CN108864276B

CN108864276B - NY-ESO-1-targeted T cell receptor combined expression PD 1antibody variable region and application thereof

Info

Publication number: CN108864276B
Application number: CN201710341203.0A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Priority date: 2017-05-16
Filing date: 2017-05-16
Publication date: 2023-02-03
Anticipated expiration: 2037-05-16
Also published as: CN108864276A

Abstract

The invention discloses an antibody of a target NY-ESO-1T cell receptor combined expression anti-PD 1. Is formed by connecting NY-ESO-1TCR alpha chain, P2A, NY-ESO-1TCR beta chain, T2A, human IL2 signal peptide and heavy chain and light chain variable region (aPD 1 scFv) structures of anti-human PD1 monoclonal antibody in series. The T cell receptor is used for modifying human T lymphocytes, and the modified T cells (TCR-T cells) can be used for expressing HLA-A2+ NY-ESO-1 positive tumors. The NY-ESO-1-aPD1TCR-T cell prepared by the invention has strong functions on specific tumor cells (U266, T2-NY-ESO-1), the CD107a expression and IFN gamma secretion are high, and the killing efficiency on the U266 is 85% under the condition that the effective target ratio is 5.

Description

NY-ESO-1-targeted T cell receptor combined expression PD 1antibody variable region and application thereof

Technical Field

The invention belongs to the field of T cell receptors, and particularly relates to a T cell receptor targeting NY-ESO-1 and combined expression PD 1antibody variable region and application thereof.

Background

In recent years, people have made great progress in screening tumor-specific antigens, and a large number of tumor-associated antigens and tumor-specific antigens have been discovered. Tumor-testis antigens, CT, the most numerous of the currently identified tumor-specific antigens, were first discovered by Boon professor and colleagues in belgium in 1991 and share the following common features: is not normally expressed in normal tissues; the expression of different intensities in various tumors such as liver cancer, malignant melanoma, lung cancer and the like; the coding gene is located on the X chromosome. Due to the above characteristics, CT antigens are considered as shared antigens specific to tumors.

The CT antigen comprises a Melanoma Antigen (MAGE) family, an SSX gene family, LAGE, GAGE, CTp11, NY-ESO-l and the like, and NY-ESO-1 is a tumor sharing antigen screened from an esophageal cancer cDNA expression library by Chen Y.T. and the like by using a serological analysis technology of a recombinant cDNA library. The NY-ESO-1 gene family has at least 3 members, which are NY-ESO-1, LAGE-1 and ESO3, and the genes are located at Xq28. The mRNA transcribed by the NY-ESO-1 gene has the longest length of 747bp, the relative molecular mass of the expressed protein is 18KD, the expressed protein consists of 180 amino acids, a hydrophobic amino acid tail exists at the C end of the expressed protein, and a potential transmembrane region exists on the NY-ESO-1 protein. The expression of NY-ESO-l mRNA and protein thereof is detected by RT-PCR and immunohistochemistry, and researchers study the expression of NY-ESO-1 in tumors of various systems, and the results show that NY-ESO-1 has different expression frequencies in tumors of various systems, has higher expression in tumor tissues such as neuroblastoma, synovial sarcoma, malignant melanoma, ovarian cancer and the like, has different expression degrees in colorectal cancer, liver cancer, urothelial cancer, multiple myeloma and lung cancer, but has lower expression of NY-ESO-1 in some types of tumors such as rectal cancer, kidney cancer, leukemia and lymphoma tissues, and even does not express the NY-ESO-1. NY-ESO-1 is also expressed in normal tissues, mainly expressed in testis and ovary and low expressed in uterus, but due to the existence of blood testis barrier, the immune toxicity suffered by the normal tissues can be effectively controlled. The expression characteristics of NY-ESO-l show good clinical application prospect and become the research focus of scholars at home and abroad. In recent years, NY-ESO-l is an important target for adoptive immunotherapy.

Due to the difficulty in obtaining tumor-reactive T cells from most tumor patients with high affinity and specificity for tumor antigens. Researchers have gradually tried to obtain specific TCR genes transfected T cells by introducing specific TCR genes that recognize tumor antigens into T cells of patients through genetic engineering methods. I.e. by not having to the patientCan redirect T cell antigen specificity to obtain tumor reactive T cell. Fundamentally, TCRs are the molecular basis for T cells to recognize antigens. Alpha accounts for more than 80% of total number of T lymphocytes in peripheral blood ⁺ β ⁺ T cells. The TCR molecule consists of alpha and beta double chains, and both the TCR alpha chain and the TCR beta chain consist of a variable region (V region) and a constant region (C region) in protein structure, wherein the V region is a key part for recognizing an antigenic peptide/MHC complex (pMHC). The V regions of the TCR α and β chains each contain three hypervariable regions, also known as Complementarity Determining Regions (CDRs), which are structurally similar to the V regions of immunoglobulins, and are generally denoted as CDRl, CDR2, and CDR 3. In addition, the TCRV β chain also contains a fourth hypervariable region CDR4. The TCR with extremely high diversity formed by mechanisms such as gene rearrangement determines the diversity of T cell recognition antigens, so that TCR alpha beta double chains expressed by mature T cells form a TCR alpha beta double chain capable of combining with tens of millions of antigens (theoretically up to 10) ¹⁴ Grade) bound antigen recognition receptor library (repotoreie)

With the continuous enrichment of relevant theoretical knowledge such as TCR diversity and TCR antigen peptide/MHC complex recognition mechanism, the deep development of molecular biology and genetic engineering technology is combined. A new idea of TCR gene engineered T cells is gradually established by adoptive cell therapy of tumors. Screening and cloning a tumor specific TCR gene, transfecting a T cell with the tumor specific TCR gene to endow the T cell with antigen specificity, thus obtaining a genetically engineered antigen specific T cell, finally transfusing the TCR gene transfected T cell into a patient body, and reconstructing T cell immune response aiming at antigen positive tumor. In recent years, many scholars have isolated tumor-associated antigen-specific TCR genes, then transduced into T cells by lentiviruses, retroviruses or other non-viral vectors and expressed them, and obtained a large number of T cells with the ability to specifically recognize antigens in a short period of time, and performed a series of preclinical or clinical trials, with some promising results.

