CN108864276A

CN108864276A - NY-ESO-1-targeted T cell receptor combined expression PD1 antibody variable region and application thereof

Info

Publication number: CN108864276A
Application number: CN201710341203.0A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co ltd
Current assignee: Shanghai Hrain Biotechnology Co ltd
Priority date: 2017-05-16
Filing date: 2017-05-16
Publication date: 2018-11-23
Anticipated expiration: 2037-05-16
Also published as: CN108864276B

Abstract

the invention discloses an antibody of targeting NY-ESO-1T cell receptor combined expression anti-PD 1, which is formed by connecting NY-ESO-1 TCR β chain, P2A, NY-ESO-1 TCR beta chain, T2A, human I L2 signal peptide and heavy chain and light chain variable region (aPD scFv) structures of anti-human PD1 monoclonal antibody in series, wherein the T cell receptor is used for modifying human T lymphocytes, the modified T cells (TCR-T cells) can be used for expressing H L A2+ NY-ESO-1 positive tumors, the NY-ESO-1-aPD1 TCR cells prepared by the invention have strong functions on specific tumor cells (U266 and T2-NY-ESO-1), the expression of CD107a and IFN gamma secretion are higher, the micro-environment target ratio is 5: 266% to U killing efficiency, the NY-ESO-1 prepared by the invention has 85% of killing effect on the U266-TCR-13-TCR-23, and the prepared NY-ESO-1-1 antibody has the function of blocking the anti-PD 1 anti-PD-TCR.

Description

Target the antibody variable region T cell receptor Combined expression PD1 and application thereof of NY-ESO-1

Technical field

The invention belongs to T cell receptor fields, and in particular to target the T cell receptor and Combined expression PD1 of NY-ESO-1 Antibody variable region and application thereof.

Background technique

People have made great progress in terms of screening tumour specific antigen in recent years, it was found that massive tumor correlation is anti- Former and tumour specific antigen.The tumour testis of Belgian Boon professor and his colleagues' first discovery in 1991 (cancer-testis antigen, CT) antigen, CT are number is most in the tumour specific antigen identified at present one Class, they have following common trait：It does not express in the normal tissue generally；It is a variety of in liver cancer, malignant mela noma, lung cancer etc. There is the expression of varying strength in tumour；Encoding gene is located on X chromosome.Due to These characteristics, CT antigen is considered as tumour The shared antigen of specificity.

CT antigen includes melanoma-associated antigen (MAGE) family, SSX gene family, LAGE, GAGE, CTp11 and NY-ESO- L etc., NY-ESO-1 are to use recombinant cDNA library serological analysis technology from cancer of the esophagus cDNA expression library by Chen Y.T. etc. In sift out come a kind of tumour share antigen.NY-ESO-1 gene family at least possesses 3 members, they are NY-ESO- respectively 1, LAGE-1 and ESO3, gene are positioned at Xq28.The mRNA longest 747bp of NY-ESO-1 genetic transcription, the protein of expression Relative molecular mass is 18KD, is made of 180 amino acid, and there are a hydrophobic amino acid tails for C-terminal, in NY-ESO-1 albumen On have potential trans-membrane region.Using the expression of RT-PCR and immunohistochemical method detection NY-ESO-l mRNA and its albumen Situation, researcher study NY-ESO-1 in the expression of the tumour of each system, the results showed that NY-ESO-1 is each swollen Tumor expression frequency is different, expressed in the tumor tissues such as neuroblastoma, synovial sarcoma, chromoma, oophoroma it is higher, Also there is different degrees of expression in colorectal cancer, liver cancer, bladder transitional cell carcinoma, Huppert's disease, lung cancer, but in some types Tumour such as the carcinoma of the rectum, kidney, leukaemia and lymphoma tissue in NY-ESO-1 expression it is lower, or even do not express.NY-ESO- 1 also has expression in the normal tissue, is mainly expressed in testis and ovary, and low expression is in uterus, but depositing due to blood-testis barrier The immunotoxicity that normal tissue is subjected to can be effectively controlled.The expression characteristic of NY-ESO-l presents good clinic and answers With prospect, become the research emphasis of domestic and foreign scholars.In recent years, NY-ESO-l is the important target spot of adoptive immunotherapy.

There is the tumour of high-affinity and specificity anti-tumour antigen due to being difficult to obtain out of most of tumor patient bodies Answering property T cell.Researcher gradually attempts the method by genetic engineering, and the specificity TCR gene of recognizable tumour antigen is led Enter patient T cells, to obtain specificity TCR gene transfecting T cells.I.e. by patient's anergic t cellular antigens specificity Reorientation (redirect) obtains tumor-reactive T cells.Basically, TCR is the molecular basis of T cell identification antigen. Just account for 80% or more α of periphery blood T lymphocyte sum⁺β⁺For T cell.Its TCR molecule is made of α, β double-strand, TCR α chain It is made of all on protein structure variable region (area V) and constant region (area C) two parts with β chain, wherein the area V is identification antigen Peptide/MHC compound (pMHC) key position.The area V of TCR α chain and β chain respectively contains the V plot structure there are three with immunoglobulin Similar hypervariable region, also referred to as complementary determining region (Complementarity Determining Region, CDR) are general to use CDRl, CDR2 and CDR3 are indicated.In addition, TCRV β chain also contains the 4th hypervariable region CDR4.It is formed by mechanism such as gene rearrangements With high multifarious TCR determine T cell identification antigen diversity, make mature T cells express TCR α β double-strand group (it can theoretically can reach 10 at ten million kind of antigen at one¹⁴Grade) combine antigen recognition receptor library (repertoire)

