CN110714018A

CN110714018A - Chimeric antigen receptor targeting EGFRVIII and uses thereof

Info

Publication number: CN110714018A
Application number: CN201810755468.XA
Authority: CN
Inventors: 刘雅容; 金涛
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2018-07-11
Filing date: 2018-07-11
Publication date: 2020-01-21
Anticipated expiration: 2038-07-11
Also published as: CN110714018B

Abstract

The present invention relates to chimeric antigen receptors targeting EGFRVIII and uses thereof. In particular, the invention provides a polynucleotide sequence selected from: (1) a polynucleotide sequence comprising the coding sequence of an anti-EGFRVIII single-chain antibody, the coding sequence of a human CD8 alpha hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 zeta intracellular region which are connected in sequence; and (2) the complement of the polynucleotide sequence of (1). The invention also provides a related fusion protein, a vector containing the coding sequence, and applications of the fusion protein, the coding sequence and the vector.

Description

Chimeric antigen receptor targeting EGFRVIII and uses thereof

Technical Field

The invention belongs to the field of cell therapy, and particularly relates to a chimeric antigen receptor targeting EGFRVIII and application thereof.

Background

Glioblastoma multiforme GBM (gliobastoma multiforme) is the most common brain tumor, and surgical treatment, radiotherapy and adjuvant chemotherapy combined with temozolomide are the main clinical treatment methods, but the clinical treatment effect of the glioblastoma multiforme is not ideal, the median survival period is only within 12 months, and the glioblastoma multiforme is easy to relapse and has poor prognosis. Epidermal growth factor receptor egfr (epidermal growth factor receptor) gene amplification, mutation and rearrangement are closely related to tumor growth, angiogenesis, tumor progression and treatment tolerance.

Epidermal Growth Factor (EGF), the relationship between growth factor and EGFR has been studied with great color since its discovery in 1962. The ErbB family is best understood, and includes the epidermal growth factor receptor (EGFR, also known as ErbB1/HER1), ErbB2 (also known as p185Neu/HER2), ErbB3 and ErbB4 (also known as HER4), all of which are extracellular ligand-binding moieties, transmembrane moieties (which function as information conductors both extracellularly and intracellularly), and intracellular moieties (including both intracellular activating moieties and downstream ligands). Activation of downstream substrates and gene transcription are closely related to cell division, proliferation, cell death, migration, invasion, and the like. These receptors have been shown to be overexpressed, amplified or rearranged in human tumors. Of all mutants, the most common mutant is the epidermal growth factor receptor type iii mutant, which has been shown by EGFRvlII studies to contribute to tumor development and formation. EGFRvlII was first discovered in glioblastoma studies, and due to deletion of exons 2 to 7 by mRNA cleavage or gene rearrangement, the extracellular domain of the EGFRvlII, which binds to the ligand, is deleted 267 amino acids, and a new glycine is generated at the fusion site. The EGFRVIIVlII lacking the extracellular ligand binding region can lead a receptor to be independent of the constitutive activation of tyrosine kinase under the condition of no ligand binding, and activate a plurality of downstream signal transduction pathways, including phosphophosphatidylinositol 3 hydroxykinase (PI3K)/Akt1, Ras, mitogen activated protein kinase and other signal transduction pathways, to cause cascade reaction, promote the proliferation of tumor cells, generate blood vessels, inhibit apoptosis and the like. EGFRvlII can transform the phenotype of tumor cells, and shows that the tumorigenicity and the invasiveness are enhanced. Enhancement of EGFRvlII signaling capacity leads to increased EGFRvlII activity and tumorigenicity, which may be associated with factors such as impaired endocytosis, prolonged signaling time, inefficient ubiquitination, and enhanced receptor dimerization.