The study of the transfection of T cells with the α β TCR gene to confer antigen specificity originally originated from a transgenic mouse model. Subsequently, several groups successfully transfected α β TCR duplexes into human leukemia cell line Jurkat. In 1999, the first experiment to confer antigen specificity to human peripheral blood T cells by TCR gene transfection, targeting recognition of tumor antigens was performed by Clay et al. They first identified and cloned tumor-reactive T cells from HLA-A2 melanoma patients. Then identifying and cloning TCR gene of m9-27 peptide capable of recognizing MART-1 (tumor specific antigen expressed in most human melanoma cells), and after cloning cDNA coding sequence of the TCR gene, transfecting the specific TCR gene into CD8+ T cells derived from HLA-A2 type healthy human peripheral blood T cells by using retrovirus vector. Specific TCR gene transfected T cells can effectively lyse MART-1 positive melanoma cell lines in vitro. Thereby proving the feasibility of using exogenous TCR gene to transform T cells to endow the T cells with tumor antigen recognition capability. Thereafter, researchers have successfully obtained TCR genes aiming at tumor antigens such as MDM2, LMP2 and the like, and successfully transfect T cells, so that TCR gene transfection T cell therapy becomes a brand new strategy for tumor immunotherapy. In 2006, rosenberg et al, SCINECE, published the results of phase 1 clinical trials of TCR gene-transfected T cell therapy in the first instance of melanoma patients. In the research, a TCR gene specific to MART-1 antigen is transferred into peripheral blood lymphocytes of a patient through a retrovirus vector, and then the lymphocytes are returned into the patient. The results showed that significant tumor regression occurred in 2 out of 17 patients.

The Robbins group returned NY-ESO-1 antigen-specific TCR gene-modified T cells to 6 synovial cell sarcoma patients and 11 malignant melanoma patients, and as a result, 4 synovial cell sarcoma patients and 5 malignant melanoma patients achieved significant therapeutic effects, including 2 patients with complete remission, and none of them had significant adverse effects. Although TCR gene-modified T cells exhibit good clinical efficacy, researchers have also found that tumors in some patients can escape killing by immunotherapy. Klippel et al found that patients with malignant melanoma who recurred following NY-ESO-1 specific T cell therapy may be associated with loss of MHC from their cells in vivo, thereby allowing for immune escape. In addition, increasing TCR affinity and reducing TCR α β chain mismatch rate are issues that need to be addressed in TCR gene therapy, and autoimmune diseases caused by TCR mismatch or too high affinity are also not negligible. Also, the tumor microenvironment of T cells and the safety issues of TCRs are of concern. In addition, regulatory T cells, myeloid-derived suppressor cells, and some cytokines can influence the imported genetically modified T cells, thereby affecting the killing function of the T cells. The results of the above studies suggest that TCR gene-transfected T cell therapy has taken a step towards clinical application.

PD1 (programmed death 1) was originally obtained in apoptotic T-cell hybridomas and was named the programmed death 1 receptor as it is associated with apoptosis. PD1 receptors are expressed on the surface of T cells and primary B cells, and play a role in the differentiation and apoptosis of these cells. PD1 has two ligands, PD-L1 (B7-H1) and PD-L2 (B7-DC), belonging to the B7 family of proteins (blood 2009.114 (8): p.1537-44.). PD-L1 protein is widely expressed in antigen presenting cells, activated T, B cells, macrophages, placental trophoblasts, myocardial endothelium and thymic cortical epithelial cells. PD-L1 interacts with the receptor PD1 on T cells and plays an important role in the negative regulation of immune response. Normally, when the body encounters a foreign pathogen or an antigen invader, the antigen presenting cell captures the antigen, processes the antigen into an epitope which can be recognized by a T cell, binds to an MHC molecule and presents the outside of the cell for the recognition of the T cell. T cells are bound to MHC molecules of antigen presenting cells through TCR, and in addition, a costimulatory signal CD28 receptor is bound to B7-1 (CD 80) or B7-2 (CD 86) on the surface of original T cells, the T cells receive a positive regulation signal, the original T cells are activated into effector T cells, and an immune response is started. When continuous antigen stimulation is available, in order to avoid excessive response, the activated T cell surface expression PD1 is combined with the PD-L1 on the surface of the antigen presenting cell to transmit a negative regulation signal to the T cell, and the T cell is reduced in proliferation or is apoptotic. The research finds that the expression of PD-L1 protein can be detected in a plurality of human tumor tissues, the microenvironment of the tumor part can induce the expression of PD-L1 on tumor cells, and the expressed PD-L1 is combined with PD1 on the surface of T cells to inhibit the anti-tumor activity of the T cells, so that the tumor cells can escape from the monitoring and elimination of the immune system of the body, and the generation and growth of tumors are facilitated.

Although the compound combination has wide prospect, the current antitumor drug treatment window is generally narrow, the effect of the combined medication is still difficult to predict, and the exertion of the PD1 effect is seriously restricted. A series of studies were conducted by professor Edmund Moon, university of Pennsylvania, and a team in his area on this combined application strategy. When the TCR-T cell with NY-ESO-1 as an antigen target is used for killing tumor cells, the anti-PD 1antibody is added, so that the phenomenon of T cell function reduction can be obviously improved; accordingly, in the mouse model of subcutaneous transplanted tumor, the tumor-removing ability of TCR-T cells is limited, and the complete elimination of tumor can be achieved after the treatment of PD 1antibody (Clin Cancer Res.2016.22 (2): p.436-47).