With enriching constantly for the correlation theories knowledges such as TCR diversity and TCR identification Antigenic Peptide/MHC complex machinery, tie Close the deep development of molecular biology and technique for gene engineering.The adoptive cell therapy of tumour gradually specifies a completely new think of Road-tcr gene engineering T cell (TCR gene engineered T cell).That is screening and clonal tumours specificity first Tcr gene, then with transfecting T cells assign its antigentic specificity, to obtain genetically engineered T cells with antigenic specificity, Tcr gene transfecting T cells are finally fed back into patient's body, rebuild the t cell immune response for being directed to antigen positive tumour.In recent years Come, many scholars isolate tumor associated antigen specificity TCR gene, then by slow virus, retrovirus or other Non-virus carrier is transduceed into T cell and is expressed, and it is thin to obtain the largely T with specific recognition antigenic capacity in a short time Born of the same parents, and a series of preclinical or clinical test has been carried out, achieve some gratifying achievements.

Initially originate from transgene mouse model with the research that α β tcr gene transfecting T cells assign antigentic specificity.Then Multiple research groups successfully make α β TCR double-strand Successful transfection be expressed in human leukemia cell line Jurkat.1999, first case It is transfected by tcr gene and assigns human peripheral T cell antigen specificity, make the experiment of its targets identification tumour antigen by Clay etc. People completes.They identify first and tumor-reactive T cells of the cloning from HLA-A2 type melanoma patients.It identifies again simultaneously The TCR base of recognizable MART-1 (tumour specific antigen for being expressed in most people melanoma cells) m9-27 peptide is cloned Cause, using retroviral vector, specificity TCR gene is transfected to come after the cDNA coded sequence that clone obtains tcr gene Derived from the CD8+T cell of HLA-A2 type healthy human peripheral blood T cell.Specificity TCR gene transfecting T cells can effectively be split in vitro Solve MART-1 positive K-1735.The knowledge of its tumour antigen is assigned using external source tcr gene transformation T cell to demonstrate The feasibility of other ability.Hereafter, researcher successfully obtains tcr gene for tumour antigens such as MDM2, LMP2 again, and with Successful transfection T cell, make tcr gene transfecting T cells treatment become immunotherapy of tumors new strategies.2006, Rosenberg etc. exists《SCINECE》It has delivered and has been controlled in the tcr gene transfecting T cells that first case carries out in melanoma patient The 1 phase clinical trial results treated.The tcr gene of MART-1 antigen-specific is transferred to patient by retroviral vector by the research Peripheral blood lymphocytes, then lymphocyte is fed back in patient body.The result shows that there is 2 to occur significantly in 17 patients Tumor regression.

Robbins research group feeds back the T cell of NY-ESO-1 antigen specific T CR gene modification thin to 6 synovial membranes Born of the same parents' sarcoma patients and 11 chromoma patients, as a result 4 synovial cell sarcom patients and 5 chromoma patients obtain Apparent therapeutic effect, patient including 2 complete incidence graphs, and apparent adverse reaction occurs without an example.Although TCR base Because the T cell of modification presents good clinical efficacy, but also there is researcher's discovery, the tumour of certain patients, which remains to escape, to be exempted from The killing of epidemic disease treatment.The discovery such as Klippel, receive to adopt after NY-ESO-1 specific T-cells therapy the pernicious melanocyte of recurrence again Tumor patient may be related with its internal cell MHC loss, so as to form immunologic escape.In addition, at present improve TCR affinity and The problem of TCR α β chain mismatch rate is tcr gene treatment urgent need to resolve is reduced, caused by TCR mispairing or excessively high etc. reasons of affinity Autoimmune disease is also very important.Equally, the tumor microenvironment of T cell and the safety issue of TCR also merit attention.This Outside, regulatory T cells, the inhibitory cells in medullary system source and some cell factors all can be to the gene modification T cells of input It has an impact, to influence the killing ability of T cell.The above result of study prompt, the treatment of tcr gene transfecting T cells are advanced in years The paces of clinical application out.

PD1 (programmed death 1) is initially obtained in the T cell hybridoma of apoptosis, due to itself and cell Apoptosis is related and is named as 1 receptor of programmed death.PD1 expression of receptor is in T cell surface and Primary B cells surface, at this It plays a role in the differentiation of a little cells and apoptosis.PD1 is PD-L1 (B7-H1) and PD-L2 (B7-DC) respectively there are two ligand, Belong to B7 family protein (Blood.2009.114 (8):p.1537-44.).PD-L1 albumen wide expression in antigen presenting cell, Activate T, B cell, macrophage, placental trophoblast, myocardium endothelium and thymic cortical epithelial cells.In PD-L1 and T cell by Body PD1 interaction, plays an important role in terms of the negativity regulation of immune response.Under normal circumstances, body encounters external When pathogen or antigen are invaded, antigen presenting cell captures antigen, carries out processing to antigen and makes what T cell can identify Epitope in conjunction with MHC molecule and is presented with cell outside for T cell identification.T cell passes through TCR and antigen presenting cell MHC molecule combine, in addition the B7-1 (CD80) or B7-2 (CD86) on costimulatory signal CD28 receptor and T cells surface are tied It closes, T cell is connected to positive regulation signal, and T cells activation is effector T cell, starts immune response.When there is lasting antigen to pierce When swashing, to avoid response excessive, activating T cell surface expression PD1 is thin to T in conjunction with the PD-L1 on antigen presenting cell surface Born of the same parents transmit negative regulation signal, and T cell proliferation reduces or apoptosis.The study found that detectable in many mankind tumor tissues To the expression of PD-L1 albumen, the microenvironment of tumor locus can induce the expression of PD-L1 on tumour cell, the PD-L1 and T of expression The PD1 of cell surface, which is combined, inhibits T cell anti-tumor activity, so that tumour cell be made to escape the monitoring of body immune system and clear It removes, is conducive to the generation and growth of tumour.