Glioblastoma (GBM) is a common recurrent brain tumor, with the abundance of blood vessels and the presence of invasive growth being the major cause. About 30% of patients with glioblastoma have EGFRvIII mutations, which are closely related to their low survival rate, although median survival time is still relatively short after comprehensive treatment with surgery, radiotherapy and chemotherapy. With the continuous progress of science, especially the progress of molecular biology, the treatment mode of glioma is gradually changed from single operation treatment to multi-mode simultaneous treatment such as comprehensive chemotherapy, radiotherapy, molecular targeted therapy and the like. Recently, high specificity, low side effect molecular targeted drug personalized therapy has become a focus of attention. Therefore, the search for the target related to the glioblastoma has extremely important clinical significance for the clinical treatment of the glioblastoma multiforme. The expression rate of EGFRvIII in glioblastoma is high, about 30-40% of patients with glioblastoma have EGFRvIII expression detected, and normal brain tissues are not expressed, so that the EGFRvIII expression rate becomes a very ideal glioblastoma multiforme treatment target. At present, the therapeutic measures taking EGFRvIII as a target point comprise: monoclonal antibodies (e.g., cetuximab and mAb 528); small molecule tyrosine kinase inhibitors; immunotherapy, such as vaccines, etc., has been studied in many laboratories at a preclinical stage. In vitro data show that cetuximab is a specific antibody against EGFRvIII, which specifically binds to EGFRvIII, resulting in a substantial reduction in the activity of EGFRvIII. However, the in vivo experimental results are not ideal, and the survival period of nude mice with high-expression EGFRvIII transplantation tumor is not remarkably increased by cetuximab. Some studies are underway to develop monoclonal antibodies directed against EGFRvIII alone without cross-reactivity to wild-type EGFR, e.g., monoclonal antibody Y10, to improve survival of nude mice with intracranial EGFRvIII transplants. The monoclonal antibody MAb 806 can also be combined with a part of wild-type EGFR for specific inhibition of EGFRvIII, and the MAb 806 shows better effect in the growth of the EGFRvIII glioblastoma transplantation tumor and also has good inhibition effect on the wild-type EGFR, and the inhibition effect is proved to be realized by reducing angiogenesis and improving apoptosis.

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back-infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of studies show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and remarkably improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a key determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

With the continuous development of Chimeric Antigen Receptor T cell (CAR-T) technology, CAR-T can be divided into four generations.

The first generation CAR-T cells consist of an extracellular binding domain-single chain antibody (scFV), a transmembrane domain (TM), and an intracellular signaling domain-Immunoreceptor Tyrosine Activation Motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 ζ. Although some specific cytotoxicity could be seen in the first generation CARs, it was found to be less effective when summarized in 2006 in clinical trials. The reason for this is because the first generation of CAR-T cells are rapidly depleted in the patient and have so poor persistence that CAR-T cells already apoptotic when they have not yet come into contact with a large number of tumor cells can elicit an anti-tumor cytotoxic effect, but rather less cytokine secretion, but their short survival time in vivo fails to elicit a persistent anti-tumor effect [ chieric g2D-modified T cells inhibition system T-cell lymphoma growth in a mannenrinating multiple cytokines and cytotoxic pathways. 11029-.

Optimization of T cell activation signaling regions in CAR design of second generation CAR-T cells remains a hotspot of research. Complete activation of T cells relies on dual signaling and cytokine action. Wherein the first signal is a specific signal initiated by the recognition of an antigen peptide-MHC complex on the surface of an antigen presenting cell by the TCR; the second signal is a co-stimulatory signal. Second generation CARs have appeared as early as 1998 (Finney HM et al, J Immunol.1998; 161 (6): 2791-7). The 2 nd generation CAR adds a costimulatory molecule in the intracellular signal peptide region, namely the costimulatory signal is assembled into the CAR, and can better provide an activation signal for CAR-T cells, so that the CAR can simultaneously activate the costimulatory molecule and the intracellular signal after identifying tumor cells, double activation is realized, and the proliferation and secretion capacity of the T cells and the anti-tumor effect can be obviously improved. The first well-studied T cell costimulatory signal receptor was CD28, which was capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes T cell proliferation, IL-2 synthesis and expression, and enhances T cell resistance to apoptosis. Costimulatory molecules such as CD134(OX40) and 41BB (4-1BB) are subsequently presented to increase cytotoxicity and proliferative activity of T cells, maintain T cell responses, prolong T cell survival, and the like. Such second generation CARs produced unexpected results in subsequent clinical trials, with shaking frequently triggered since 2010 based on clinical reports of second generation CARs, with complete remission rates of up to 90% and above, especially for relapsed, refractory ALL patients.

The third generation CAR signal peptide region is integrated with more than 2 costimulatory molecules, so that the T cells can be continuously activated and proliferated, cytokines can be continuously secreted, and the capability of the T cells in killing tumor cells is more remarkable, namely, the new generation CAR can obtain stronger anti-tumor response. Most typically, U Pen Carl June is added with a 41BB stimulating factor under the action of CD28 stimulating factor.

Fourth generation CAR-T cells are supplemented with cytokines or co-stimulatory ligands, for example fourth generation CARs can produce IL-12, which can modulate the immune microenvironment-increase the activation of T cells, while activating innate immune cells to act to eliminate target antigen negative cancer cells, thus achieving a bi-directional regulatory effect [ chimielewski M, Abken h. the four generation of cars. expert Opin Biol ther. 2015; 15(8): 1145-54 ].

