B CN 109609685B CN 201910095869 A CN201910095869 A CN 201910095869A CN 109609685 B CN109609685 B CN 109609685B
- Authority
- CN
- China
- Prior art keywords
- miscanthus
- genes
- gene
- sequence
- reference gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 150
- 240000003433 Miscanthus floridulus Species 0.000 title 1
- 241000878007 Miscanthus Species 0.000 claims abstract description 40
- 241000878006 Miscanthus sinensis Species 0.000 claims abstract description 23
- 241000196324 Embryophyta Species 0.000 claims abstract description 16
- 230000008641 drought stress Effects 0.000 claims abstract description 14
- 238000006243 chemical reaction Methods 0.000 claims description 43
- 230000014509 gene expression Effects 0.000 claims description 21
- 239000002299 complementary DNA Substances 0.000 claims description 18
- 238000010839 reverse transcription Methods 0.000 claims description 15
- 238000000034 method Methods 0.000 claims description 14
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 claims description 10
- 238000011529 RT qPCR Methods 0.000 claims description 10
- 238000004090 dissolution Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 238000004458 analytical method Methods 0.000 claims description 8
- 239000004576 sand Substances 0.000 claims description 8
- 230000002194 synthesizing effect Effects 0.000 claims description 8
- 230000008018 melting Effects 0.000 claims description 7
- 238000002844 melting Methods 0.000 claims description 7
- 238000003753 real-time PCR Methods 0.000 claims description 7
- 239000000463 material Substances 0.000 claims description 6
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 5
- 239000008118 PEG 6000 Substances 0.000 claims description 5
- 229920002584 Polyethylene Glycol 6000 Polymers 0.000 claims description 5
- 238000002123 RNA extraction Methods 0.000 claims description 5
- 239000005708 Sodium hypochlorite Substances 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 5
- 238000010805 cDNA synthesis kit Methods 0.000 claims description 5
- 238000013211 curve analysis Methods 0.000 claims description 5
- 238000004925 denaturation Methods 0.000 claims description 5
- 230000036425 denaturation Effects 0.000 claims description 5
- 238000005286 illumination Methods 0.000 claims description 5
- 239000007788 liquid Substances 0.000 claims description 5
- 229910052757 nitrogen Inorganic materials 0.000 claims description 5
- 235000015097 nutrients Nutrition 0.000 claims description 5
- 238000012257 pre-denaturation Methods 0.000 claims description 5
- SUKJFIGYRHOWBL-UHFFFAOYSA-N sodium hypochlorite Chemical compound [Na+].Cl[O-] SUKJFIGYRHOWBL-UHFFFAOYSA-N 0.000 claims description 5
- 238000001514 detection method Methods 0.000 claims description 4
- 238000011002 quantification Methods 0.000 claims description 4
- 239000011543 agarose gel Substances 0.000 claims description 3
- 238000010804 cDNA synthesis Methods 0.000 claims description 3
- 230000001954 sterilising effect Effects 0.000 claims description 3
- 238000010195 expression analysis Methods 0.000 abstract description 12
- 238000012937 correction Methods 0.000 abstract description 11
- 238000011160 research Methods 0.000 abstract description 9
- 238000012216 screening Methods 0.000 abstract description 9
- 238000012795 verification Methods 0.000 abstract description 9
- 241000894007 species Species 0.000 abstract description 7
- 240000006394 Sorghum bicolor Species 0.000 abstract description 4
- 235000011684 Sorghum saccharatum Nutrition 0.000 abstract description 3
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 19
- 101150017120 sod gene Proteins 0.000 description 10
- 241001093152 Mangifera Species 0.000 description 7
- 235000004936 Bromus mango Nutrition 0.000 description 6
- 235000014826 Mangifera indica Nutrition 0.000 description 6
- 235000009184 Spondias indica Nutrition 0.000 description 6
- 108010085238 Actins Proteins 0.000 description 4
- 239000012295 chemical reaction liquid Substances 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 230000001105 regulatory effect Effects 0.000 description 4
- 102000007469 Actins Human genes 0.000 description 3
- 239000002028 Biomass Substances 0.000 description 3
- 208000035199 Tetraploidy Diseases 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000035882 stress Effects 0.000 description 3
- 108020004463 18S ribosomal RNA Proteins 0.000 description 2
- 101000741929 Caenorhabditis elegans Serine/threonine-protein phosphatase 2A catalytic subunit Proteins 0.000 description 2
- 244000025254 Cannabis sativa Species 0.000 description 2
- 102100035914 S-adenosylmethionine decarboxylase proenzyme Human genes 0.000 description 2
- 108050004491 S-adenosylmethionine decarboxylase proenzyme Proteins 0.000 description 2
- 208000026487 Triploidy Diseases 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 101150055766 cat gene Proteins 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000008014 freezing Effects 0.000 description 2
- 238000007710 freezing Methods 0.000 description 2
- 108020004445 glyceraldehyde-3-phosphate dehydrogenase Proteins 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 241000219195 Arabidopsis thaliana Species 0.000 description 1
- 101100232687 Drosophila melanogaster eIF4A gene Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102100031181 Glyceraldehyde-3-phosphate dehydrogenase Human genes 0.000 description 1
- 241001074116 Miscanthus x giganteus Species 0.000 description 1
- 240000007594 Oryza sativa Species 0.000 description 1
- 235000007164 Oryza sativa Nutrition 0.000 description 1
- 241000209504 Poaceae Species 0.000 description 1
- 230000036579 abiotic stress Effects 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 239000003963 antioxidant agent Substances 0.000 description 1
- 230000003078 antioxidant effect Effects 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 230000008645 cold stress Effects 0.000 description 1
- 238000002485 combustion reaction Methods 0.000 description 1
- 239000002131 composite material Substances 0.000 description 1
- 230000000249 desinfective effect Effects 0.000 description 1
- 230000024346 drought recovery Effects 0.000 description 1
- -1 eIF4a Proteins 0.000 description 1
- 230000001094 effect on targets Effects 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 239000004459 forage Substances 0.000 description 1
- 102000034356 gene-regulatory proteins Human genes 0.000 description 1
- 108091006104 gene-regulatory proteins Proteins 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 229910001385 heavy metal Inorganic materials 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000037353 metabolic pathway Effects 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 230000004792 oxidative damage Effects 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 230000037361 pathway Effects 0.000 description 1
- 230000035479 physiological effects, processes and functions Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000005067 remediation Methods 0.000 description 1
- 235000009566 rice Nutrition 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 230000010473 stable expression Effects 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an internal reference gene developed based on a miscanthus transcriptome sequence and application thereof. The 3 internal reference gene sequences are derived from miscanthus sinensis transcriptome sequences, have the advantages of good specificity, high stability and the like compared with the prior universal internal reference genes on other species, and simultaneously, through the expression analysis research of SOD and CAT genes under the drought stress of miscanthus, the three developed internal reference genes have better correction capability compared with other universal internal reference genes, thereby providing an effective internal reference gene correction tool for the expression analysis, screening and verification work of the miscanthus sinensis genes in the future. In addition, the newly developed reference gene enriches the available number of the reference gene in plants and related research applied to other sorghum and miscanthus plants. Is suitable for popularization and application in the field of internal reference genes.