Although compound combine foreground is wide, current antineoplastic treatment window is generally relatively narrow, the effect of drug combination Still it is difficult to predict seriously constrain the performance of PD1 effect.University of Pennsylvania Edmund Moon professor is led with him Team has carried out a series of researchs for this use in conjunction strategy.In the TCR-T cell killing that NY-ESO-1 is Antigenic Target When tumour cell is tested, the phenomenon that anti-PD1 antibody is added, T cell hypofunction can be significantly improved；Correspondingly, subcutaneous in mouse In Transplanted tumor model, the tumor clearance ability of TCR-T cell is limited, and after giving the processing of PD1 antibody at the same time, then it can reach It totally disappeared purpose (the Clin Cancer Res.2016.22 (2) except tumour:p.436-47.).

Our patents are while also to express anti-human PD1 using the TCR α chain of NY-ESO-l and TCR β chain as the structure of TCR Segment.This patent modifies targeting TCR, introduces the segment of anti-human PD1, makes TCR-T cell and blocks PD1/PD- L1 combined signal application strategy inhibits microenvironment to obtain good improvement tumour immunity.It is also simultaneously clinical trial from now on It lays a good foundation.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected NY-ESO-1TCR α chain, the coded sequence of P2A, NY-ESO-1TCR β The coded sequence of chain, the coded sequence of T2A, the coded sequence of people's IL2 signal peptide, the heavy chain of anti-human PD1 monoclonal antibody and light The coded sequence polynucleotide sequence in series of chain variable region (aPD1scFv)；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, in the coded sequence coded sequence such as SEQ ID of the NY-ESO-1TCR α NO:Shown in 2 1-822 nucleotide sequences.In one or more embodiments, the coded sequence of the P2A such as SEQ ID NO:Shown in 2 823-903 nucleotide sequences.In one or more embodiments, the coding of the NY-ESO-1TCR β chain Sequence such as SEQ ID NO:Shown in 2 904-1830 nucleotide sequences.In one or more embodiments, the people T2A Coded sequence such as SEQ ID NO:Shown in 2 1831-1905 nucleotide sequences.In one or more embodiments, institute State the coded sequence such as SEQ ID NO of people's IL2 signal peptide:Shown in 2 1906-1965 nucleotide sequences.In one or more In embodiment, the heavy chain-coding sequence of the people PD1 monoclonal antibody such as SEQ ID NO:2 1966-2304 nucleotide Shown in sequence.In one or more embodiments, the light chain encoding sequences of the people PD1 monoclonal antibody such as SEQ ID NO: Shown in 2 2350-2670 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain the coded sequence of sequentially connected NY-ESO-1TCR α chain, the coded sequence of P2A, NY-ESO-1TCR β The coded sequence of chain, the coded sequence of T2A, the coded sequence of people's IL2 signal peptide, the heavy chain of anti-human PD1 monoclonal antibody and light The coded sequence of chain variable region (aPD1scFv) is connected in series coded sequence；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell；

In one or more embodiments, in the coded sequence coded sequence such as SEQ ID of the NY-ESO-1TCR α NO:Shown in 1 1-274 amino acids sequence.In one or more embodiments, the coded sequence of the P2A such as SEQ ID NO:Shown in 1 275-301 amino acids sequence.In one or more embodiments, the coding of the NY-ESO-1TCR β chain Sequence such as SEQ ID NO:Shown in 1 302-610 amino acids sequence.In one or more embodiments, the people T2A's Coded sequence such as SEQ ID NO:Shown in 1 611-635 amino acids sequence.In one or more embodiments, the people The coded sequence of IL2 signal peptide such as SEQ ID NO:Shown in 1 636-655 amino acids sequence.In one or more embodiment party In case, the heavy chain-coding sequence of the people PD1 monoclonal antibody such as SEQ ID NO:Shown in 1 656-768 amino acids sequence. In one or more embodiments, the light chain encoding sequences of the people PD1 monoclonal antibody such as SEQ ID NO:1 784- Shown in 890 amino acids sequences.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein.

Sixth aspect present invention provides a kind of pharmaceutical composition of T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or gene modification in the drug of the preparation treatment NY-ESO-1 disease mediated. In one or more embodiments, it is preferable that the disease that the NY-ESO-1 is mediated includes neuroblastoma, synovial membrane meat Tumor, chromoma, oophoroma；

It is highly preferred that the disease that the NY-ESO-1 is mediated include neuroblastoma, synovial sarcoma, chromoma, Oophoroma, colorectal cancer, liver cancer, bladder transitional cell carcinoma, Huppert's disease, lung cancer.

Detailed description of the invention

Fig. 1 is RV-NY-ESO-1TCR-aPD1 (NY-ESO-1-aPD1TCR-T) retrovirus expression vector schematic diagram.

Fig. 2 is the part of RV-NY-ESO-1TCR-aPD1 (NY-ESO-1-aPD1TCR-T) retrovirus expression plasmid Sequencing result peak value figure.

Fig. 3 is 72 hours NY-ESO-1TCR-T and NY-ESO-1- of FCM results show retroviral infection T cell The TCR expression efficiency of aPD1TCR-T.

Fig. 4 293T-PD1 overexpressing cell and NY-ESO-1TCR-aPD1 virus incubation 30min after stain anti-Human Fab result.

Fig. 5 is that the NY-ESO-1-aPD1TCR-T cell for preparing 5 days and target cell co-culture CD107a expression in 5 hours and examine It surveys.