The patent takes a TCR alpha chain and a TCR beta chain of NY-ESO-l as the structure of TCR, and simultaneously expresses a segment of anti-human PD 1. The targeted TCR is modified, and the fragment of anti-human PD1 is introduced, so that the tumor immunosuppression microenvironment is well improved by a TCR-T cell and blocking PD1/PD-L1 signal combined application strategy. Meanwhile, a foundation is laid for clinical experiments in the future.

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) The coding sequence of NY-ESO-1TCR alpha chain, the coding sequence of P2A, the coding sequence of NY-ESO-1TCR beta chain, the coding sequence of T2A, the coding sequence of human IL2 signal peptide, and the coding sequence of heavy chain and light chain variable region (aPD 1 scFv) of anti-human PD1 monoclonal antibody are connected in series to form a polynucleotide sequence; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the coding sequence for the NY-ESO-1TCR α is as shown in SEQ ID NO. 2 nucleotide sequences 1-822. In one or more embodiments, the coding sequence for P2A is as set forth in SEQ ID NO 2, nucleotide sequences 823-903. In one or more embodiments, the coding sequence for the NY-ESO-1TCR β chain is as shown in nucleotide sequence 904-1830 of SEQ ID NO. 2. In one or more embodiments, the coding sequence for human T2A is as set forth in SEQ ID NO. 2 nucleotide sequences 1831-1905. In one or more embodiments, the coding sequence for the human IL2 signal peptide is as shown in SEQ ID NO 2 at nucleotide sequences 1906-1965. In one or more embodiments, the heavy chain coding sequence of the human PD1 monoclonal antibody is as shown in nucleotide sequences 1966-2304 of SEQ ID NO. 2. In one or more embodiments, the light chain coding sequence of the human PD1 monoclonal antibody is as shown in nucleotide sequence 2350-2670 of SEQ ID NO. 2.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) The coding sequence comprises a coding sequence of an NY-ESO-1TCR alpha chain, a coding sequence of P2A, a coding sequence of an NY-ESO-1TCR beta chain, a coding sequence of T2A, a coding sequence of human IL2 signal peptide, and a coding sequence of a heavy chain and light chain variable region (aPD 1 scFv) of an anti-human PD1 monoclonal antibody which are connected in series to form the coding sequence; and

(2) A fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

in one or more embodiments, the coding sequence for the NY-ESO-1TCR α is as shown in amino acid sequence 1-274 of SEQ ID NO 1. In one or more embodiments, the coding sequence for P2A is as set forth in amino acid sequences 275-301 of SEQ ID NO 1. In one or more embodiments, the coding sequence for the NY-ESO-1TCR β chain is as set forth in amino acid sequence 302-610 of SEQ ID NO: 1. In one or more embodiments, the coding sequence of human T2A is as shown in amino acid sequence 611-635 of SEQ ID NO 1. In one or more embodiments, the coding sequence for the human IL2 signal peptide is as set forth in SEQ ID NO 1 amino acid sequences 636-655. In one or more embodiments, the heavy chain coding sequence of the human PD1 monoclonal antibody is represented by the amino acid sequence at positions 656-768 of SEQ ID NO. 1. In one or more embodiments, the light chain coding sequence of the human PD1 monoclonal antibody is as set forth in SEQ ID NO.1 amino acid sequences 784-890.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3'LTR,5' LTR, a polynucleotide sequence as described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T-cell as described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a NY-ESO-1 mediated disease. In one or more embodiments, preferably, the NY-ESO-1 mediated disease includes neuroblastoma, synovial sarcoma, malignant melanoma, ovarian cancer;

more preferably, said NY-ESO-1 mediated disease comprises neuroblastoma, synovial sarcoma, malignant melanoma, ovarian cancer, colorectal cancer, liver cancer, urinary epithelial cancer, multiple myeloma, lung cancer.

Drawings

FIG. 1 is a schematic diagram of RV-NY-ESO-1TCR-aPD1 (NY-ESO-1-aPD 1 TCR-T) retroviral expression vector.

FIG. 2 is a partial sequencing result peak diagram of RV-NY-ESO-1TCR-aPD1 (NY-ESO-1-aPD 1 TCR-T) retrovirus expression plasmid.

FIG. 3 is a flow cytometer showing the TCR expression efficiency of NY-ESO-1TCR-T and NY-ESO-1-aPD1TCR-T at 72 hours after retroviral infection of T cells.

FIG. 4 shows the result of anti-Human Fab staining after incubating 293T-PD1 overexpression cells and NY-ESO-1TCR-aPD1 virus for 30min.

FIG. 5 is a preparation of 5 days NY-ESO-1-aPD1TCR-T cells and target cells co-culture for 5 hours CD107a expression detection.

FIG. 6 shows the secretion assay of IFN γ for 5 hours of co-culture of NY-ESO-1-aPD1TCR-T cells and target cells prepared for 5 days.

FIG. 7 shows the killing effect of 5 days of NY-ESO-1TCR-T and NY-ESO-1-aPD1TCR-T cells on tumor cells after co-culture with target cells for 16 hours.

FIG. 8 shows the expression of PD1 on the surface of TCR-T after preparation of 5-day co-culture of NY-ESO-1TCR-T and NY-ESO-1-aPD1TCR-T with target cells for 24 hours and 48 hours.

Detailed Description

The invention provides a T Cell Receptor (TCR) targeting NY-ESO-1. The TCR comprises heavy chain and light chain variable region (aPD 1 scFv) fragments of NY-ESO-1TCR alpha chain, P2A, NY-ESO-1TCR beta chain, T2A, human IL2 and anti-human PD1 monoclonal antibody which are connected in sequence.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites, which will necessitate the introduction of one or more irrelevant residues at the end of the expressed amino acid sequence, which will not affect the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or carboxy-terminus of the fusion protein of the invention (i.e., the TCR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag can be FLAG, HA, HA1, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7,4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins.