Description
Technical Field
The invention belongs to the field of reference genes, and particularly relates to a reference gene developed based on a miscanthus transcriptome sequence and application thereof.
Background
Miscanthus sinensis (Miscanthus sinensis) is a perennial rooting stem type C4 plant of Gramineae, and is widely used as a high-quality forage grass, a landscape plant ornamental grass, a water and soil conservation and heavy metal pollution remediation plant. The common biomass of the miscanthus plants is high in yield and good in combustion quality, and the miscanthus plants are wide in distribution and strong in stress resistance, are suitable for being planted on the wide marginal land, and are considered to be one of sustainable biological energy crops with great potential. At present, the mango plant which is most widely applied worldwide is triploid miracle (Miscanthus x giganteus), which is formed by crossing diploid mango and tetraploid silvergrass, and although the mango and the tetraploid silvergrass have high biomass yield, the mango and the tetraploid silvergrass may have high risk to improve the quality and the stress resistance of the mango through breeding due to the narrow genetic basis and the sterile property of the triploid. As one of parent species, the miscanthus is widely distributed in the eastern part of Asia, is spread in mountainous regions, hills and barren slopes and fields below the altitude of 1800m in China, and has the biomass yield comparable to that of Qigang and better stress resistance.
With global climate change, extreme temperatures frequently occur, and the rainfall is unevenly distributed, so that drought becomes an abiotic stress factor which seriously affects the growth, development and even survival of plants. Plant drought tolerance is a complex quantitative trait consisting of multiple gene-regulated combinations including multiple metabolic pathways, regulatory networks and cells. At present, many drought-resistant related genes are reported in model plants, for example 299 drought-caused genes are determined in arabidopsis thaliana, and mainly act on functional proteins and regulatory proteins. In rice, 73 genes were identified to be caused by drought, high salt and cold stress. In the study on drought in miscanthus, although people have made more studies on the growth, physiology and other aspects of different miscanthus materials, the molecular mechanism of response of miscanthus to drought stress is still in the initial stage. Nie, etc. although it is detected by transcriptome sequencing technology that 5324 up-regulated differentially expressed genes are related to mango drought stress response and corresponding regulatory pathways are found, the subsequent papers also need a large amount of gene screening and verification work.
Real-time fluorescent quantitative PCR (qRT-PCR) is a nucleic acid quantitative technology developed based on a common PCR qualitative technology, has the advantages of strong identification specificity, high reaction sensitivity, good repeatability and the like, and becomes one of the most common technologies for researching gene expression, screening and verifying in molecular biology. In the analysis of the expression of an internal reference gene, in order to obtain data with high accuracy, an internal reference gene with stable expression needs to be screened as a standard. Common reference genes are expressed differently under different species, plant tissues, growth environments and other conditions, and none of the reference genes can be stably expressed under all conditions, so that the determination of the expression condition of the reference genes under different conditions is particularly important. At present, the development and verification of related reference genes on miscanthus research are not found, and the process of subsequent gene screening and verification research is severely restricted. Therefore, as a tool gene, the gene has important theoretical and practical values on development, screening and verification of the reference gene in the miscanthus.
Disclosure of Invention
The invention aims to solve the technical problem of providing an internal reference gene developed based on a miscanthus transcriptome sequence, wherein the internal reference gene provides an effective internal reference gene correction tool for the expression analysis, screening and verification work of the miscanthus genes.
The technical scheme adopted by the invention for solving the technical problems is as follows: the reference gene developed based on the miscanthus transcriptome sequence comprises the following three genes: the cDNA SEQUENCE of the Unigene33312 is shown in a SEQUENCE table SEQ ID NO.1, the cDNA SEQUENCE of the Unigene33024 is shown in a SEQUENCE table SEQ ID NO.2, and the cDNA SEQUENCE of the Unigene26576 is shown in a SEQUENCE table SEQ ID NO. 3.
The invention also discloses application of the reference gene developed based on the miscanthus sinensis transcriptome sequence in gene analysis after the miscanthus sinensis drought stress.
The invention also provides a gene analysis method of the reference gene developed based on the miscanthus sinensis transcriptome sequence after the drought stress of the miscanthus sinensis, which comprises the following steps:
1) and material selection: selecting miscanthus sinensis seeds, sterilizing the selected seeds with 75% alcohol and 1% sodium hypochlorite, germinating the seeds in a culture dish, transplanting the seeds into an incubator, pouring 1 time of Hoagland nutrient solution into the incubator for sand culture, wherein the day and night temperature of the sand culture treatment is 28 ℃ and 25 ℃, the day and night are respectively circulated for 12 hours in sequence, the relative humidity is 75%, the illumination intensity is 250 umol.m < -2 >. s < -1 >, and the seeds are cultured for three months; selecting healthy plants with similar growth vigor for drought treatment, wherein the drought treatment mode is that 20% PEG 6000 is adopted to simulate the drought treatment for 6 days, the leaves are respectively sampled in 0, 1, 3 and 6 days after the drought treatment, the samples are quickly frozen by liquid nitrogen after being sampled, and the samples are placed in a refrigerator at the temperature of minus 80 ℃ for RNA extraction;
2) and extracting total RNA of miscanthus: using Direct-zolTMExtracting total RNA by using an RNA MiniPrep kit, detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and performing purity detection and concentration quantification on the extracted RNA by using NanoDrop 2000;
3) and synthesizing cDNA; synthesizing cDNA of qualified samples by adopting an iScript cDNASynthesis Kit (Bio-Rad Laboratories Inc.), and storing at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:
first, 20. mu.L of a reverse transcription reaction solution was prepared in a microtube in total, and the reaction process was as follows: the reaction was carried out at 25 ℃ for 5min, at 46 ℃ for 20min, at 95 ℃ for 1min and then at 4 ℃. The reverse transcription reaction liquid system is shown in table 1:
TABLE 1 reverse transcription reaction solution table
4) qRT-PCR reaction of target gene and reference gene:
using SsoAdvanced TM Universal
Green Supermix (Bio-Rad Laboratories Inc., Hercules, Calif., USA) for qRTPCR, in which the reference gene and the target gene are spotted on the same PCR plate and the reaction is carried out on a CFX96TM Real Time System (Bio-Rad) fluorescence quantitative instrument, the PCR reaction System is shown in Table 2:
TABLE 2qRT-PCR reaction systems Table
The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 35 cycles, then performing dissolution curve analysis at 65-95 ℃, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain a melting temperature, collecting a dissolution curve fluorescence signal, and automatically reading Ct value data by a real-time fluorescence quantitative PCR instrument (Bio-Rad, USA);
5) the Ct value obtained was defined as 2-△△CtThe method calculates the relative expression quantity, and comprises the following specific steps:
Δ Ct (target gene) -Ct (reference gene)
Δ Ct ═ Δ Ct (treatment) - Δct (control)
2-△△CtRelative expression amount.