Fig. 6 is that the secretion of the NY-ESO-1-aPD1TCR-T cell and target cell 5 hours IFN γs of co-cultivation that prepare 5 days is examined It surveys.

Fig. 7 be prepare 5 days NY-ESO-1TCR-T and NY-ESO-1-aPD1TCR-T cell and target cell co-cultivation it is 16 small When after to the lethal effect of tumour cell.

Fig. 8 be prepare 5 days NY-ESO-1TCR-T and NY-ESO-1-aPD1TCR-T and target cell co-culture 24 hours and The surface TCR-T PD1 is expressed after 48 hours.

Specific embodiment

The present invention provides a kind of T cell receptor (TCR) for targeting NY-ESO-1.The TCR contains sequentially connected NY-ESO- 1TCR α chain, P2A, NY-ESO-1TCR β chain, T2A, people IL2, anti-human PD1 monoclonal antibody heavy chain and light chain variable region (aPD1scFv) segment.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described TCR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:TCR, SEQ ID NO shown in 1 1-601 amino acids sequence:1 275- The mutant of TCR shown in 601 amino acids sequences.These mutant include：With the TCR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, the preferably at least 97% sequence identity and biology for retaining the TCR is living The amino acid sequence of property (such as activating T cell).The sequence between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used The column phase same sex.

Mutant further includes：In SEQ ID NO:1 amino acid sequence, SEQ ID NO shown in 1-601:1 275- There are one or several mutation (insertion, deletion or substitution), while still in the amino acid sequence of amino acid sequence shown in 601 Retain the amino acid sequence of the biological activity of the TCR.Several mutation are often referred within 1-10, such as 1-8, 1-5 or 1-3.Replace and is preferably conservative replaces.For example, in the art, with amino acid similar in performance When carrying out conservative replaces, the function of protein or polypeptide is not usually changed." amino acid similar in performance " includes For example, with similar side chain amino acid residue family, these families include have basic side chain amino acid (such as rely ammonia Acid, arginine, histidine), the amino acid (such as aspartic acid, glutamic acid) with acid side-chain, have uncharged pole Property side chain amino acid (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), tool There are amino acid (such as alanine, valine, leucine, isoleucine proline, phenylalanine, the first sulphur ammonia of non-polar sidechain Acid, tryptophan), with β-branched building block amino acid (such as threonine, valine, isoleucine) and with aromatic side chain Amino acid (such as tyrosine, phenylalanine, tryptophan, histidine).Therefore, with from the same side chain class in polypeptide of the present invention Another amino acid residue replace one or several sites, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (TCR).It can be according to expression vector before nucleic acid constructs is inserted into carrier Difference is required and is operated to nucleic acid constructs.The technology for changing polynucleotide sequence using recombinant DNA method is this Known to field.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription Column.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence is also possible to suitable leader sequence, to host cell translation The non-translational region of important mRNA.5 ' ends of leader sequence and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of TCR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus.

TCR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, TCR-T cell of the invention can differentiation in vivo at center remember sample state.

The anti-tumor immune response as caused by TCR-T cell can be active or passive immunity response.In addition, what TCR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of TCR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that TCR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and TCR-T can be used The disease of born of the same parents' treatment is preferably the disease that NY-ESO-1 is mediated.

The T cell of TCR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as TCR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, TCR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment NY-ESO-1 mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

Present invention search sequence information from NCBI GenBank database, full genome synthesize T cell receptor NY-ESO- The genetic fragment of 1TCR-aPD1 is inserted into retroviral vector RV.Recombinant plasmid packaging virus in 293T cell infects T Cell makes T cell express the T cell receptor.In one embodiment of the invention, the T of T cell receptor gene modification is realized The method for transformation of lymphocyte is based on Retroviral Transformation method.This method has high conversion efficiency, and foreign gene can Stablize expression, and the advantages that in vitro culture T lymphocyte reaches the time of clinical number of stages can be shortened.It is drenched in transgenosis T Bar cell surface, the nucleic acid of conversion by transcription, accurate translation on it.Present invention expression NY-ESO-1TCR's obtained Retrovirus prepares TCR-T cell by Retronectin method, and the TCR-T cell after preparation 3 days is infected with flow cytometer detection imitates Rate, TCR-T cell co-cultures 5 hours detection CD107a with the tumour cell of the NY-ESO-1 positive in vitro and expresses after preparation 5 days With the secretion of IFN γ, TCR-T cell co-cultures 16 hours methods with tumour cell in vitro and detects TCR-T cell pair after preparation 5 days The specific killing action (cytotoxicity) of tumour cell.Therefore NY-ESO-1-aPD1TCR-T of the present invention can be in HLA-A2 It is applied in the treatment of+NY-ESO-1 positive tumor.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, being the method and reagent of this field routine.

Embodiment 1：The determination of NY-ESO-1TCR-aPD1 gene order

Searching NY-ESO-1TCR α, NY-ESO-1TCR β, anti-PD1 heavy chain of antibody and light chain from NCBI site databases can Become area's gene sequence information, these sequences are in website http:Codon optimization is carried out on //sg.idtdna.com/CodonOpt, Guarantee to be more suitable for human cell's expression in the case where encoding amino acid sequence is constant.

Each amino acid and gene sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2).

Above-mentioned sequence full genome is synthesized, different restriction enzyme sites is being introduced from beginning to end, is forming complete NY-ESO-1TCR- APD1 gene sequence information.