The invention also includes TCR shown by the 1 st to 601 st amino acid sequence of SEQ ID NO.1 and TCR mutant shown by the 275 th to 601 st amino acid sequence of SEQ ID NO. 1. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the TCR and retains the biological activity (e.g., activating T cells) of the TCR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include: an amino acid sequence having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence shown in positions 1-601 of SEQ ID NO.1, the amino acid sequence shown in positions 275-601 of SEQ ID NO.1, while still retaining the biological activity of the TCR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

The invention also relates to nucleic acid constructs comprising a polynucleotide sequence as described herein, and one or more control sequences operably linked to the sequence. The polynucleotide sequences of the present invention can be manipulated in a variety of ways to ensure expression of the fusion protein (TCR). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter, and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, molecular cloning. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Typically, suitable vectors comprise an origin of replication functional in at least one organism, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers (e.g., WO 01/96584, WO01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector containing a replication initiation site, a 3'LTR,5' LTR, a polynucleotide sequence as described herein, and optionally a selectable marker.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 (SV 40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during a period of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the TCR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be various types of T cells from various sources. For example, the T cells may be derived from PBMCs of patients with malignant tumors.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30 to 80ng/ml, such as 50 ng/ml) of CD3 antibody prior to culturing in a medium containing an appropriate amount (e.g., 30 to 80IU/ml, such as 50 IU/ml) of IL2 for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein.

The TCR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the TCR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The anti-tumor immune response elicited by the TCR-T cells can be an active or passive immune response. In addition, the TCR-mediated immune response can be part of an adoptive immunotherapy step, in which the TCR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases which can be treated with the TCRs of the invention, their coding sequences, nucleic acid constructs, expression vectors, viruses and TCR-T cells are preferably NY-ESO-1 mediated diseases.

The TCR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, the pharmaceutical compositions of the invention may comprise TCR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10 ⁴ To 10 ⁹ Dosage of individual cells/kg body weight, preferably 10 ⁵ To 10 ⁶ Dosage of individual cells/kg body weight. T cell compositions may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., rosenberg et al, new Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node, or site of infection.

In some embodiments of the invention, the TCR-T cells of the invention, or compositions thereof, can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be in conjunction with radiotherapeutic or chemotherapeutic agents known in the art for the treatment of NY-ESO-1 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention searches sequence information from NCBI GenBank database, synthesizes gene segment of T cell receptor NY-ESO-1TCR-aPD1 by whole gene, and inserts into retrovirus vector RV. The recombinant plasmid packages the virus in 293T cells, infects T cells, and makes the T cells express the T cell receptor. In one embodiment of the invention, the transformation method to achieve T cell receptor gene modified T lymphocytes is based on a retroviral transformation method. The method has the advantages of high transformation efficiency, stable expression of exogenous genes, and capability of shortening the time for in vitro culture of T lymphocytes to reach clinical level number. On the surface of the transgenic T lymphocyte, the transformed nucleic acid is expressed thereon by transcription and translation. The retrovirus expressing the NY-ESO-1TCR, which is obtained by the invention, is used for preparing TCR-T cells by a Retrocin method, the TCR-T cells after 3 days are prepared and used for detecting the infection efficiency by flow, the TCR-T cells after 5 days are prepared and cultured together with NY-ESO-1 positive tumor cells in vitro for 5 hours to detect the CD107a expression and the IFN gamma secretion, and the TCR-T cells after 5 days are prepared and cultured together with the tumor cells in vitro for 16 hours to detect the specific killing effect (cytotoxicity) of the TCR-T cells on the tumor cells. Therefore, the NY-ESO-1-aPD1TCR-T can be applied to the treatment of HLA-A2+ NY-ESO-1 positive tumors.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to include any and all variations which become evident as a result of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Example 1: determination of NY-ESO-1TCR-aPD1 Gene sequence

NY-ESO-1TCR alpha, NY-ESO-1TCR beta and anti-PD 1antibody heavy chain and light chain variable region gene sequence information are searched from an NCBI website database, and the sequences are subjected to codon optimization on a website http:// sg.idtdna.com/CodonOpt, so that the expression of human cells is more suitable under the condition of unchanging an encoding amino acid sequence.

The amino acid and gene sequence information is shown in SEQ ENCE LISTING (SEQ UNCE ID NO. 1-2).

The whole gene of the sequence is synthesized, and different enzyme cutting sites are introduced at the head and the tail to form complete NY-ESO-1TCR-aPD1 gene sequence information.

Example 2: construction of viral vectors comprising NY-ESO-1TCR-aPD1 nucleic acid sequences

The nucleotide sequence of the CAR molecule prepared in example 1 was digested with NotI (NEB) and EcoRI (NEB), ligated with T4 ligase (NEB) and inserted into the NotI-EcoRI site of the retroviral RV vector, transformed into competent e.coli (DH 5 α), the recombinant plasmid was sent to marine biotechnology limited for sequencing, and the sequencing result was aligned with the pseudo-synthesized NY-ESO-1 TCR-adp 1 sequence to verify whether the sequence was correct. The sequencing primers are as follows:

sense sequence AGCATCGTTCTGTTGTTGTCTC (SEQINCE ID NO. 3)

Antisense sequence TGTTTGTCTTGTGGCAATACAC (SEQINCE ID NO. 4)

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1. FIG. 2 shows a partial sequencing peak plot of the retroviral expression plasmid.

Example 3: retroviral packaging

1. Day 1 293T cells should be less than 20 passages but not too longIs full. At 0.6X 10 ⁶ cells/ml are plated, 10ml of DMEM medium is added into a 10cm dish, the cells are fully mixed, and the cells are cultured overnight at 37 ℃;

2. on day 2, 293T cells are transfected to a confluence of about 90% (usually, plating for about 14-18 h); plasmid complexes were prepared with amounts of each plasmid RV-NY-ESO-1TCR-aPD1 (MSCV) 12.5ug, gag-pol 10ug, VSVg 6.25ug, caCl ₂ 250ul，H ₂ O is 1ml, and the total volume is 1.25ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. Adding the mixture into a 293T dish along the edge gently, culturing at 37 ℃ for 4h, removing the culture medium, washing with PBS once, and adding the preheated fresh culture medium again;

3. day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, split-charged and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 4: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, adjusting cell density to 1 × 10 with 5% AB serum X-VIVO (LONZA) medium ⁶ The volume is/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimeiyuan) and 50ng/ml CD28 antibody (Beijing Hokkimeiyuan), and 100IU/ml interleukin 2 (Beijing Erlu) was added to stimulate the culture for 48 hours to cause viral infection.