The invention has the beneficial effects that: the 3 internal reference gene sequences are all derived from miscanthus sequences, have the advantages of good specificity, high stability and the like compared with the prior universal internal reference genes on other species, and meanwhile, through the expression analysis research of SOD and CAT genes under the drought stress of miscanthus, the three internal reference genes have better correction capability compared with other universal internal reference genes, an effective internal reference gene correction tool is provided for the expression analysis, screening and verification work of the miscanthus genes in future.
Drawings
FIG. 1 is an electrophoretogram of amplification of 12 reference genes in example 1;
FIG. 2 shows Ct values of 12 reference genes in all samples in example 1;
FIG. 3 is a melting curve of 12 reference genes in example 1;
FIG. 4 shows the paired variation coefficients (A) and expression stability values M (B) of 12 reference genes calculated by GeNorm software in example 1;
FIG. 5 shows the results of the correction of different reference genes for SOD and CAT gene expression analysis under drought treatment in example 2.
Detailed Description
The present invention will be further described with reference to the following examples.
The reference gene developed based on the miscanthus transcriptome sequence comprises the following three genes: unigene33312, Unigene33024, and Unigene 26576;
the cDNA sequence of the Unigene33312 reference gene is shown below:
TAAGCCATTCAAGGGAATTCATTTCTTAAATATCAGCGAGTCATGCTAAACTTGGTTCAACTTTGTTCAACAAGGATTTGATATGAACCTTGCTTTCTGCAATCAAGAGAAGCAGAGAAATGAGGGGAGTTCCGTGGAGTCATCACAATGGAGAAACATCAAGCAGCATGTGCTACCTTATGGTTCTTCGAGGCCACTCACACGAAAGCTTTCATTTGATGCCTCCTCAAGTGAATCAAGAGGCACAGAAGCCTCAACAAGTATGTCAACAGAGAACACCTCTGTGTCCATCAATGTCCCAAAGTTGGCAGAGGGCATTGAATTTGGGAGGCAACCAATGGTCACATCCTCCACTTTGGTAGAACTAACAACTAGACTAGATTTCTTCAAGGAGCGAAGGTCGCAACTGATGGAACAACTTCATAGTCTTGATTTAGGACGTGGATCTGCTCCTCAGGGTTTTCCATACAAGCCACCATCTCCTTGGAACCACCCAAGGTAGGATGACCATTCAATTTCATGATTGTAAATTCTTCAGTAGGGTTCTTTTCTCCCCGCCTGGCAATTGTAGAAAACTGCGTATGCGAGTGTAAATGTATTTTGTTTTTTTTTTCAATATGGTTTAGCTTTCATGTTGCGCGAGAATAGCTCCTCAAGTGGGATGTGATCAAGTCTTCTGTATGTAATGTTGTCATGGTGGTGCCCTTTAGACAAGTTTTCCAGTGTTGTGGCGGTGTATATGTATTTTGTGCGTTTTCTCATAGAAATTGGATAGGTTGACTACTTGTATGGCCGTTTATTCATACCTAGCGCAAAGGATGAGGAAAACAGGGATCAAATGAGAACCCAGCATGAGTTTATAAATAATTCGAGGTAGGCTTGAGGCTGTGTTTTATCCTTGCAAATTAGTG
the cDNA sequence of the Unigene33024 reference gene is shown below:
TGCACACAACCATGTCGATCATTCATCACACATAGAGTAGCCGAAGTCACATCTCAACTTGGTCTCTCAATAGGCATCTGTATACATTTCTATTTATATATACACTGGGCACAGTACAACATTTATTAATTCAATTATCTTTGTCAGTTTAAGGATGACCACCTAATTTATGCTGACAACATTCAGAGCACTGCGGTACACCAGACCCAACACCCGTTTGGTTCCACATCAAAACAGGGAGTCAAGATACGAGTAGTTGCACAGGCGGTCGAACTGAAGCAGGCTGCCATACATCCTATCCCACACACCAACGAAAAGTGTGTCAGTGTCTGGGCTGAACGACGTGCCGGATATCTCGCCAAAGAAGTCCAGCTCCTGCCTTTTGTTGTAGTCACTCTTCACATCGTAGATGTGCACAAAGTCAGCAGGTTCGGCCATGGACATGAACTGGCCATCCGAGGTGAAGCGGATCGACCTGATGGCTCCAAGGTTACCCCTCAACACATGGACGGATTTTGAGAGATTCCTCACGTCCCAGATTCGGCATGTCTTGTCTTGGTTGCCAGTAGCAAATGTTCGCCCGTCAGGGCTCCAAGCCGATGCAAATGAATAATCCCGATGTCCTTTTATGGAATGAAGCGTCTTTCCAGAGTTGGCATCAATAAGTAGACCATCAGGATCATCCCCCACAATAACAACTACCTTTCTGTCAGGACTCAACGAAGTATGCTGCATCAACAAACTACAAGTAAACACAGATACAGCAACAAAAATAATGAAGAATTGCACTAAACTTGACCTACTCCCTTCATTCCAAATTATAGCTCACTTTATCTTTGTTCTAAGCCAGGCTTCTTTAACTTTTGACCAAGTTTTCTAGAAAAAATGCACCAACATTTACAACATCAAATCAGTCTCATTAAATTTTCATGAAATATGTCTTGATGGTGCATTTATTTGAACTTTACTTTGGAGAAAAAAGAACTTATTTGTGAAATTCATACAGATGTTGGACCCATTTATCCTCTACATTATGTTAGAAAAGGTGACAAGGAAGAGGGAAGCTAAGGATGCCATGTCCAGAATGACCAGGTATATTGAAGGGTGCCAGCAGTGCATGTCACTTTTCTTTTATTATTAATACTGTATCCAGAAGATGGGAGCCTACTATGTCATCAACTGCGGCAATAGAAATGTAAAGGCATTTTGGATTTGTTCCACAAACCAAGTATAGGTTTATGTATCGGTATTGCTAGATTCACCAACAGCTATAACCAATAGGTCAAAAACATGCCCAAGAAAGTAGAACAAGCTAATAATACAAGCACAACTATGGGGCATATGAAATAGCAATGAAGTCTGTATTCTGTAAATTTTATTTGCTGACAGCATGTGTAGAAAGATGTACCTTGTAATGATAGCACCAACAAGAAGATCCAAATATAGAACATAAAGGTAATAGAAATAGCTAAGAAACCAAAGGAACCTACATTCACTGGC CATTCAAACTGAAA
the cDNA sequence of the Unigene26576 reference gene is shown below:
CCCACGTTTGCTCAGGTCCACTCGGAACAGATACCAGCAAACGACATCTCTCCCCGACGTCCCCGTCCCTTTCACCCCTCGCCGCCGTCGTCGCCGCCGCGCTCGTATCTGCGGCTCCCCGCGCCGTATCCTGCGGAAGAAGTGTTTAACGGGCTACATCCCACCACTGCACGATGTCGGCAGCGGCGCGGGTGCTGCCGAAGGCGGTGACCTTCGTGACGGGCAACGCCAAGAAGCTGGAGGAGGTCCGCGCCATCCTCGGCTCTTCCATCCCCTTCCAGTCGCTGAAGCTCGACCTGCCAGAACTGCAAGGGGAGCCAGAGGACATATCCAAAGAGAAAGCACGAATGGCTGCATCTCAGGTGAATGGGCCTGTACTGGTGGAGGACACCTGCCTATGTTTTAATGCACTCAAAGGCCTACCAGGACCCTACATAAAGTGGTTTCTTGAGAAGATTGGGCATGAAGGTCTGAACAATCTGTTAAAAGCTTACGAAGATAAATCAGCGTTTGCAATGTGCATCTTTTCTCTTGCTCTTGGACCTGGAGAGGAACCAATCACATTTGTTGGAAAAACTGCGGGAAAGATTGTACCTGCTAGAGGTCCTAATGATTTTGGATGGGATCCTGTATTCCAGCCAGTTGGTTTTGAACAAACATATGCTGAGATGCCCAAGTCAGTGAAGAATGAAATATCTCAGAGGGAAAGCTCTTGCTCTGGTGAAAGAACACTTTGCATCTGCTAGCTATACAGTTCAGAGCGATGACTCAGCTTAAGTTTGACTTTGGTTCCCAGACGAATGAACGTCACATTCTGGAATGTAAACTGAACTAGTTTTAGTGGATACTGTGGTCTACTGTTAAGTTTATTCATAGCTGTACTATAGTTTGTTTGATTGTAATATACTTGGTGCCTATTATCAACTTACGATATTTCTTCACTGGATCAA TGACACCT
the 3 internal reference gene sequences are all derived from miscanthus sequences, have the advantages of good specificity, high stability and the like compared with the prior universal internal reference genes on other species, and meanwhile, through the expression analysis research of SOD and CAT genes under the drought stress of miscanthus, the three internal reference genes have better correction capability compared with other universal internal reference genes, an effective internal reference gene correction tool is provided for the expression analysis, screening and verification work of the miscanthus genes in future.
The invention also discloses application of the reference gene developed based on the miscanthus sinensis transcriptome sequence in gene analysis after the miscanthus sinensis drought stress.
The invention also provides a gene analysis method of the reference gene developed based on the miscanthus sinensis transcriptome sequence after the drought stress of the miscanthus sinensis, which comprises the following steps:
1) and material selection: selecting miscanthus sinensis seeds, sterilizing the selected seeds with 75% alcohol and 1% sodium hypochlorite, germinating the seeds in a culture dish, transplanting the seeds into an incubator, pouring 1 time of Hoagland nutrient solution into the incubator for sand culture, wherein the day and night temperature of the sand culture treatment is 28 ℃ and 25 ℃, the day and night are respectively circulated for 12 hours in sequence, the relative humidity is 75%, the illumination intensity is 250 umol.m < -2 >. s < -1 >, and the seeds are cultured for three months; selecting healthy plants with similar growth vigor for drought treatment, wherein the drought treatment mode is that 20% PEG 6000 is adopted to simulate the drought treatment for 6 days, the leaves are respectively sampled in 0, 1, 3 and 6 days after the drought treatment, the samples are quickly frozen by liquid nitrogen after being sampled, and the samples are placed in a refrigerator at the temperature of minus 80 ℃ for RNA extraction;
2) and extracting total RNA of miscanthus: using Direct-zolTMExtracting total RNA by using an RNA MiniPrep kit, detecting the integrity of the RNA by using 1% agarose gel electrophoresis, and performing purity detection and concentration quantification on the extracted RNA by using NanoDrop 2000;
3) and synthesizing cDNA; synthesizing cDNA of qualified samples by adopting an iScript cDNA Synthesis Kit (Bio-Rad Laboratories Inc.), and storing at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:
first, 20. mu.L of a reverse transcription reaction solution was prepared in a microtube in total, and the reaction process was as follows: the reaction was carried out at 25 ℃ for 5min, then at 46 ℃ for 20min, then at 95 ℃ for 1min, and then maintained at 4 ℃. The reverse transcription reaction liquid system is shown in table 1:
TABLE 1 reverse transcription reaction solution table
4) qRT-PCR reaction of target gene and reference gene:
using SsoAdvanced TM Universal
Green Supermix (Bio-Rad Laboratories Inc., Hercules, Calif., USA) was subjected to qRT-PCR, in which the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on a CFX96TM Real Time System (Bio-Rad) fluorescence quantifier, and the PCR reaction System is shown in Table 2:
TABLE 2qRT-PCR reaction systems Table
The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 35 cycles, then performing dissolution curve analysis at 65-95 ℃, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain a melting temperature, collecting a dissolution curve fluorescence signal, and automatically reading Ct value data by a real-time fluorescence quantitative PCR instrument (Bio-Rad, USA);
5) the Ct value obtained was defined as 2-△△CtThe method calculates the relative expression quantity, and comprises the following specific steps:
Δ Ct (target gene) -Ct (reference gene)
Δ Ct ═ Δ Ct (treatment) - Δct (control)
2-△△CtRelative expression amount.