One termEGFRvIII treatment of gliomas for tumor-targeted antigensThe CAR-T I phase clinical trial of the cell tumor showed the safety and primary efficacy of this therapy. To date, this CAR-T immunotherapy has been performed in only 9 patients, and the safety of CART EGFRvIII cells is within acceptable limits for all patients. To date, the number of CART EGFRvIII cells prepared and returned to patients was 1-5x10⁸Range, safe cell infusion, no evidence of tumor off-target toxicity or toxicity cross-reactivity with wild-type EGFR. Detection of patient peripheral blood samples by flow cytometry and quantitative PCR between 7 and 10 days after CAR-T infusion showed significant expansion of CAR-T EGFRvIII cells in all patient blood. Although some patients experienced elevated serum IL-6 when peripheral blood CAR-T EGFRvIII proliferated, no systemic cytokine release syndrome was observed in either clinical or laboratory tests. One patient had non-convulsive seizures after day 9 following CAR-T cell infusion and had complete recovery after conventional anti-epileptic and anti-cytokine therapy. 5 patients underwent tumor resection surgery on days 6-120 after CAR-TEGFRvIII cell infusion, and pathological examination demonstrated active CAR-T cell infiltration and newly-entered T cell infiltration in tumor tissue. The conclusions currently drawn from this clinical trial are mainly: CAR-TEGFRvIII treatment is safe; no side effects of tumor off-target toxicity and cytokine release syndrome; CAR-T cells can retain immune activity; CAR-T EGFRvIII cells were able to track the entry of CAR-T EGFRvIII antigen-positive glioma cells into tumor tissue.

The EGFRVIIII (139) -41BBz CAR-T cell plays a good role in vitro cell experiments. Lays a good foundation for clinical experiments and clinical treatment.

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-EGFRVIII single-chain antibody, the coding sequence of a human CD8 alpha hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 zeta intracellular region which are connected in sequence; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the coding sequence of the signal peptide preceding the coding sequence of the anti-EGFRVIII single chain antibody is represented by the nucleotide sequence at positions 1-63 of SEQ ID No. 1. In one or more embodiments, the coding sequence of the anti-EGFRVIII single chain antibody is shown as nucleotide sequence 64-788 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the human CD8 α hinge region is as shown in the nucleotide sequence at positions 789-929 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the transmembrane region of human CD8 is as shown in the nucleotide sequence at positions 930-995 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the intracellular region of human 41BB is as shown in the nucleotide sequence at positions 996-1139 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the intracellular region of human CD3 ζ is as set forth in nucleotide sequences SEQ ID NO 1, positions 1140 and 1472.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) a coding sequence of a fusion protein comprising an anti-EGFRVIII single-chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region which are sequentially linked; and

(2) a fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

preferably, the anti-EGFRVIII single chain antibody is anti-EGFRVIII monoclonal antibody 139.

In one or more embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 1-21 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the EGFRVIII single chain antibody is as set forth in amino acids 22-262 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 263-309 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is as shown in SEQ ID NO 2 at amino acids 310-331. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 332-379 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in SEQ ID NO 2 at amino acids 380-490.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, a polynucleotide sequence described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell described herein, or a pharmaceutical composition thereof, in the preparation of a medicament for the treatment of an EGFRVIII-mediated disease.

In one or more embodiments, the EGFRVIII-mediated disease is malignant brain glioma.

Drawings

FIG. 1 is a schematic diagram of an EGFRVIII-CAR retroviral expression vector (EGFRVIII-41 BBz). Figure 2 is a flow cytometer showing the EGFRVIII-CAR + expression efficiency of retroviral infected T cells for 72 hours.

FIG. 3 is a graph showing INF- γ secretion by co-culturing EGFRVIII-CART cells prepared for 5 days with target cells for 5 hours.

FIG. 4 is a graph showing the killing effect on tumor cells after preparation of 5-day EGFRVIII-CART cells co-cultured with target cells for 20 hours.

Detailed Description

The present invention provides a Chimeric Antigen Receptor (CAR) targeting EGFRVIII. The CAR comprises fragments of an anti-EGFRVIII single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, a human CD3 ζ intracellular region, linked in sequence.

anti-EGFRVIII single chain antibodies suitable for use in the present invention may be derived from various anti-EGFRVIII monoclonal antibodies known in the art.

Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. In certain embodiments, the monoclonal antibody is the monoclonal antibody having clone number 139. In certain embodiments, the amino acid sequence of the anti-EGFRVIII single chain antibody is as set forth in amino acids 22-262 of SEQ ID NO 2.

The amino acid sequence of the human CD8 alpha hinge region suitable for use in the present invention can be shown as amino acids 263-309 of SEQ ID NO 2.

The human CD8 transmembrane region suitable for use in the present invention can be the various human CD8 transmembrane region sequences commonly used in the art for CARs. In certain embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 310-331 of SEQ ID NO 2.

The 41BB suitable for use in the present invention can be any of the various 41 BBs known in the art for use in CARs. As an illustrative example, the present invention uses 41BB shown by the amino acid sequences in positions 332-379 of SEQ ID NO. 2.

The intracellular domain of human CD3 ζ suitable for use in the present invention may be various intracellular domains of human CD3 ζ conventionally used in CARs in the art. In certain embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in SEQ ID NO 2 at amino acids 380-490.

The above-mentioned portions forming the fusion protein of the present invention, such as the light chain variable region and the heavy chain variable region of the anti-EGFRVIII single chain antibody, the human CD8 α hinge region, the human CD8 transmembrane region, 41BB, and the human CD3 ζ intracellular region, etc., may be directly linked to each other, or may be linked by a linker sequence. The linker sequence may be one known in the art to be suitable for use with antibodies, for example, a G and S containing linker sequence. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2,3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like.

In certain embodiments, the amino acid sequence of the CAR of the invention is as set forth in amino acids 22-490 of SEQ ID No. 2 or as set forth in amino acids 1-490 of SEQ ID No. 2.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins.

The invention also includes the CAR shown in the amino acid sequence at positions 22-490 of SEQ ID NO. 2, or a mutant of the CAR shown in SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include: an amino acid sequence having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence depicted in positions 22-490 of SEQ ID NO:2, the amino acid sequence depicted in positions 1-490 of SEQ ID NO:2 or the amino acid sequence depicted in SEQ ID NO:2, while still retaining the biological activity of the CAR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion proteins described herein is as set forth in nucleotides 64-1472 of SEQ ID NO. 1, or as set forth in nucleotides 1-1472 of SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion protein (CAR). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, polynucleotide sequences described herein, and optionally a selectable marker.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during periods of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably EGFRVIII mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Dosage of individual cells/kg body weight. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., Rosenberg et al, New Eng.J. of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be in conjunction with radiation or chemotherapeutic agents known in the art for the treatment of EGFRVIII mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention adopts the gene sequence of an anti-EGFRVIII antibody (particularly scFV derived from clone No. 139), searches the gene sequence information of a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region from a NCBI GenBank database, synthesizes a gene fragment of a chimeric antigen receptor anti-EGFRVIII scFv-CD8 hinge region-CD 8TM-41BB-CD3 zeta, and inserts the gene fragment into a retrovirus vector. The recombinant plasmid packages the virus in 293T cells, infects T cells, and causes the T cells to express the chimeric antigen receptor. The invention realizes the transformation method of the T lymphocyte modified by the chimeric antigen receptor gene based on a retrovirus transformation method. The method has the advantages of high transformation efficiency, stable expression of exogenous genes, and capability of shortening the time for in vitro culture of T lymphocytes to reach clinical level number. On the surface of the transgenic T lymphocyte, the transformed nucleic acid is expressed by transcription and translation. The CAR-T cell prepared by the invention has strong killing function on specific tumor cells, and the killing efficiency exceeds 40% under the condition that the effective target ratio is 20: 1.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The NT cells used in the examples were untransfected T cells of the same origin as in example 3, and used as control cells. The K562-EGFRVIII cell is a K562 cell highly expressing EGFRVIII, and the U251-EGFRVIII cell is a U251 cell highly expressing EGFRVIII. Both of these cells are self-constructed over-expressing cell lines by the company.

Example 1: determination of EGFRVIII-scFv-CD8 alpha-41 BB-CD3 zeta Gene sequence

The sequence information of human CD8 alpha hinge region, human CD8 alpha transmembrane region, 41BB intracellular region and human CD3 zeta intracellular region gene is searched from NCBI website database, the cloning number of the anti-EGFRVII single-chain antibody is 139, and the sequences are subjected to codon optimization on website http:// sg.