On the next day after T cell activation culture, the non-tissue treated plates were coated with 250. Mu.l of each well of 24-well plates by Retronectin (Takara) diluted in PBS to a final concentration of 15. Mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

Two days after T cell activation culture, 2 coated 24-well plates were removed, the coating solution was aspirated off, and HBSS containing 2% BSA was added for blocking at room temperature for 30min. The volume of the blocking solution was 500. Mu.l per well, the blocking solution was aspirated and the plate was washed twice with HBSS containing 2.5% HEPES.

4. Adding the virus solution into each well, adding 2ml of virus solution into each well, centrifuging at 32 ℃ for 2000g, and centrifuging for 2h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X 10 ⁶ 1ml in volume, and the culture medium is T fineIL-2 200IU/ml is added into the cell culture medium. Centrifuge at 30 deg.C and 1000g for 10min.

6. After completion of centrifugation, the plate was incubated at 37 ℃ in a CO2 incubator 5%.

7. 24h after infection, the cell suspension was aspirated, centrifuged at 1200rpm,4 ℃ for 7min.

8. After the cells are infected, the density of the cells is observed every day, and T cell culture solution containing IL-2 100IU/ml is supplemented timely to maintain the density of the T cells at 5 multiplied by 10 ⁵ Cells were expanded around/ml.

Example 5: flow cytometry for detecting expression of T lymphocyte surface TCR after infection

TCR-T cells and NT cells (control group) 72 hours after infection are collected by centrifugation respectively, PBS is washed for 1 time, then supernatant is discarded, corresponding antibody is added and is washed by PBS for 30min in the dark, then heavy suspension is carried out, and finally TCR expression is detected by a flow cytometer, wherein the antibody is anti-human TCR V13.1antibody (Biolegend).

The results of this example show in FIG. 3 the expression efficiency of NY-ESO-1-TCR-T and NY-ESO-1-aPD 1-TCR-T72 hours after infection of T cells with the retrovirus prepared in example 3. The positive rate of the TCR was 74.3% and 81.2%, respectively.

Example 6: flow detection of secretory anti-PD1 expression in virus

NY-ESO-1TCR and NY-ESO-1TCR-aPD1 viruses are respectively incubated with 293T-PD1 (cells over-expressing PD1 prepared by the company) for 30min, and then are subjected to on-machine detection after being stained for 30min by anti-human Fab. The secretable anti-PD 1antibody is humanized and can be detected by the anti-human Fab antibody.

The results of this example are shown in FIG. 4, and the expression rate of the secretable anti-PD1 detected by the flow results is 97.3%.

Example 7: detection of CD107a expression following co-culture of TCR-T cells with target cells

1. Taking a V-bottom 96-well plate, adding 2X 10 TCR-T/NT cells to each well ⁵ 2X 10 of the sum target cells (U266, T2-NY-ESO-1)/control cells (T2) ⁵ Separately, resuspend to 100ul of IL-2 free X-VIVO complete medium, add BD GolgiStop (containing monesin, 1. Mu.l BD GolgiStop per 1ml medium), and add to each well2ul CD107a antibody (1: 50) was added thereto, and the mixture was incubated at 37 ℃ for 4 hours to collect cells.

2. The samples were centrifuged to remove the medium, the cells washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, and appropriate amounts of specific surface antibodies CD3, CD4, CD8 were added to each tube, the volume of resuspension was 100ul, and incubation was carried out for 30min on ice in the dark.

3. Cells were washed 1 time with 3mL PBS per tube and centrifuged at 400g for 5 min. The supernatant was carefully aspirated.

4. An appropriate amount of PBS was resuspended and CD107a expression was detected by flow cytometry (Biolegend).

The results of this example are shown in figure 5. The percentage of CD107a expression in CD8 positive cells after co-culture of NY-ESO-1-PD1-TCR-T cells with two target cells (U266, T2-NY-ESO-1) was 70.3% and 70.4%, respectively.

Example 8: IFN gamma secretion detection after co-culture of TCR-T cells and target cells

1. Taking prepared TCR-T cells, resuspending the TCR-T cells in Lonza culture medium, and adjusting the cell concentration to be 1 multiplied by 10 ⁶ /mL。

2. Each well of the experimental group contains target cells (U266, T2-NY-ESO-1) or negative control cells (T2) 2X 10 ⁵ 2X 10 TCR-T/NT cells ⁵ 100 μ l of Lonza medium without IL-2. Mix well and add to 96-well plate. BD GolgiStop (containing monesin, 1. Mu.l BD GolgiStop per 1ml of medium) was added thereto, and after mixing well, the mixture was incubated at 37 ℃ for 4 hours. Cells were collected as experimental groups.

3. Cells were washed 1 time with 1mL PBS per tube and centrifuged at 300g for 5 minutes. The supernatant was carefully aspirated or decanted.

After washing the cells with PBS, 250. Mu.l/EP tube Fixation/Permeabilization solution was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes. Using 1 XBD Perm/Wash ^TM buffer washes cells 2 times, 1 mL/time.

5. Staining with intracellular factor, collecting appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and applying BD Perm/Wash ^TM buffer diluted to 50. Mu.l. The antibody dilution was used to fully resuspend the cells with fixed rupture of membranes, incubated 30min at 4 ℃ in the dark, washed 2 times with 1 XBD Perm/Wash buffer 1 mL/time, and then resuspended in PBS.