Embodiment 2：The building of viral vectors comprising NY-ESO-1TCR-aPD1 nucleic acid sequence

By the nucleotide sequence of the CAR molecule prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The site NotI-EcoRI of T4 ligase (NEB) connection insertion retrovirus RV carrier, is transformed into competence E.coli (DH5 α), recombinant plasmid is served Hai Sheng work Bioisystech Co., Ltd to be sequenced, by sequencing result and the NY-ESO- being fitted to Whether 1TCR-aPD1 sequence alignment is correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC(SEQUNCE ID NO.3)

Antisense sequences:TGTTTGTCTTGTGGCAATACAC(SEQUNCE ID NO.4)

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6 × 10⁶Cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations；

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are that RV-NY-ESO-1TCR-aPD1 (MSCV) is 12.5ug, Gag-pol 10ug, VSVg For 6.25ug, CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；It is added in another pipe isometric with plasmid composite HBS, be vortexed when adding plasmid composite concussion 20s.Softly mixture is added in 293T ware along side, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating；

3. the 4th day：Supernatant is collected after transfection 48h and is stored in -80 degree with packing after the filtering of 0.45um filter, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treated culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activation two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4. in virus liquid adding hole, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubator after centrifugation.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Embodiment 5：The expression of T lymphocyte surface TCR after flow cytomery infection

72 hours after infecting TCR-T cells and NT cell (control group) are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery TCR expression, antibody is anti-human TCR V13.1antibody(Biolegend)。

The present embodiment result shows in Fig. 3, the retroviral infection T cell being prepared using embodiment 3 72 hours Afterwards, NY-ESO-1-TCR-T and NY-ESO-1-aPD1-TCR-T expression efficiency.TCR positive rate is respectively 74.3% and 81.2%.

Embodiment 6：Secreting type anti-PD1 expression in flow cytometer detection virus

NY-ESO-1TCR and NY-ESO-1TCR-aPD1 virus respectively with 293T-PD1 (our company preparation overexpression PD1 Cell) be incubated for 30min, then with anti-human Fab dyeing 30min after go up machine testing.The anti-PD1 that can so secrete is anti- Body is being detected by anti-human Fab antibody for humanization.

The present embodiment result such as Fig. 4 shows that streaming result detects that the anti-PD1 expression rate that can be secreted is 97.3%.

Embodiment 7：CD107a detection of expression after TCR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, every hole adds TCR-T/NT cell 2 × 10⁵A and target cell (U266, T2-NY-ESO- 1)/control cell (T2) 2 × 10⁵It is a, the X-VIVO complete medium for being free of IL-2 for 100ul is resuspended, BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), and 2ul CD107a antibody is added in every hole (1:50) it, is incubated for 4 hours for 37 DEG C, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3, CD4, CD8, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD107a expresses (Biolegend).

The present embodiment is as the result is shown in Fig. 5.NY-ESO-1-PD1-TCR-T cell and two target cells (U266, T2- NY-ESO-1 the percentage of CD107a expression is respectively 70.3% and 70.4% in CD8 positive cell after) co-culturing.

Embodiment 8：IFN γ secretion detects after TCR-T cell and target cell co-culture

1. taking the TCR-T cell prepared, it is resuspended with Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the every hole of experimental group contains target cell (U266, T2-NY-ESO-1) or negative control cell (T2) 2 × 10⁵It is a, TCR- T/NT cell 2 × 10⁵A, 100 μ l are free of the Lonza culture medium of IL-2.It is added after mixing well in 96 orifice plates.BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), and after mixing well, 37 DEG C of incubations 4 are small When.Cell is collected, as experimental group.

3. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer is cleaned cell 2 times, 1mL/ times.

5. carrying out factor dyeing intracellular, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation The cleaning cell 2 times of 30min, 1 × BD Perm/WashTMbuffer 1mL/ times, is then resuspended with PBS.

6. flow cytomery.

The present embodiment is as the result is shown in Fig. 6.NY-ESO-1-PD1-TCR-T cell and two target cells (U266, T2- NY-ESO-1 the percentage of IFN-γ expression is respectively 56.8% and 54.8% in CD8 positive cell after) co-culturing.

Embodiment 9：TCR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

1.K562 cell (negative control cell) is resuspended in serum free medium RPMI 1640, and adjustment cell concentration is 1 ×10⁶Fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino is added in/ml (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm is centrifuged 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh culture cleans twice of cell, and is resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

5.U266 cell (target cell) is suspended in the PBS containing 0.1%BSA, and adjustment concentration is 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end Concentration is 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated for, being added and being reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effect TCR-T cell is simultaneously suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

11. having infected the cell toxicant of the effector T cell (TCR-T cell) of NY-ESO-1-aPD1 in all experiments Property and the cytotoxicity of negative control effector T cell (NT cell) that is uninfected by compare, and these effector T cells come from The same patient.

12.NY-ESO-1-aPD1TCR-T and negative control effector T cell, according to T cell：Target cell=5:1,1:1, Ratio is cultivated in 5ml sterility test pipe (BD Biosciences).In each co-cultivation group, target cell is that Raji is thin Born of the same parents 100, and 000 (50 μ l), 100,000 K562 cell (50 μ l) of negative control cell.Being arranged one group simultaneously only includes U266 target cell and K562 negative control cell.

13. co-cultured cell is placed in 37 DEG C of incubation 16h.

14. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated for 30min on ice.

15. being not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

16. analysis uses the living cells gating of 7AAD feminine gender, it is thin to measure the U266 target lived after T cell and target cell co-cultivation The ratio of born of the same parents and K562 negative control cell living.

A) for the T cell of each group of co-cultivation and target cell,

Target cell survival %=U266 viable count/K562 viable count.

B) the target cell survival % of cytotoxic killer cell %=100- calibration, i.e., (U266 is living thin when no effector cell Born of the same parents' number-when containing effector cell U266 viable count)/K562 viable count ratio.