The sequences are connected in sequence by adopting overlap PCR according to the sequences of anti-EGFRVIII scFv, human CD8 alpha hinge region gene, human CD8 alpha transmembrane region gene, 41BB intracellular region gene and human CD3 zeta intracellular region gene, and different enzyme cutting sites are introduced at the connection positions of the sequences to form complete EGFRVIII-CAR gene sequence information.

The nucleotide sequence of the CAR molecule was double-digested with NotI (NEB) and EcoRI (NEB), inserted into the NotI-EcoRI site of the retrovirus RV by T4 ligase (NEB) and transformed into competent E.coli (DH 5. alpha.).

The recombinant plasmid is sent to Shanghai Biotechnology limited to be sequenced, and the sequencing result is compared with the fitted EGFRVIIICAR sequence to verify whether the sequence is correct. The sequencing primer is as follows:

and (3) sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 3);

antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 4).

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1.

Example 2: retroviral packaging

1. Day 1: 293T cells should be less than 20 passages, but not overgrown. At 0.6X 10⁶Plating cells/ml, adding 10ml of DMEM medium into a 10cm dish, fully and uniformly mixing the cells, and culturing at 37 ℃ overnight;

2. day 2: the 293T cell fusion degree reaches about 90%, and transfection is carried out (generally, the plate laying time is about 14-18 h); plasmid complexes were prepared with amounts of each plasmid being 12.5ug RV backbone, 10ug Gag-pol, 6.25ug VSVg, CaCl₂250ul，H₂O1 ml, the total volume is 1.25 ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added to the pre-warmed fresh medium.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, dispensed and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 3: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, and adjusting cell density to 1 × 10 with medium containing 5% AB serum X-VIVO (LONZA)⁶and/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimeiyuan) and 50ng/ml CD28 antibody (Beijing Hokkimeiyuan), and 100IU/ml interleukin 2 (Beijing double-Lut) was added to stimulate and culture for 48 hours, and then infected with the virus prepared in example 3;

2. every other day after T cell activation culture, the plates were plated in 24-well plates with 250. mu.l/well in Retronectin (Takara) coated non-tissue-treated plates diluted in PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

3. After two days of T cell activation culture, 2 coated 24-well plates were removed, the coating solution was aspirated away, and HBSS containing 2% BSA was added and blocked at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. The virus solution prepared in example 3 was added to wells 2ml of virus solution per well, centrifuged at 32 ℃ and 2000g for 2 h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X 10⁶The volume is 1ml, and the culture medium is T cell culture medium added with IL-2200 IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were placed at 37 ℃ in 5% CO₂Culturing in an incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2100 IU/ml is supplemented at a proper time to maintain the density of the T cells at 5x10⁵Cells were expanded at around/ml.

Thus, CART cells each infected with the retrovirus shown in example 2 were obtained and named EGFRVIIICART cells (EGFRVIIICAR expressing example 1).

Example 4: flow cytometry for detecting proportion of infected T lymphocytes and expression of surface CAR protein

The CAR-T cells and NT cells (control) prepared in example 4 were collected by centrifugation 72 hours after infection, washed 1 time with PBS, the supernatant was discarded, the corresponding antibody was added and washed with PBS 30min in the dark, resuspended, and finally detected by flow cytometry. CAR + was detected by ProteinL antibody (Jackson Immunoresearch).

FIG. 2 shows that the expression efficiency of EGFRVIIICAR + was 39% 72 hours after T cells were infected with the retrovirus prepared in example 2.

Example 5: INF-gamma secretion assay after co-culture of CAR-T cells with target cells

1. The prepared CAR-T cells were taken and resuspended in Lonza medium, and the cell concentration was adjusted to 1X 10⁶/mL。

2. The experimental group contained 2X 10 target cells (K562-EGFRVIII or U251-EGFRVIII) or control cells (K562) per well⁵EGFRVIII CAR-T cell 2X 10⁵200. mu.l of Lonza medium without IL-2. Mix well and add to 96-well plate. Meanwhile, BD GolgiPlug (containing protein transport inhibitor brefeldin A (brefeldin A)) is added, 1 mu l BD GolgiPlug is added into 1ml of cell culture medium, and the mixture is incubated for 5 to 6 hours at 37 ℃ after being fully mixed. Cells were collected as experimental groups.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 minutes. The supernatant was carefully aspirated or decanted.

After washing the cells with PBS, 250. mu.l/EP tube fixation/permeation solution was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes. Using 1 XBD Perm/Wash^TMThe cells were washed 2 times with 1 mL/time buffer.