6. And (4) detecting by using a flow cytometer.

The results of this example are shown in fig. 6. The percentages of IFN-gamma expression in CD8 positive cells after co-culture of NY-ESO-1-PD1-TCR-T cells and two target cells (U266, T2-NY-ESO-1) were 56.8% and 54.8%, respectively.

Example 9: detection of tumor-specific cell killing after co-culture of TCR-T cells and target cells

The K562 cells (negative control cells) were resuspended in serum-free medium RPMI 1640 adjusted to a cell concentration of 1X 10 ⁶ Perml, the fluorescent dye BMQC (2, 3,6, 7-tetrahydroo-9-bromomethyl-1H, 5Hquinolizino (9, 1-gh) coumarins) was added to a final concentration of 5. Mu.M.

2. Mixing, and incubating at 37 deg.C for 30min.

3. Centrifugation is carried out for 5min at 1500rpm at room temperature, the supernatant is discarded and the cells are resuspended in cytotoxic medium (phenol red-free 1640+5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh medium washed the cells twice and resuspended in fresh cytotoxic medium at a density of 1X 10 ⁶ /ml。

5.U266 cells (target cells) were suspended in PBS containing 0.1% BSA and adjusted to a concentration of 1X 10 ⁶ /ml。

6. A fluorescent dye CFSE (fluorescent dye CFSE) was added to a final concentration of 1. Mu.M.

7. Mixing, and incubating at 37 deg.C for 10min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X 10 ⁶ /ml。

10. Effector TCR-T cells were washed and suspended in cytotoxic medium at a concentration of 5X 10 ⁶ /ml。

11. In all experiments, cytotoxicity of effector T cells (TCR-T cells) infected with NY-ESO-1-aPD1 was compared with that of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

ny-ESO-1-aPD1TCR-T and negative control effector T cells, as per T cell: target cells =5, 1,1, in 5ml sterile test tubes (BD Biosciences). In each co-culture group, the target cells were Raji cells (100,000 cells) (50. Mu.l), and the negative control cells were K562 cells (100,000 cells) (50. Mu.l). A panel was set up containing only U266 target cells and K562 negative control cells.

13. The co-cultured cells were incubated at 37 ℃ for 16h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-aminoactomycin D) at the concentrations recommended by the instructions and incubation on ice for 30min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Assay the proportion of viable U266 target cells and viable K562 negative control cells after co-culture of T cells and target cells was determined using 7AAD negative viable cell gating.

a) For each set of co-cultured T cells and target cells,

target cell survival% = U266 viable cell number/K562 viable cell number.

b) % cytotoxic killer cells = 100-% calibrated target cell survival, i.e. (number of U266 viable cells without effector cells-number of U266 viable cells with effector cells)/number of K562 viable cells ratio.

The results of this example are shown in fig. 7. FIG. 7 shows that at an effective target ratio of 5, the killing efficiency of NY-ESO-1-PD1TCR-T cells against HLA-A2-T2-NY-ESO-1 is 85%, respectively.

Example 10: detection of surface PD1 expression after co-culture of TCR-T cells and target cells

1. Taking a V-bottom 96-well plate, adding 2X 10 TCR-T/NT cells to each well ⁵ And target cells (U266), setting the group of K562 cells as a negative control, resuspending into 100ul of IL-2-containing X-VIVO complete medium, incubating at 37 ℃ for 24 hours and 48 hours, and collecting the cells.

2. The samples were centrifuged to remove the medium, the cells washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, and an appropriate amount of specific surface antibodies CD3 and PD1 was added to each tube, the volume of the suspension was 100ul, and the tubes were incubated on ice for 30 minutes in the dark.

4. And (3) resuspending with an appropriate amount of PBS, detecting CD3 and PD1 by a flow cytometer, and analyzing the expression condition of PD1 in a CD3+ cell population.

The results of this example are shown in fig. 8. FIG. 8 shows TCR-T surface PD1 expression after NY-ESO-1TCR-T and NY-ESO-1-PD1TCR-T cells were co-cultured with target cells (U266) for 24 hours. In U266 cells, the expression rate of NY-ESO-1TCR-T surface PD1 is 28.4%, and the expression rate of NY-ESO-1 PD1TCR-T surface PD1 is 17.2%. The 48H results were consistent in trend. The NY-ESO-1-PD1TCR-T constructed by the patent can secrete PD1 and PDL1 to be combined, and can regulate an immunosuppressive microenvironment.

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., ltd

<120> NY-ESO-1 targeted T cell receptor combined expression PD 1antibody variable region and application thereof