Example 1
In this example, three reference genes developed based on a miscanthus transcriptome sequence according to the present invention were compared and applied to nine conventional reference genes in the gene analysis after the drought stress of miscanthus, and for comparing the effects of developing new reference genes, the following seven commonly used conventional reference genes GAPDH, 18S rRNA, ACTIN, PP2A, eIF4a, SAMS, SAMDC and two related species sorghum reference genes Sb09g019750 and Sb02g041180 were selected as controls. Sequence information of common internal reference genes comes from NCBI database, primers are designed on line by using primer3.0 after homologous gene sequence comparison, and relevant information of the primers is shown in Table 4.
The method specifically comprises the following steps:
1) and material selection: selecting Chinese silvergrass seeds, and disinfecting the selected seeds with 75% alcohol and 1% sodium hypochlorite. The experimental seeds are transplanted into a plastic basin (the diameter is 9cm) for sand culture after sprouting in a culture dish, 1 time of Hoagland nutrient solution is poured into the plastic basin for culture in an incubator, the day and night temperature is 28 ℃/25 ℃, the culture is carried out for 12 hours respectively, the relative humidity is 75 percent, the illumination intensity is 250 umol.m < -2 >. s < -1 >, and the culture is carried out for three months; selecting healthy plants with similar growth vigor for drought treatment, simulating the drought treatment for 6 days by using 20% PEG 6000, respectively sampling leaves in 0, 1, 3 and 6 days after the drought treatment, taking samples in 0 day as a control, quickly freezing the samples by using liquid nitrogen after the samples are sampled, and placing the samples in a refrigerator at the temperature of minus 80 ℃ for RNA extraction;
2) and extracting total RNA of miscanthus: using Direct-zolTMRNAMINiPrep kit extractionTotal RNA, detecting the integrity of the RNA by electrophoresis of 1% agarose gel, and detecting the purity and quantifying the concentration of the extracted RNA by using NanoDrop 2000;
3) and synthesizing cDNA; qualified samples were used to synthesize cDNA using the iScript cDNASynthesis Kit (Bio-Rad Laboratories Inc.) and stored at-20 ℃ until use. The method comprises the following specific steps:
first, 20. mu.L of a reverse transcription reaction solution was prepared in a microtube in total, and the reaction process was as follows: the reaction was carried out at 25 ℃ for 5min, then at 46 ℃ for 20min, then at 95 ℃ for 1min, and then maintained at 4 ℃. The reverse transcription reaction liquid system is shown in table 1:
TABLE 1 reverse transcription reaction solution table
4) qRT-PCR reaction of target gene and reference gene:
using SsoAdvanced TM Universal
Green Supermix (Bio-Rad Laboratories Inc., Hercules, Calif., USA) was subjected to qRT-PCR, in which the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on a CFX96TM RealTime System (Bio-Rad) fluorescence quantifier, and the PCR reaction System is shown in Table 2:
TABLE 2qRT-PCR reaction systems Table
The primers for the reference gene used in the reaction are shown in Table 4:
TABLE 3qRT-PCR reference Gene primer sequences
The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 35 cycles. Then, performing 65-95 ℃ dissolution curve analysis, increasing the temperature by 0.5 ℃ in each cycle, continuously obtaining the melting temperature for 2-5s, collecting the fluorescence signal of the dissolution curve, automatically reading the Ct value data of the reference gene by a real-time fluorescence quantitative PCR instrument (Bio-Rad, USA), and calculating the amplification efficiency of the primer by using a standard curve;
defining the expression quantity of a sample corresponding to the Ct value of a certain reference gene in different samples as 1 in Microsoft Office Excel 2010, and defining the relative expression quantity of the reference gene in other samples as 2-△Ct(Δ Ct is Ct-minimum Ct value of each sample), according to 12 reference gene data, using 3 software programs of geonorm (ver.3.5), bestkoeper (ver.1.0) and Normfinder (ver.0.953) to analyze the stability of the expression amount of the candidate reference gene, and finally using RefFinder to comprehensively sort the reference genes, as shown in table 4:
TABLE 4 sequencing after comprehensive analysis of reference genes
FIG. 1 is an electrophoretogram of amplification of 12 reference genes, wherein M is DL2000DNA marker, 1 is 18s rRNA, 2 is eIF4A, 3 is SAMDC, 4 is SAMS, 5 is PP2A, 6 is GAPDH, 7 is Sb09g019750, 8 is Sb02g041180, 9 is ACTIN, 10 is Unigene33312, 11 is Unigene33024, and 12 is Unigene 26576; FIG. 2 shows Ct values of 12 reference genes in all samples, where the central line of each box represents the Ct median of each reference, the two ends of the box represent the range of 25% -75% of the data, the upper and lower edges represent the maximum and minimum values, and O represents an abnormal value; FIG. 3 is a melting curve of 12 reference genes; FIG. 4 shows the pairing variation coefficient (A) and expression stability value M (B) of 12 reference genes calculated by GeNorm software;
as can be seen from fig. 1, fig. 2, fig. 3, fig. 4, and table 4, the top three reference genes in the final composite ranking are Unigene33024, Unigene26576, and Unigene33312, respectively. The results show that the newly developed three reference genes have good specificity and high stability, and can be used for related research on miscanthus and other sorghum and miscanthus plants.