The present embodiment is as the result is shown in Fig. 7.Fig. 7 is shown, is 5 in effect target ratio:In the case of 1, NY-ESO-1-PD1TCR-T Cell is respectively 85% to the killing-efficiency of target cell HLA-A2-T2-NY-ESO-1.

Embodiment 10：TCR-T cell and target cell co-culture rear surface PD1 detection of expression

1. taking one piece of 96 orifice plate of the bottom V, every hole adds TCR-T/NT cell 2 × 10⁵A and target cell (U266), setting plus K562 Groups of cells is negative control, and the X-VIVO complete medium for 100ul containing IL-2 is resuspended, and 37 DEG C are incubated for 24 hours and 48 hours, Collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3, PD1, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

4. appropriate PBS is resuspended, flow cytomery CD3, PD1, PD1 expression in CD3+ cell mass is analyzed.

The present embodiment is as the result is shown in fig. 8.Fig. 8 shows, NY-ESO-1TCR-T and NY-ESO-1-PD1TCR-T cell The surface TCR-T PD1 is expressed after co-culturing 24 hours with target cell (U266).In U266 cell, the surface NY-ESO-1TCR-T PD1 expression rate is that the surface 28.4%, NY-ESO-1-PD1TCR-T PD1 expression rate is 17.2%.48H result trend is consistent.Explanation The NY-ESO-1-PD1TCR-T of this patent building can secrete PD1 and combine with PDL1, can adjust to immunosupress microenvironment Section.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>Target the antibody variable region T cell receptor Combined expression PD1 and application thereof of NY-ESO-1