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 890

<212> PRT

<213> Artificial sequence

<400> 1

Met Glu Thr Leu Leu Gly Leu Leu Ile Leu Trp Leu Gln Leu Gln Trp

1 5 10 15

Val Ser Ser Lys Gln Glu Val Thr Gln Ile Pro Ala Ala Leu Ser Val

20 25 30

Pro Glu Gly Glu Asn Leu Val Leu Asn Cys Ser Phe Thr Asp Ser Ala

35 40 45

Ile Tyr Asn Leu Gln Trp Phe Arg Gln Asp Pro Gly Lys Gly Leu Thr

50 55 60

Ser Leu Leu Leu Ile Gln Ser Ser Gln Arg Glu Gln Thr Ser Gly Arg

65 70 75 80

Leu Asn Ala Ser Leu Asp Lys Ser Ser Gly Arg Ser Thr Leu Tyr Ile

85 90 95

Ala Ala Ser Gln Pro Gly Asp Ser Ala Thr Tyr Leu Cys Ala Val Arg

100 105 110

Pro Leu Tyr Gly Gly Ser Tyr Ile Pro Thr Phe Gly Arg Gly Thr Ser

115 120 125

Leu Ile Val His Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln

130 135 140

Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp

145 150 155 160

Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr

165 170 175

Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser

180 185 190

Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn

195 200 205

Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro

210 215 220

Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp

225 230 235 240

Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu

245 250 255

Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp

260 265 270

Ser Ser Arg Ala Lys Arg Ser Gly Ser Gly Ala Thr Asn Phe Ser Leu

275 280 285

Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ser Ile

290 295 300

Gly Leu Leu Cys Cys Ala Ala Leu Ser Leu Leu Trp Ala Gly Pro Val

305 310 315 320

Asn Ala Gly Val Thr Gln Thr Pro Lys Phe Gln Val Leu Lys Thr Gly

325 330 335

Gln Ser Met Thr Leu Gln Cys Ala Gln Asp Met Asn His Glu Tyr Met

340 345 350

Ser Trp Tyr Arg Gln Asp Pro Gly Met Gly Leu Arg Leu Ile His Tyr

355 360 365

Ser Val Gly Ala Gly Ile Thr Asp Gln Gly Glu Val Pro Asn Gly Tyr

370 375 380

Asn Val Ser Arg Ser Thr Thr Glu Asp Phe Pro Leu Arg Leu Leu Ser

385 390 395 400

Ala Ala Pro Ser Gln Thr Ser Val Tyr Phe Cys Ala Ser Ser Tyr Val

405 410 415

Gly Asn Thr Gly Glu Leu Phe Phe Gly Glu Gly Ser Arg Leu Thr Val

420 425 430

Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

435 440 445

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

450 455 460

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

465 470 475 480

Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu

485 490 495

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg

500 505 510

Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg

515 520 525

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

530 535 540

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

545 550 555 560

Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu

565 570 575

Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr

580 585 590

Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys

595 600 605

Asp Phe Arg Ala Lys Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu

610 615 620

Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Tyr Arg Met Gln

625 630 635 640

Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu Val Thr Asn Ser Gln

645 650 655

Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser

660 665 670

Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser Gly

675 680 685

Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala

690 695 700

Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val Lys

705 710 715 720

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe Leu

725 730 735

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

740 745 750

Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

755 760 765

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

770 775 780

Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu

785 790 795 800

Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu

805 810 815

Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr

820 825 830

Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser

835 840 845

Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu

850 855 860

Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr

865 870 875 880

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

885 890

<210> 2

<211> 2670

<212> DNA

<213> Artificial sequence

<400> 2

atggaaacac tgctgggcct gctgatcctg tggctgcagc tgcagtgggt gtccagcaag 60

caggaagtga cccagatccc tgccgccctg tctgtgcctg agggcgagaa cctggtgctg 120

aactgcagct tcaccgacag cgccatctac aacctgcagt ggttcagaca ggaccccggc 180

aagggcctga caagcctgct gctgattcag agcagccaga gagagcagac cagcggcaga 240

ctgaacgcca gcctggataa gagcagcggc cggtccaccc tgtatatcgc cgcttctcag 300

cctggcgact ccgccacata tctgtgtgct gtgcggcctc tgtacggcgg cagctacatc 360

cctaccttcg gcagaggcac cagcctgatc gtgcacccct acatccagaa ccccgacccc 420

gccgtgtacc agctgagaga cagcaagtcc agcgacaaga gcgtgtgcct gttcaccgac 480

ttcgacagcc agaccaacgt gtcccagagc aaggacagcg acgtgtacat caccgacaag 540

accgtgctgg acatgcggag catggacttc aagagcaaca gcgccgtggc ctggtccaac 600

aagagcgatt tcgcctgcgc caacgccttc aacaacagca ttatccccga ggacacattc 660

ttcccaagcc ccgagagcag ctgcgacgtg aagctggtgg aaaagagctt cgagacagac 720

accaacctga acttccagaa cctgagcgtg atcggcttcc ggattctgct gctgaaggtg 780

gccggcttca acctgctgat gaccctgaga ctgtggtcca gccgggccaa gagatctggc 840

agcggcgcca ccaatttcag cctgctgaaa caggccggcg acgtggaaga gaaccctggc 900

cctatgagca tcggcctgct gtgttgtgcc gctctgtccc tgctgtgggc cggacctgtg 960

aatgctggcg tgacacagac ccccaagttc caggtgctga aaaccggcca gagcatgacc 1020

ctgcagtgcg cccaggacat gaaccacgag tacatgagct ggtatcggca ggaccctggc 1080

atgggactgc ggctgatcca ctactctgtg ggcgccggca tcaccgatca gggcgaggtg 1140

cccaacggct acaatgtgtc cagatccacc accgaggact tcccactgag actgctgtct 1200

gccgccccta gccagacctc cgtgtacttc tgtgccagca gctacgtggg caacaccggc 1260

gagctgttct ttggcgaggg cagcagactg acagtgctgg aagatctgaa gaacgtgttc 1320

cccccagagg tggccgtgtt cgagccttct gaggccgaga tcagccacac ccagaaagcc 1380