Example 2
In this embodiment, in order to verify the effect of the application of the reference gene, two genes, i.e., Cu/Zn SOD and CAT, are selected as target genes, and both SOD and CAT are common antioxidant enzymes in plants, which can help plants to scavenge active oxygen in vivo and protect cells from oxidative damage, and the expression level of the genes is usually increased after being stressed. Taking Unigene33312 and common reference gene ACTIN as examples to analyze the expression characteristics of mango SOD and CAT genes after drought stress, the specific steps are as follows:
1) and material selection: seeds of miscanthus (two varieties: 0819 and 1302) are selected and sterilized with 75% alcohol and 1% sodium hypochlorite. The experimental seeds are transplanted into a plastic basin (the diameter is 9cm) for sand culture after sprouting in a culture dish, 1 time of Hoagland nutrient solution is poured into the plastic basin for culture in an incubator, the day and night temperature is 28 ℃/25 ℃, the culture is carried out for 12 hours respectively, the relative humidity is 75 percent, the illumination intensity is 250 umol.m < -2 >. s < -1 >, and the culture is carried out for three months; and (4) selecting healthy plants with similar growth vigor for drought treatment. Simulating drought treatment with 20% PEG 6000 for 6 days, sampling leaves at 0, 1, 3 and 6 days after treatment, taking the sample at 0 day as a control, quickly freezing the sample with liquid nitrogen, and placing the sample in a refrigerator at-80 ℃ for RNA extraction;
2) and extracting total RNA of miscanthus: using Direct-zolTMThe RNA MiniPrep kit extracts total RNA, performs electrophoresis on 1% agarose gel to detect the integrity of the RNA, and performs purity detection and concentration quantification on the extracted RNA by using NanoDrop 2000.
3) And synthesizing cDNA; qualified samples were synthesized into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories Inc.) and stored at-20 ℃ until use. The method comprises the following specific steps:
first, 20. mu.L of reverse transcription reaction solution was prepared in a microtube, and the reaction process was as follows: the reaction was carried out at 25 ℃ for 5min, then at 46 ℃ for 20min, then at 95 ℃ for 1min, and then maintained at 4 ℃. The reverse transcription reaction liquid system is shown in table 1:
TABLE 1 reverse transcription reaction solution table
4) qRT-PCR reaction of target gene and reference gene:
using SsoAdvanced TM Universal
Green Supermix (Bio-Rad Laboratories Inc., Hercules, Calif., USA) was subjected to qRT-PCR, in which the reference gene and the target gene were spotted on the same PCR plate, and the reaction was performed on a CFX96TM Real Time System (Bio-Rad) fluorescence quantifier, and the PCR reaction System is shown in Table 2:
TABLE 2qRT-PCR reaction systems Table
The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, 35 cycles, then performing dissolution curve analysis at 65-95 ℃, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain a melting temperature, collecting a dissolution curve fluorescence signal, and automatically reading Ct value data by a real-time fluorescence quantitative PCR instrument (Bio-Rad, USA); wherein, the SOD and CAT quantitative PCR primers are shown in the table 5;
TABLE 5 amplification information of target Gene primers
After obtaining Ct values, 2 was used in Microsoft Office Excel 2010-△△CtThe method calculates the relative expression quantity, and comprises the following specific steps:
Δ Ct (target gene) -Ct (reference gene)
Δ Ct ═ Δ Ct (treatment) - Δct (control)
2-△△CtRelative expression amount
FIG. 5 shows the results of correcting different internal reference genes for SOD and CAT gene expression analysis under drought treatment, and it can be seen from FIG. 5 that the internal reference genes developed by the present invention have better effect on target gene expression analysis compared with the common internal reference ACTIN, clearly showing the expression change conditions of the target genes SOD and CAT after 1, 3 and 6 days of drought treatment; when the gene is used alone, the test operation is simple and convenient, the cost is reduced, the gene can be combined with other internal reference genes for correction, and as can be seen from figure 5, the Unigene33312 can be used as the most economical and effective internal reference gene selection on miscanthus and homologous species.
In conclusion, the 3 internal reference gene sequences are derived from miscanthus sinensis transcriptome sequences, and have the advantages of good specificity, high stability and the like compared with the conventional universal internal reference genes on other species, and meanwhile, the three developed internal reference genes have better correction capability compared with other universal internal reference genes through the expression analysis research of SOD and CAT genes under the drought stress of miscanthus sinensis, so that an effective internal reference gene correction tool is provided for the expression analysis, screening and verification work of the miscanthus sinensis genes in the future. In addition, the newly developed reference gene enriches the available number of the reference gene in plants and related research applied to other sorghum and miscanthus plants.