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 890

<212> PRT

<213>Artificial sequence

<400> 1

Met Glu Thr Leu Leu Gly Leu Leu Ile Leu Trp Leu Gln Leu Gln Trp

1 5 10 15

Val Ser Ser Lys Gln Glu Val Thr Gln Ile Pro Ala Ala Leu Ser Val

20 25 30

Pro Glu Gly Glu Asn Leu Val Leu Asn Cys Ser Phe Thr Asp Ser Ala

35 40 45

Ile Tyr Asn Leu Gln Trp Phe Arg Gln Asp Pro Gly Lys Gly Leu Thr

50 55 60

Ser Leu Leu Leu Ile Gln Ser Ser Gln Arg Glu Gln Thr Ser Gly Arg

65 70 75 80

Leu Asn Ala Ser Leu Asp Lys Ser Ser Gly Arg Ser Thr Leu Tyr Ile

85 90 95

Ala Ala Ser Gln Pro Gly Asp Ser Ala Thr Tyr Leu Cys Ala Val Arg

100 105 110

Pro Leu Tyr Gly Gly Ser Tyr Ile Pro Thr Phe Gly Arg Gly Thr Ser

115 120 125

Leu Ile Val His Pro Tyr Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln

130 135 140

Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp

145 150 155 160

Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr

165 170 175

Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser

180 185 190

Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn

195 200 205

Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro

210 215 220

Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp

225 230 235 240

Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu

245 250 255

Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp

260 265 270

Ser Ser Arg Ala Lys Arg Ser Gly Ser Gly Ala Thr Asn Phe Ser Leu

275 280 285

Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ser Ile

290 295 300

Gly Leu Leu Cys Cys Ala Ala Leu Ser Leu Leu Trp Ala Gly Pro Val

305 310 315 320

Asn Ala Gly Val Thr Gln Thr Pro Lys Phe Gln Val Leu Lys Thr Gly

325 330 335

Gln Ser Met Thr Leu Gln Cys Ala Gln Asp Met Asn His Glu Tyr Met

340 345 350

Ser Trp Tyr Arg Gln Asp Pro Gly Met Gly Leu Arg Leu Ile His Tyr

355 360 365

Ser Val Gly Ala Gly Ile Thr Asp Gln Gly Glu Val Pro Asn Gly Tyr

370 375 380

Asn Val Ser Arg Ser Thr Thr Glu Asp Phe Pro Leu Arg Leu Leu Ser

385 390 395 400

Ala Ala Pro Ser Gln Thr Ser Val Tyr Phe Cys Ala Ser Ser Tyr Val

405 410 415

Gly Asn Thr Gly Glu Leu Phe Phe Gly Glu Gly Ser Arg Leu Thr Val

420 425 430

Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu

435 440 445

Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys

450 455 460

Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val

465 470 475 480

Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu

485 490 495

Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg

500 505 510

Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg

515 520 525

Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln

530 535 540

Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly

545 550 555 560

Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu

565 570 575

Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr

580 585 590

Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys

595 600 605

Asp Phe Arg Ala Lys Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu

610 615 620

Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Tyr Arg Met Gln

625 630 635 640

Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu Val Thr Asn Ser Gln

645 650 655

Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser

660 665 670

Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser Gly

675 680 685

Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala

690 695 700

Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val Lys

705 710 715 720

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe Leu

725 730 735

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

740 745 750

Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

755 760 765

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

770 775 780

Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu

785 790 795 800

Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu

805 810 815

Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr

820 825 830

Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser

835 840 845

Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu

850 855 860

Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr

865 870 875 880

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

885 890

<210> 2

<211> 2670

<212> DNA

<213>Artificial sequence

<400> 2

atggaaacac tgctgggcct gctgatcctg tggctgcagc tgcagtgggt gtccagcaag 60

caggaagtga cccagatccc tgccgccctg tctgtgcctg agggcgagaa cctggtgctg 120

aactgcagct tcaccgacag cgccatctac aacctgcagt ggttcagaca ggaccccggc 180

aagggcctga caagcctgct gctgattcag agcagccaga gagagcagac cagcggcaga 240

ctgaacgcca gcctggataa gagcagcggc cggtccaccc tgtatatcgc cgcttctcag 300

cctggcgact ccgccacata tctgtgtgct gtgcggcctc tgtacggcgg cagctacatc 360

cctaccttcg gcagaggcac cagcctgatc gtgcacccct acatccagaa ccccgacccc 420

gccgtgtacc agctgagaga cagcaagtcc agcgacaaga gcgtgtgcct gttcaccgac 480

ttcgacagcc agaccaacgt gtcccagagc aaggacagcg acgtgtacat caccgacaag 540

accgtgctgg acatgcggag catggacttc aagagcaaca gcgccgtggc ctggtccaac 600

aagagcgatt tcgcctgcgc caacgccttc aacaacagca ttatccccga ggacacattc 660

ttcccaagcc ccgagagcag ctgcgacgtg aagctggtgg aaaagagctt cgagacagac 720

accaacctga acttccagaa cctgagcgtg atcggcttcc ggattctgct gctgaaggtg 780

gccggcttca acctgctgat gaccctgaga ctgtggtcca gccgggccaa gagatctggc 840

agcggcgcca ccaatttcag cctgctgaaa caggccggcg acgtggaaga gaaccctggc 900

cctatgagca tcggcctgct gtgttgtgcc gctctgtccc tgctgtgggc cggacctgtg 960

aatgctggcg tgacacagac ccccaagttc caggtgctga aaaccggcca gagcatgacc 1020

ctgcagtgcg cccaggacat gaaccacgag tacatgagct ggtatcggca ggaccctggc 1080

atgggactgc ggctgatcca ctactctgtg ggcgccggca tcaccgatca gggcgaggtg 1140

cccaacggct acaatgtgtc cagatccacc accgaggact tcccactgag actgctgtct 1200

gccgccccta gccagacctc cgtgtacttc tgtgccagca gctacgtggg caacaccggc 1260

gagctgttct ttggcgaggg cagcagactg acagtgctgg aagatctgaa gaacgtgttc 1320

cccccagagg tggccgtgtt cgagccttct gaggccgaga tcagccacac ccagaaagcc 1380

accctcgtgt gtctggccac cggcttctac cccgaccacg tggaactgtc ttggtgggtc 1440

aacggcaaag aggtgcacag cggcgtgtcc accgatcccc agcctctgaa agagcagccc 1500

gccctgaacg acagccggta ctgtctgtcc tcccggctga gagtgtccgc caccttctgg 1560

cagaaccccc ggaaccactt cagatgccag gtgcagttct acggcctgag cgagaacgac 1620

gagtggaccc aggacagagc caagcccgtg actcagatcg tgtctgccga ggcctggggc 1680

agagccgatt gtggctttac cagcgagagc taccagcagg gcgtgctgag cgccaccatc 1740

ctgtacgaga tcctgctggg caaggccacc ctgtacgccg tgctggtgtc cgccctggtg 1800

ctgatggcca tggtcaaacg gaaggacttc agagccaagc ggggctctgg cgagggcaga 1860

ggctctctgc tgacctgcgg agatgtggaa gaaaatcccg gccctatgta cagaatgcag 1920

ctgttgtctt gtattgccct ttctctcgcc ctcgtaacaa attcacaagt ccaattggtg 1980

gagtctggcg gtggggtagt tcagcccggc cgatccctgc gcctggactg caaagcttct 2040

ggaattacgt tctcaaactc cggaatgcac tgggtgcggc aagcacctgg gaaagggctg 2100

gagtgggttg cggtgatttg gtacgatggc tctaagaggt actacgcaga cagcgttaaa 2160

ggcagattta ctatatcccg agataactct aaaaatacgc tcttcctcca aatgaatagc 2220

ctgagggcag aagacacagc cgtttactat tgtgctacca atgatgatta ctggggacag 2280

ggcaccctgg ttaccgtaag ttccggcggt ggtggaagtg gaggaggggg atccggaggc 2340

gggggttctg agatcgtcct gacccagtct ccagccactc tctccctgtc tccaggcgag 2400

cgcgctacac tgagttgtag agcttcccag tccgtgagca gctatctggc ctggtatcag 2460

cagaagcctg ggcaggctcc acggttgctg atttatgacg cctccaaccg cgcgactggg 2520

ataccagcta ggttttccgg atcaggcagc ggcactgatt ttacactgac catctcatct 2580

ctcgagccgg aagatttcgc cgtttactat tgtcaacaga gttcaaactg gccacggaca 2640

ttcggtcagg ggaccaaggt tgaaattaag 2670

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

<210> 5

<211> 6

<212> PRT

<213>Artificial sequence

<400> 5

Asp Ser Ala Ile Tyr Asn

1 5

<210> 6

<211> 7

<212> PRT

<213>Artificial sequence

<400> 6

Ile Gln Ser Ser Gln Arg Glu

1 5

<210> 7

<211> 13

<212> PRT

<213>Artificial sequence

<400> 7

Ala Val Arg Pro Leu Tyr Gly Gly Ser Tyr Ile Pro Thr

1 5 10

<210> 8

<211> 5

<212> PRT

<213>Artificial sequence

<400> 8

Met Asn His Glu Tyr

1 5

<210> 9

<211> 6

<212> PRT

<213>Artificial sequence

<400> 9

Ser Val Gly Ala Gly Ile

1 5

<210> 10

<211> 12

<212> PRT

<213>Artificial sequence

<400> 10

Ala Ser Ser Tyr Val Gly Asn Thr Gly Glu Leu Phe

1 5 10

Claims

1. a kind of T cell receptor (TCR), which is characterized in that it includes TCR α chain variable domain and TCR β chain variable domain, and it is described TCR α chain variable domain be and SEQ ID NO:1 1-274 amino acids sequence has the amino acid sequence of at least 90% sequence identity Column；And/or

The TCR β chain variable domain be and SEQ ID NO:1 302-610 has the amino acid sequence of at least 90% sequence identity Column；

Preferably, the amino acid sequence of the CDR3 of the TCR α chain variable domain is AVRPLYGGSYIPT (SEQ ID NO:7)；

And/or the amino acid sequence of the CDR3 of the TCR β chain variable domain is ASSYVGNTGELF (SEQ ID NO:10).