5. Staining with intracellular factor, taking appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and performing BD Perm/Wash^TMThe buffer was diluted to 50. mu.l. Resuspending the fixed and disrupted cells thoroughly with the antibody dilution, incubating at 4 ℃ in the dark for 30min, 1 XBD Perm/Wash^TMCells were washed 2 times with 1 mL/time buffer and then resuspended in PBS.

6. And (4) detecting by using a flow cytometer.

FIG. 3 shows that the percentage of IFN-. gamma.secretion by EGFRVIII CART cells in CD 8-positive U251-EGFRVIIII cells was 21.7%.

Example 6: detection of tumor-specific cell killing after Co-culture of CAR-T cells with target cells

K562 cells (control cells as target cells) were resuspended in serum-free medium (1640) adjusted to a cell concentration of 1X 10⁶Perml, the fluorescent dye BMQC (2,3,6, 7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarins) was added to a final concentration of 5. mu.M.

2. Mixing, and incubating at 37 deg.C for 30 min.

3. Centrifugation was carried out at 1500rpm for 5min at room temperature, the supernatant was discarded and the cells resuspended in cytotoxic medium (phenol red-free 1640+ 5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh cytotoxic Medium cells were washed twice and resuspended in fresh cytotoxic Medium at a density of 1X 10⁶/ml。

K562-EGFRVIII cells (containing the EGFRVIII target protein, as target cells) were suspended in PBS containing 0.1% BSA at a concentration of 1X 10⁶/ml。

6. The fluorescent dye CFSE (fluorescent dye) (CFSE) was added to a final concentration of 1. mu.M.

7. Mixing, and incubating at 37 deg.C for 10 min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X 10⁶/ml。

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5X10⁶/ml。

11. In all experiments, cytotoxicity of effector T cells infected with EGFRVIII-BBz CAR (CAR-T cells) was compared to that of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

EGFRVIII-BBz CAR-T and negative control effector T cells, according to T cell: target cells were cultured in 5ml sterile test tubes (BD Biosciences) at a ratio of 20:1, 4: 1. In each co-culture group, 100,000 (50. mu.l) K562-EGFRVIII cells were targeted, and 100,000K 562 cells (50. mu.l) were negative control cells. A set containing only K562-EGFRVIII target cells and K562 negative control cells was set up.

13. The co-cultured cells were incubated at 37 ℃ for 5 h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-aminoactomycin D) at the concentrations recommended by the instructions and incubation on ice for 30 min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Analysis the proportion of live K562-EGFRVIII target cells and live K562 control cells after co-culture of T cells and target cells was determined using 7AAD negative live cell gating.

a) For each set of co-cultured T cells and target cells,

percent target cell survival ═ K562-EGFRVIIINumber of viable cells/Number of viable cells in K562。

b) Percent cytotoxic killer cells ═ 100-calibrated target cell survival%, i.e. (ratio of number of K562-EGFRVIII living cells at non-responder cells-number of K562-EGFRVIII living cells at effector cells)/number of K562 living cells.

The results are shown in fig. 4. FIG. 4 shows that the killing rate of EGFRVIII CART cells on K562-EGFRVIIII cells was 40% at an effective target ratio of 20: 1.

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., Ltd

<120> EGFRVIII-targeted chimeric antigen receptor and uses thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1472