Sequence listing
<110> Sichuan university of agriculture
<120> reference gene developed based on miscanthus transcriptome sequence and application thereof
<130> 2019
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 911
<212> DNA
<213> Artificial sequence (regongxulie)
<400> 1
taagccattc aagggaattc atttcttaaa tatcagcgag tcatgctaaa cttggttcaa 60
ctttgttcaa caaggatttg atatgaacct tgctttctgc aatcaagaga agcagagaaa 120
tgaggggagt tccgtggagt catcacaatg gagaaacatc aagcagcatg tgctacctta 180
tggttcttcg aggccactca cacgaaagct ttcatttgat gcctcctcaa gtgaatcaag 240
aggcacagaa gcctcaacaa gtatgtcaac agagaacacc tctgtgtcca tcaatgtccc 300
aaagttggca gagggcattg aatttgggag gcaaccaatg gtcacatcct ccactttggt 360
agaactaaca actagactag atttcttcaa ggagcgaagg tcgcaactga tggaacaact 420
tcatagtctt gatttaggac gtggatctgc tcctcagggt tttccataca agccaccatc 480
tccttggaac cacccaaggt aggatgacca ttcaatttca tgattgtaaa ttcttcagta 540
gggttctttt ctccccgcct ggcaattgta gaaaactgcg tatgcgagtg taaatgtatt 600
ttgttttttt tttcaatatg gtttagcttt catgttgcgc gagaatagct cctcaagtgg 660
gatgtgatca agtcttctgt atgtaatgtt gtcatggtgg tgccctttag acaagttttc 720
cagtgttgtg gcggtgtata tgtattttgt gcgttttctc atagaaattg gataggttga 780
ctacttgtat ggccgtttat tcatacctag cgcaaaggat gaggaaaaca gggatcaaat 840
gagaacccag catgagttta taaataattc gaggtaggct tgaggctgtg ttttatcctt 900
gcaaattagt g 911
<210> 2
<211> 1514
<212> DNA
<213> Artificial sequence (regongxulie)
<400> 2
tgcacacaac catgtcgatc attcatcaca catagagtag ccgaagtcac atctcaactt 60
ggtctctcaa taggcatctg tatacatttc tatttatata tacactgggc acagtacaac 120
atttattaat tcaattatct ttgtcagttt aaggatgacc acctaattta tgctgacaac 180
attcagagca ctgcggtaca ccagacccaa cacccgtttg gttccacatc aaaacaggga 240
gtcaagatac gagtagttgc acaggcggtc gaactgaagc aggctgccat acatcctatc 300
ccacacacca acgaaaagtg tgtcagtgtc tgggctgaac gacgtgccgg atatctcgcc 360
aaagaagtcc agctcctgcc ttttgttgta gtcactcttc acatcgtaga tgtgcacaaa 420
gtcagcaggt tcggccatgg acatgaactg gccatccgag gtgaagcgga tcgacctgat 480
ggctccaagg ttacccctca acacatggac ggattttgag agattcctca cgtcccagat 540
tcggcatgtc ttgtcttggt tgccagtagc aaatgttcgc ccgtcagggc tccaagccga 600
tgcaaatgaa taatcccgat gtccttttat ggaatgaagc gtctttccag agttggcatc 660
aataagtaga ccatcaggat catcccccac aataacaact acctttctgt caggactcaa 720
cgaagtatgc tgcatcaaca aactacaagt aaacacagat acagcaacaa aaataatgaa 780
gaattgcact aaacttgacc tactcccttc attccaaatt atagctcact ttatctttgt 840
tctaagccag gcttctttaa cttttgacca agttttctag aaaaaatgca ccaacattta 900
caacatcaaa tcagtctcat taaattttca tgaaatatgt cttgatggtg catttatttg 960
aactttactt tggagaaaaa agaacttatt tgtgaaattc atacagatgt tggacccatt 1020
tatcctctac attatgttag aaaaggtgac aaggaagagg gaagctaagg atgccatgtc 1080
cagaatgacc aggtatattg aagggtgcca gcagtgcatg tcacttttct tttattatta 1140
atactgtatc cagaagatgg gagcctacta tgtcatcaac tgcggcaata gaaatgtaaa 1200
ggcattttgg atttgttcca caaaccaagt ataggtttat gtatcggtat tgctagattc 1260
accaacagct ataaccaata ggtcaaaaac atgcccaaga aagtagaaca agctaataat 1320
acaagcacaa ctatggggca tatgaaatag caatgaagtc tgtattctgt aaattttatt 1380
tgctgacagc atgtgtagaa agatgtacct tgtaatgata gcaccaacaa gaagatccaa 1440
atatagaaca taaaggtaat agaaatagct aagaaaccaa aggaacctac attcactggc 1500
cattcaaact gaaa 1514
<210> 3
<211> 958
<212> DNA
<213> Artificial sequence (regongxulie)
<400> 3
cccacgtttg ctcaggtcca ctcggaacag ataccagcaa acgacatctc tccccgacgt 60
ccccgtccct ttcacccctc gccgccgtcg tcgccgccgc gctcgtatct gcggctcccc 120
gcgccgtatc ctgcggaaga agtgtttaac gggctacatc ccaccactgc acgatgtcgg 180
cagcggcgcg ggtgctgccg aaggcggtga ccttcgtgac gggcaacgcc aagaagctgg 240
aggaggtccg cgccatcctc ggctcttcca tccccttcca gtcgctgaag ctcgacctgc 300
cagaactgca aggggagcca gaggacatat ccaaagagaa agcacgaatg gctgcatctc 360
aggtgaatgg gcctgtactg gtggaggaca cctgcctatg ttttaatgca ctcaaaggcc 420
taccaggacc ctacataaag tggtttcttg agaagattgg gcatgaaggt ctgaacaatc 480
tgttaaaagc ttacgaagat aaatcagcgt ttgcaatgtg catcttttct cttgctcttg 540
gacctggaga ggaaccaatc acatttgttg gaaaaactgc gggaaagatt gtacctgcta 600
gaggtcctaa tgattttgga tgggatcctg tattccagcc agttggtttt gaacaaacat 660
atgctgagat gcccaagtca gtgaagaatg aaatatctca gagggaaagc tcttgctctg 720
gtgaaagaac actttgcatc tgctagctat acagttcaga gcgatgactc agcttaagtt 780
tgactttggt tcccagacga atgaacgtca cattctggaa tgtaaactga actagtttta 840
gtggatactg tggtctactg ttaagtttat tcatagctgt actatagttt gtttgattgt 900
aatatacttg gtgcctatta tcaacttacg atatttcttc actggatcaa tgacacct 958
Claims (3)
1. An internal reference gene developed based on a miscanthus transcriptome sequence is characterized in that: the reference genes comprise the following two genes: the cDNA SEQUENCE of the Unigene33312 is shown in a SEQUENCE table SEQUENCE ID NO.1, and the cDNA SEQUENCE of the Unigene33024 reference gene is shown in a SEQUENCE table SEQUENCE ID NO. 2.
2. The use of the reference gene developed based on the miscanthus sinensis transcriptome sequence of claim 1 in gene analysis after miscanthus sinensis drought stress.