2. as claim 1 TCR, which is characterized in that 3 complementary determining regions (CDR) of the TCR α chain variable domain

For：

αCDR1-DSAIYN(SEQ ID NO:5)

αCDR2-IQSSQRE(SEQ ID NO:6)

αCDR3-AVRPLYGGSYIPT(SEQ ID NO:7)；And/or

3 complementary determining regions of the TCR β chain variable domain are：

βCDR1-MNHEY(SEQ ID NO:8)

βCDR2-SVGAGI(SEQ ID NO:9)

βCDR3-ASSYVGNTGELF(SEQ ID NO:10)。

3. a kind of multivalent TCR complex, which is characterized in that contain at least two TCR molecule, and at least one TCR therein Molecule is TCR described in any of the above-described claim.

4. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) containing the coded sequence of sequentially connected NY-ESO-1TCR α chain, the coded sequence of P2A, NY-ESO-1TCR β chain Coded sequence, the coded sequence of T2A, the coded sequence of people's IL2 signal peptide, the heavy chain of anti-human PD1 monoclonal antibody and light chain can The coded sequence for becoming area (aPD1scFv) is in series

(2) complementary series of (1) described polynucleotide sequence.

5. a kind of artificial synthesized polynucleotide sequence, which is characterized in that

The NY-ESO-1TCR α chain coding sequence such as SEQ ID NO:Shown in 2 1-822 nucleotide sequences；And/or

The coded sequence of the P2A such as SEQ ID NO:Shown in 2 823-903 nucleotide sequences；And/or

The NY-ESO-1TCR β chain coding sequence such as SEQ ID NO:Shown in 2 904-1830 nucleotide sequences；And/or

The T2A coded sequence such as SEQ ID NO:Shown in 2 1831-1905 nucleotide sequences；And/or

The coded sequence of the people IL2 signal peptide such as SEQ ID NO:Shown in 2 1906-1965 nucleotide sequences；And/or

The heavy chain variable region coded sequence such as SEQ ID NO of the anti-human PD1 monoclonal antibody:2 1966-2304 nucleotide Shown in sequence；And/or

The light chain variable region coded sequence such as SEQ ID NO of the anti-human PD1 monoclonal antibody:2 2350-2670 nucleotide Shown in sequence.

6. a kind of artificial synthesized amino acid sequence, which is characterized in that

The NY-ESO-1TCR α chain coding sequence such as SEQ ID NO:Shown in 1 1-274 amino acids sequence；And/or

The coded sequence of the P2A such as SEQ ID NO:Shown in 1 275-301 amino acids sequence；And/or

The NY-ESO-1TCR β chain coding sequence such as SEQ ID NO:Shown in 1 302-610 amino acids sequence；And/or

The T2A coded sequence such as SEQ ID NO:Shown in 1 611-635 amino acids sequence；And/or

The coded sequence of the people IL2 signal peptide such as SEQ ID NO:Shown in 1 636-655 amino acids sequence；And/or

The heavy chain variable region coded sequence such as SEQ ID NO of the anti-human PD1 monoclonal antibody:1 656-768 amino acids sequence Shown in column；And/or

The light chain variable region coded sequence such as SEQ ID NO of the anti-human PD1 monoclonal antibody:1 784-890 amino acids sequence Shown in column.

7. a kind of fusion protein, the fusion protein is selected from：

(1) containing the coded sequence of sequentially connected NY-ESO-1TCR α chain, the coded sequence of P2A, NY-ESO-1TCR β chain Coded sequence, the coded sequence of T2A, the coded sequence of people's IL2 signal peptide, the heavy chain of anti-human PD1 monoclonal antibody and light chain can The coded sequence for becoming area (aPD1scFv) is connected in series；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein as derived from (1) of cell activity.

8. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

9. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence described in claim 4；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence described in claim 4.

10. a kind of retrovirus, the retrovirus contains nucleic acid constructs as claimed in claim 6, preferably comprises institute Carrier is stated, the further preferably described retroviral vector.

11. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence as stated in claim 2, or contain nucleic acid constructs as claimed in claim 6, or infection Retrovirus as claimed in claim 7.

12. fusion protein described in any one of polynucleotide sequence described in claim 4, claim 7-8, right are wanted The application of nucleic acid constructs described in asking 9 or retrovirus described in any one of claim 10 in the T cell of preparation activation.

13. fusion protein described in any one of polynucleotide sequence described in any one of claim 4, claim 7-8, Gene described in nucleic acid constructs as claimed in claim 9, retrovirus described in any one of claim 10 or claim 12 is repaired The purposes of the T cell of decorations or its pharmaceutical composition in the drug of the preparation treatment NY-ESO-1 disease mediated；

Preferably, the disease that the NY-ESO-1 is mediated includes neuroblastoma, synovial sarcoma, chromoma, oophoroma；

It is highly preferred that the disease that the NY-ESO-1 is mediated includes neuroblastoma, synovial sarcoma, chromoma, ovary Cancer, colorectal cancer, liver cancer, bladder transitional cell carcinoma, Huppert's disease, lung cancer.