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>1

atggttctgc tggtcaccag cctgctgctg tgcgaactgc cccaccccgc ctttctgctg 60

atccccgaca tccagatgac ccagagccct agcagcctga gcgccagcgt gggcgacaga 120

gtgaccatca cctgtcgggc cagccagggc atcagaaaca acctggcctg gtatcagcag 180

aagcccggca aggcccccaa gagactgatc tacgctgcca gcaatctgca gagcggcgtg 240

cccagcagat tcaccggaag cggctccggc accgagttca ccctgatcgt gtccagcctg 300

cagcccgagg acttcgccac ctactactgc ctgcagcacc acagctaccc tctgaccagc 360

ggcggaggca ccaaggtgga gatcaagcgg accggcagca ccagcggcag cggcaagcct 420

ggcagcggcg agggaagcga ggtccaggtg ctggaatctg gcggcggact ggtgcagcct 480

ggcggcagcc tgagactgag ctgtgccgcc agcggcttca ccttcagcag ctacgccatg 540

tcttgggtcc ggcaggctcc tggaaagggc ctggaatggg tgtccgccat cagcggctct 600

ggcggctcca ccaactacgc cgacagcgtg aagggccggt tcaccatcag ccgggacaac 660

agcaagaaca ccctgtatct gcagatgaac agcctgagag ccgaggacac cgccgtgtac 720

tactgtgccg gcagcagcgg gtggagcgag tactggggcc agggcacact ggtcacagtg 780

tctagcgcac tacaactcca gcacccagac cccctacacc tgctccaact atcgcaagtc 840

agcccctgtc actgcgccct gaagcctgtc gccctgctgc cgggggagct gtgcatactc 900

ggggactgga ctttgcctgt gatatctaca tctgggcgcc cttggccggg acttgtgggg 960

tccttctcct gtcactggtt atcacccttt actgcaggtt cagtgtcgtg aagagaggcc 1020

ggaagaagct gctgtacatc ttcaagcagc ctttcatgag gcccgtgcag actacccagg 1080

aggaagatgg atgcagctgt agattccctg aagaggagga aggaggctgt gagctgagag 1140

tgaagttctc ccgaagcgca gatgccccag cctatcagca gggacagaat cagctgtaca 1200

acgagctgaa cctgggaaga cgggaggaat acgatgtgct ggacaaaagg cggggcagag 1260

atcctgagat gggcggcaaa ccaagacgga agaaccccca ggaaggtctg tataatgagc 1320

tgcagaaaga caagatggct gaggcctact cagaaatcgg gatgaagggc gaaagaagga 1380

gaggaaaagg ccacgacgga ctgtaccagg ggctgagtac agcaacaaaa gacacctatg 1440

acgctctgca catgcaggct ctgccaccaa ga 1472

<210>3

<211>490

<212>PRT

<213> Artificial sequence (Homo sapiens)