accctcgtgt gtctggccac cggcttctac cccgaccacg tggaactgtc ttggtgggtc 1440

aacggcaaag aggtgcacag cggcgtgtcc accgatcccc agcctctgaa agagcagccc 1500

gccctgaacg acagccggta ctgtctgtcc tcccggctga gagtgtccgc caccttctgg 1560

cagaaccccc ggaaccactt cagatgccag gtgcagttct acggcctgag cgagaacgac 1620

gagtggaccc aggacagagc caagcccgtg actcagatcg tgtctgccga ggcctggggc 1680

agagccgatt gtggctttac cagcgagagc taccagcagg gcgtgctgag cgccaccatc 1740

ctgtacgaga tcctgctggg caaggccacc ctgtacgccg tgctggtgtc cgccctggtg 1800

ctgatggcca tggtcaaacg gaaggacttc agagccaagc ggggctctgg cgagggcaga 1860

ggctctctgc tgacctgcgg agatgtggaa gaaaatcccg gccctatgta cagaatgcag 1920

ctgttgtctt gtattgccct ttctctcgcc ctcgtaacaa attcacaagt ccaattggtg 1980

gagtctggcg gtggggtagt tcagcccggc cgatccctgc gcctggactg caaagcttct 2040

ggaattacgt tctcaaactc cggaatgcac tgggtgcggc aagcacctgg gaaagggctg 2100

gagtgggttg cggtgatttg gtacgatggc tctaagaggt actacgcaga cagcgttaaa 2160

ggcagattta ctatatcccg agataactct aaaaatacgc tcttcctcca aatgaatagc 2220

ctgagggcag aagacacagc cgtttactat tgtgctacca atgatgatta ctggggacag 2280

ggcaccctgg ttaccgtaag ttccggcggt ggtggaagtg gaggaggggg atccggaggc 2340

gggggttctg agatcgtcct gacccagtct ccagccactc tctccctgtc tccaggcgag 2400

cgcgctacac tgagttgtag agcttcccag tccgtgagca gctatctggc ctggtatcag 2460

cagaagcctg ggcaggctcc acggttgctg atttatgacg cctccaaccg cgcgactggg 2520

ataccagcta ggttttccgg atcaggcagc ggcactgatt ttacactgac catctcatct 2580

ctcgagccgg aagatttcgc cgtttactat tgtcaacaga gttcaaactg gccacggaca 2640

ttcggtcagg ggaccaaggt tgaaattaag 2670

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<223> primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<223> primer

<400> 4

tgtttgtctt gtggcaatac ac 22

<210> 5

<211> 6

<212> PRT

<213> Artificial sequence

<400> 5

Asp Ser Ala Ile Tyr Asn

1 5

<210> 6

<211> 7

<212> PRT

<213> Artificial sequence

<400> 6

Ile Gln Ser Ser Gln Arg Glu

1 5

<210> 7

<211> 13

<212> PRT

<213> Artificial sequence

<400> 7

Ala Val Arg Pro Leu Tyr Gly Gly Ser Tyr Ile Pro Thr

1 5 10

<210> 8

<211> 5

<212> PRT

<213> Artificial sequence

<400> 8

Met Asn His Glu Tyr

1 5

<210> 9

<211> 6

<212> PRT

<213> Artificial sequence

<400> 9

Ser Val Gly Ala Gly Ile

1 5

<210> 10

<211> 12

<212> PRT

<213> Artificial sequence

<400> 10

Ala Ser Ser Tyr Val Gly Asn Thr Gly Glu Leu Phe

1 5 10

Claims

1. A polynucleotide, the sequence of which is selected from the group consisting of:

(1) The coding sequence of NY-ESO-1TCR alpha chain, the coding sequence of P2A, the coding sequence of NY-ESO-1TCR beta chain, the coding sequence of T2A, the coding sequence of human IL2 signal peptide, and the coding sequence of heavy chain and light chain variable region (aPD 1 scFv) of antihuman PD1 monoclonal antibody which are connected in sequence;

(2) (1) the complement of the polynucleotide sequence;

the NY-ESO-1TCR alpha chain sequence is shown as SEQ ID NO 1 st-274 th amino acid sequence;

the P2A sequence is shown as the 275 th-301 th amino acid sequence of SEQ ID NO 1;

the NY-ESO-1TCR beta chain sequence is shown as SEQ ID NO:1 amino acid sequence from 302 th position to 610 th position;

the T2A sequence is shown as SEQ ID NO 1 amino acid sequence 611-635;

the sequence of the human IL2 signal peptide is shown as the 636 th-655 th amino acid sequence of SEQ ID NO 1;

the heavy chain variable region sequence of the anti-human PD1 monoclonal antibody is shown as the 656-768 th amino acid sequence of SEQ ID NO. 1;

the light chain variable region sequence of the anti-human PD1 monoclonal antibody is shown as the 784-890 amino acid sequence of SEQ ID NO. 1.

2. The polynucleotide according to claim 1,

the coding sequence of the NY-ESO-1TCR alpha chain is shown as the 1 st to 822 nd nucleotide sequence of SEQ ID NO 2;

the coding sequence of the P2A is shown as nucleotide sequence 823-903 of SEQ ID NO. 2;

the coding sequence of the NY-ESO-1TCR beta chain is shown as the 904 th to 1830 th nucleotide sequence of SEQ ID NO. 2;

the coding sequence of the T2A is shown as SEQ ID NO. 2 nucleotide sequence from 1831-1905;

the coding sequence of the human IL2 signal peptide is shown as 1906-1965 nucleotide sequence of SEQ ID NO 2;

the heavy chain variable region coding sequence of the anti-human PD1 monoclonal antibody is shown as the nucleotide sequence of 1966-2304 of SEQ ID NO. 2; and/or

The light chain variable region coding sequence of the anti-human PD1 monoclonal antibody is shown as 2350-2670 bit nucleotide sequence of SEQ ID NO 2.

3. A nucleic acid construct comprising the polynucleotide of claim 1 or 2.

4. The nucleic acid construct of claim 3, which is a vector.

5. The nucleic acid construct of claim 3, which is a retroviral vector containing a replication initiation site, 3'LTR,5' LTR.

6. A retrovirus, said retrovirus containing the nucleic acid constructs of any one of claims 3-5.

7. A genetically modified T cell or a pharmaceutical composition comprising a genetically modified T cell, wherein the cell comprises the polynucleotide of claim 1 or 2, or comprises the nucleic acid construct of any one of claims 3 to 5, or is infected with the retrovirus of claim 6.

8. Use of the polynucleotide of claim 1 or 2, the nucleic acid construct of any one of claims 3 to 5 or the retrovirus of claim 6 in the preparation of an activated T cell.

9. Use of a polynucleotide of claim 1 or 2, a nucleic acid construct of any of claims 3 to 5, a retrovirus of claim 6 or a genetically modified T-cell of claim 7 or a pharmaceutical composition comprising a T-cell so modified in the manufacture of a medicament for the treatment of a NY-ESO-1 mediated disease, said NY-ESO-1 mediated disease being selected from the group consisting of neuroblastoma, synovial sarcoma, malignant melanoma, ovarian cancer, colorectal cancer, liver cancer, urinary epithelial cancer, multiple myeloma and lung cancer.