3. The method for analyzing the gene of the reference gene developed based on the miscanthus sinensis transcriptome sequence in the claim 1 after the miscanthus sinensis drought stress comprises the following steps:
1) and material selection: selecting miscanthus sinensis seeds, sterilizing the selected seeds with 75% alcohol and 1% sodium hypochlorite, germinating the seeds in a culture dish, transplanting the seeds into an incubator, pouring 1 time of Hoagland nutrient solution into the incubator for sand culture, wherein the day and night temperature of the sand culture treatment is 28 ℃ and 25 ℃, the day and night are respectively circulated for 12 hours in sequence, the relative humidity is 75%, the illumination intensity is 250 umol.m < -2 >. s < -1 >, and the seeds are cultured for three months; selecting healthy plants with similar growth vigor for drought treatment, wherein the drought treatment mode is that 20% PEG 6000 is adopted to simulate the drought treatment for 6 days, the leaves are respectively sampled in 0, 1, 3 and 6 days after the drought treatment, the samples are quickly frozen by liquid nitrogen after being sampled, and the samples are placed in a refrigerator at the temperature of minus 80 ℃ for RNA extraction;
2) and extracting total RNA of miscanthus: using Direct-zolTMTotal RNA is extracted by an RNA MiniPrep kit, and the RNA is detected by 1 percent agarose gel electrophoresisAnd the purity detection and concentration quantification of the extracted RNA were performed using NanoDrop 2000;
3) and synthesizing cDNA; synthesizing cDNA of qualified samples by adopting an iScript cDNA Synthesis Kit, and storing at-20 ℃ for later use; the specific steps for cDNA synthesis are as follows:
first, 20. mu.L of a reverse transcription reaction solution was prepared in a microtube in total, and the reaction process was as follows: the reaction solution system of the reverse transcription is shown in Table 1, wherein the reaction is carried out at 25 ℃ for 5min, then at 46 ℃ for 20min, then at 95 ℃ for 1min, and then at 4 ℃:
TABLE 1 reverse transcription reaction solution table
4) qRT-PCR reaction of target gene and reference gene:
using SsoAdvanced TM Universal
Green Supermix carries out qRT-PCR, internal reference genes and target genes are spotted on the same PCR plate, the reaction is carried out on a CFX96TM Real Time System fluorescence quantifier, and the PCR reaction System is shown in Table 2:
TABLE 2qRT-PCR reaction systems Table
The amplification procedure was: pre-denaturation at 95 ℃ for 30 s; performing denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, performing 35 cycles, performing dissolution curve analysis at 65-95 ℃, increasing the temperature by 0.5 ℃ in each cycle, continuing for 2-5s to obtain a melting temperature, collecting a fluorescence signal of the dissolution curve, and automatically reading Ct value data by a real-time fluorescence quantitative PCR instrument;
5) using the Ct value obtained
The method calculates the relative expression quantity, and comprises the following specific steps:
Δ Ct (target gene) -Ct (reference gene)
Δ Ct ═ Δ Ct (treatment) - Δct (control)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910095869.1A CN109609685B (en) | 2019-01-31 | 2019-01-31 | Reference gene developed based on miscanthus transcriptome sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910095869.1A CN109609685B (en) | 2019-01-31 | 2019-01-31 | Reference gene developed based on miscanthus transcriptome sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109609685A CN109609685A (en) | 2019-04-12 |
| CN109609685B true CN109609685B (en) | 2020-11-27 |
Family
ID=66018772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910095869.1A Expired - Fee Related CN109609685B (en) | 2019-01-31 | 2019-01-31 | Reference gene developed based on miscanthus transcriptome sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109609685B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641652A (en) * | 2017-10-18 | 2018-01-30 | 上海市松江区中心医院 | Reference gene and its screening technique applied to one group of real-time quantitative PCR relative quantification of hepatocellular carcinoma |
| CN108588191A (en) * | 2018-04-27 | 2018-09-28 | 青海大学农林科学院 | The selection method of reference gene in jerusalem artichoke Real-time PCR Analysis |
-
2019
- 2019-01-31 CN CN201910095869.1A patent/CN109609685B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641652A (en) * | 2017-10-18 | 2018-01-30 | 上海市松江区中心医院 | Reference gene and its screening technique applied to one group of real-time quantitative PCR relative quantification of hepatocellular carcinoma |
| CN108588191A (en) * | 2018-04-27 | 2018-09-28 | 青海大学农林科学院 | The selection method of reference gene in jerusalem artichoke Real-time PCR Analysis |
Non-Patent Citations (3)
| Title |
|---|
| A detailed gene expression study of the Miscanthus genus reveals changes in the transcriptome associated with the rejuvenation of spring rhizomes;Barling, A 等;《BMC GENOMICS》;20131209;第14卷;第1-16页 * |
| Enriching Genomic Resources and Transcriptional Profile Analysis of Miscanthus sinensis under Drought Stress Based on RNA Sequencing;Nie, G等;《INTERNATIONAL JOURNAL OF GENOMICS》;20171231;第2-4页 * |
| Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization;Reddy, PS等;《FRONTIERS IN PLANT SCIENCE》;20160425;第7卷;第2-6页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109609685A (en) | 2019-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Reddy et al. | Physiology and transcriptomics of water-deficit stress responses in wheat cultivars TAM 111 and TAM 112 | |
| Davik et al. | Dehydrin, alcohol dehydrogenase, and central metabolite levels are associated with cold tolerance in diploid strawberry (Fragaria spp.) | |
| Kim et al. | Loss-of-function alleles of heading date 1 (Hd1) are associated with adaptation of temperate japonica rice plants to the tropical region | |
| Sarazin et al. | Water-stressed sunflower transcriptome analysis revealed important molecular markers involved in drought stress response and tolerance | |
| CN102321758A (en) | Method for screening real-time fluorescent quantitative PCR internal reference molecules of desert plant Eremosparton songoricum (Litv.) Vass. | |
| Zhang et al. | Mining and expression analysis of candidate genes involved in regulating the chilling requirement fulfillment of Paeonia lactiflora ‘Hang Baishao’ | |
| Ajeesh Krishna et al. | Genomic-assisted breeding in finger millet (Eleusine Coracana (L.) Gaertn.) for abiotic stress tolerance | |
| Xu et al. | Genome-wide association study on root traits under different growing environments in wheat (Triticum aestivum L.) | |
| CN112981000B (en) | InDel molecular marker related to cotton drought resistance and application thereof | |
| CN109609685B (en) | Reference gene developed based on miscanthus transcriptome sequence and application thereof | |
| CN109504686B (en) | Application of tomato SlCaM6 gene in improving low-temperature resistance | |
| CN109371041B (en) | Rice gene OsHGN for increasing grain number per ear and application thereof | |
| Li et al. | Identification of candidate genes that regulate the trade-off between seedling cold tolerance and fruit quality in melon (Cucumis melo L.) | |
| Yang et al. | Understanding the molecular mechanism of drought resistance in Shanlan upland rice by transcriptome and phenotype analyses | |
| CN108085409B (en) | Screening method of fir reference gene in different tissues and application of screening gene as reference gene | |
| CN113735951B (en) | Application of CLE peptide anti-transpiration agent | |
| CN115044693A (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) internal reference gene of black-drug parabagin and application thereof | |
| Rivai et al. | Examination of the usability of leaf chlorophyll content and gene expression analyses as nitrogen status biomarkers in Sorghum bicolor | |
| Pichler et al. | Relative developmental, environmental, and tree-to-tree variability in buds from field-grown apple trees | |
| CN114196772A (en) | Real-time quantitative PCR reference gene of Tilia miqueliana under different tissues and stress treatment conditions, and screening method and application thereof | |
| CN112501181A (en) | Rice stress resistance related gene OsTZF7 and encoding protein and application thereof | |
| Sandhu et al. | Genomic footprints uncovering abiotic stress tolerance in rice | |
| Peng et al. | DU Xiong-Ming. Transcriptome Analysis of Transcription Factors in Upland Cotton Seedlings under NaCl Stress [J] | |
| CN105001313B (en) | Bermuda grass ' C299 ' dehydrin protein Dehydrin-S and its encoding gene and probe | |
| CN105037515B (en) | Bermuda grass ' C299 ' dehydrin protein Dehydrin-L and its encoding gene and probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201127 |