<400>3

Met Val Leu Leu Val Thr Ser Leu Leu Leu Cys Gly Leu Pro His Pro

1 5 10 15

Ala Pro Leu Leu Ile Pro Ala Ile Gly Met Thr Gly Ser Pro Ser Ser

20 25 30

Leu Ser Ala Ser Val Gly Ala Ala Val Thr Ile Thr Cys Ala Ala Ser

35 40 45

Gly Gly Ile Ala Ala Ala Leu Ala Thr Thr Gly Gly Leu Pro Gly Leu

50 55 60

Ala Pro Leu Ala Leu Ile Thr Ala Ala Ser Ala Leu Gly Ser Gly Val

65 70 75 80

Pro Ser Ala Pro Thr Gly Ser Gly Ser Gly Thr Gly Pro Thr Leu Ile

85 90 95

Val Ser Ser Leu Gly Pro Gly Ala Pro Ala Thr Thr Thr Cys Leu Gly

100 105 110

His His Ser Thr Pro Leu Thr Ser Gly Gly Gly Thr Leu Val Gly Ile

115 120 125

Leu Ala Thr Gly Ser Thr Ser Gly Ser Gly Leu Pro Gly Ser Gly Gly

130 135 140

Gly Ser Gly Val Gly Val Leu Gly Ser Gly Gly Gly Leu Val Gly Pro

145 150 155 160

Gly Gly Ser Leu Ala Leu Ser Cys Ala Ala Ser Gly Pro Thr Pro Ser

165 170 175

Ser Thr Ala Met Ser Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly

180 185 190

Thr Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Ala Thr Ala Ala

195 200 205

Ser Val Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr

210 215 220

Leu Thr Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr

225 230 235 240

Thr Cys Ala Gly Ser Ser Gly Thr Ser Gly Thr Thr Gly Gly Gly Thr

245 250 255

Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Ala Pro Pro Thr

260 265 270

Pro Ala Pro Thr Ile Ala Ser Gly Pro Leu Ser Leu Ala Pro Gly Ala

275 280 285

Cys Ala Pro Ala Ala Gly Gly Ala Val His Thr Ala Gly Leu Ala Pro

290 295 300

Ala Cys Ala Ile Thr Ile Thr Ala Pro Leu Ala Gly Thr Cys Gly Val

305 310 315 320

Leu Leu Leu Ser Leu Val Ile Thr Leu Thr Cys Ala Pro Ser Val Val

325 330 335

Leu Ala Gly Ala Leu Leu Leu Leu Thr Ile Pro Leu Gly Pro Pro Met

340 345 350

Ala Pro Val Gly Thr Thr Gly Gly Gly Ala Gly Cys Ser Cys Ala Pro

355 360 365

Pro Gly Gly Gly Gly Gly Gly Cys Gly Leu Ala Val Leu Pro Ser Ala

370 375 380

Ser Ala Ala Ala Pro Ala Thr Gly Gly Gly Gly Ala Gly Leu Thr Ala

385 390 395 400

Gly Leu Ala Leu Gly Ala Ala Gly Gly Thr Ala Val Leu Ala Leu Ala

405 410 415

Ala Gly Ala Ala Pro Gly Met Gly Gly Leu Pro Ala Ala Leu Ala Pro

420 425 430

Gly Gly Gly Leu Thr Ala Gly Leu Gly Leu Ala Leu Met Ala Gly Ala

435 440 445

Thr Ser Gly Ile Gly Met Leu Gly Gly Ala Ala Ala Gly Leu Gly His

450 455 460

Ala Gly Leu Thr Gly Gly Leu Ser Thr Ala Thr Leu Ala Thr Thr Ala

465 470 475 480

Ala Leu His Met Gly Ala Leu Pro ProAla

485 490

<210>3

<211>21

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>3

agcatcgttc tgtgttgtct c 21

<210>4

<211>22

<212>DNA

<213> Artificial sequence (Homo sapiens)

<400>4

tgtttgtctt gtggcaatac ac 22

Claims

1. A polynucleotide sequence selected from the group consisting of:

(2) (1) the complement of the polynucleotide sequence.

2. The polynucleotide sequence of claim 1,

the coding sequence of the signal peptide before the coding sequence of the anti-EGFRVIII single-chain antibody is shown as the 1 st to 63 rd nucleotide sequences of SEQ ID NO; and/or

The coding sequence of the anti-EGFRVIII single-chain antibody is shown as the nucleotide sequence of the 64 th-788 th site of SEQ ID NO 1; and/or

The coding sequence of the human CD8 alpha hinge region is shown as the 789-929 th nucleotide sequence of SEQ ID NO 1; and/or

The coding sequence of the transmembrane region of the human CD8 is shown as the nucleotide sequence at the 930-995 position of SEQ ID NO. 1; and/or

The coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence at position 996-1139 of SEQ ID NO. 1; and/or

The coding sequence of the intracellular region of human CD3 zeta is shown in the nucleotide sequence at position 1140-1472 of SEQ ID NO. 1.

3. A fusion protein selected from the group consisting of:

(1) a coding sequence comprising a fusion protein of an anti-EGFRVIII single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, and a human CD3 zeta intracellular region, linked in sequence, and optionally, a fragment of EGFRVIII comprising extracellular domain III and extracellular domain IV; and

4. The fusion protein of claim 3, wherein the fusion protein has one or more of the following characteristics:

the fusion protein further comprises a signal peptide at the N end of the anti-EGFRVIII single-chain antibody, preferably, the amino acid sequence of the signal peptide is shown as amino acids 1-21 of SEQ ID NO. 2;

the amino acid sequence of the anti-EGFRVIII single-chain antibody is shown as amino acids 22-262 of SEQ ID NO 2;

the amino acid sequence of the human CD8 alpha hinge region is shown as the amino acid at the 263 rd-position 309 position of SEQ ID NO 2;

the amino acid sequence of the transmembrane region of the human CD8 is shown as the amino acid at the 310-position and 331-position of SEQ ID NO. 2;

the amino acid sequence of the intracellular region of the human 41BB is shown as the amino acid 332-379 of SEQ ID NO. 2;

the amino acid sequence of the intracellular domain of human CD3 ζ is shown as amino acids 380-490 of SEQ ID NO. 2.

5. A nucleic acid construct comprising the polynucleotide sequence of any one of claims 1-2;

preferably, the nucleic acid construct is a vector;

more preferably, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, and a polynucleotide sequence according to any one of claims 1-2.

6. A retrovirus containing the nucleic acid construct of claim 5, preferably containing the vector, more preferably containing the retroviral vector.

7. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises a polynucleotide sequence according to any one of claims 1 to 2, or comprises a nucleic acid construct according to claim 5, or is infected with a retrovirus according to claim 6, or stably expresses a fragment of a fusion protein according to any one of claims 3 to 4.

8. Use of a polynucleotide sequence according to any one of claims 1 to 2, a fusion protein according to any one of claims 3 to 4, a nucleic acid construct according to claim 5 or a retrovirus according to claim 6 in the preparation of an activated T cell.

9. Use of the polynucleotide sequence of any one of claims 1-2, the fusion protein of any one of claims 3-4, the nucleic acid construct of claim 5, the retrovirus of claim 6, or the genetically modified T cell of claim 7, or a pharmaceutical composition thereof, in the manufacture of a medicament for treating an EGFRVIII-mediated disease;

preferably, the EGFRVIII-mediated disease is malignant brain glioma.