CN110551824B

CN110551824B - SNP molecular marker related to sperm storage capacity of hen and application thereof

Info

Publication number: CN110551824B
Application number: CN201810555246.3A
Authority: CN
Inventors: 李世军; 周慧敏; 莫长欢; 马帅
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2018-05-31
Filing date: 2018-05-31
Publication date: 2023-02-03
Anticipated expiration: 2038-05-31
Also published as: CN110551824A

Abstract

The invention provides an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, wherein 1 SNP molecular marker related to the sperm storage capacity of the hen is screened from the genome of the hen and is positioned on the chromosome 1 of the hen through the technical methods of genome-wide association analysis (GWAS) and restriction endonuclease length polymorphism (PCR-RFLP). The polymorphism of the SNP site is obviously related to the sperm storage capacity DN (the number of days between insemination and the last fertilized egg production) and FN (the number of fertilized eggs produced by the hen after insemination) of the hen, and the SNP molecular marker polymorphism site is represented as CC genotype, is a favorable marker of the sperm storage capacity of the hen, and can be used for screening and improving the sperm storage capacity of the hen.

Description

SNP molecular marker related to sperm storage capacity of hen and application thereof

Technical Field

The invention belongs to the technical field of livestock molecular markers, and particularly relates to 1 SNP molecular marker related to the sperm storage capacity of hens and application thereof.

Background

The sperm storage capacity of a hen refers to the ability of a hen to store sperm and continue to produce fertilized eggs after natural mating or Artificial Insemination (AI). In a population of many varieties or strains, researchers have found that there are significant individual differences in The ability of hens to store sperm, reflected in The number of fertilized eggs laid by a hen (FN) or The day of Duration (DN) after a natural mating or artificial insemination. In the process of poultry breeding and hatching egg production, the sperm storage capacity of hens is a key factor for determining the frequency of artificial insemination, for example, the sperm storage property of turkeys is as long as one to two months, so that the artificial insemination of the turkeys needs to be performed once a month in the production process of hatching eggs, and even for the turkeys which are about to be started for production, the artificial insemination can be performed half a month in advance to improve the yield of the hatching eggs (Bakst, 2010). While White leghorns and Jinghong hens (Jinghong brown chickens) generally have the sperm storage property of about two weeks, and sheldrake (Anas platyrhyncha domitheca) also has the sperm storage property of about 13 days (Lake and Stewart,1978 Blackburn et al, 2009 Liu et al, 2015), and artificial insemination on the White leghorns and the Jinghong hens generally needs to be performed once a week in order to ensure the fertility rate of over 90 percent of hatching eggs in production. Under the condition that the artificial insemination technology is generally adopted in the current large-scale intensive production, the hens with long semen storage capacity are selected, the semen storage character of the hens is improved, the artificial insemination frequency in the hatching egg production process can be effectively reduced, the feeding amount of breeding cocks is further reduced, the feeding cost is reduced, meanwhile, the stress response of the hens to the artificial insemination is reduced, and the production benefit is increased. SNPs and genome regions associated with the traits are detected by using genome-wide association analysis (GWAS), so that the working efficiency and the statistical effectiveness can be greatly improved. The research is to perform whole genome correlation analysis on chicken semen storage capacity by utilizing chicken whole genome SNP chips (600K, affymetrix), and to detect SNPs and genome regions related to the semen storage traits of hens in a whole genome range. The research works in national fund (project number: 31372301, project name: screening of new genes related to chicken sperm storage capacity difference and initial detection of molecular mechanism) and key research and transformation plan (project number: CGZH 2017000237) in autonomous innovation fund and major breeding project: the method is completed under the funding of a heat-resistant high-yield gene and a combination thereof (the project number is 2662018PY 088) discovered by a spit-Lai resource group.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, and 1 SNP molecular marker related to the sperm storage capacity is found on the chromosome 1 of a hen genome for the first time through whole genome association analysis.

The invention is realized by the following technical scheme:

an SNP molecular marker related to the sperm storage capacity of hens, which is positioned on chromosome 1, and the nucleotide sequence (SEQ ID NO. 1) of the molecular marker is as follows:

AAAAGCATTTGCATGAGATATATTARCATTTTATTCATGACAAAAGGAAAT

the base R at position 26 in the above sequence is A or C, resulting in polymorphism.

Obtained by screening according to the following method:

1) Collecting experimental samples: collecting a test chicken blood sample for DNA extraction;

2) And (3) determining the sperm storage capacity of the hen: measuring the number (FN) of fertilized eggs laid by hens and the number (DN) of continuous days after the artificial insemination of the test chicken for one time, repeatedly measuring for three times, and taking the average value of the results measured for three times as the semen storage capacity of the test chicken;

3) Extracting and detecting chicken genome DNA: extracting chicken genome DNA from a test chicken blood sample, and preparing a hen whole genome DNA sample;

4) Genotype judgment and correlation analysis of the genotype and the chicken sperm storage capacity:

hybridizing genome DNA extracted from a test chicken blood sample with a chicken 600K high-density SNP chip (Affymetrix Axiom), then performing quality control test on original genotype data of all individuals by adopting PLINK software, performing association analysis on test semen storage capacity and genotype by utilizing TASSEL statistical analysis software, and selecting SNP which achieves the genome level of a whole genome and is remarkable.

The polymorphism of the SNP locus is obviously related to semen storage capacity DN (the number of days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination) (P is less than 0.05), CC genotype is a favorable marker of the semen storage capacity of the hen, and the SNP molecular marker can be used for screening and improving the semen storage traits of the hen.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention utilizes a Genome wide association analysis (GWAS) technical method to screen and obtain SNPs molecular markers related to chicken semen storage capacity (Duration of fertility) in the whole Genome range of hens, and further utilizes a restriction fragment length polymorphism (PCR-RFLP) analysis method to verify the correlation between the SNP and the chicken semen storage capacity (Duration of fertility) in an expanded population. Provides 1 new SNP molecular marker for selecting and improving the sperm storage capacity of the hen by utilizing molecular marker assisted breeding.

Detailed Description

Example 1 screening of SNP molecular markers associated with the ability to store sperm in hens

1) Collecting experimental samples:

the experimental group is 701 healthy hens which are from a core breeding chicken farm of 'Jinghong No. 1' laying hens and a parental group (200 days old), and all hens are hatched in the same batch. The chickens were bred in Wuhanyukou poultry Co., ltd, and were bred in a single cage under 14-hour lighting conditions, and were fed with free food and water. During the raising period, the conditions of temperature, humidity, ventilation, light and the like are the same, and the method is a conventional method.

2) And (3) measuring sperm storage capacity:

taking 20 days as a period, semen is collected from the cock once, and the semen is required to be free of excrement, feather scraps and blood pollution, otherwise, the semen is discarded uniformly. The mixed semen is used for inseminating the hen (20 microliters/hen), the stimulation of an inseminating instrument is avoided during inseminating, and simultaneously, in order to avoid inseminating infection, the inseminating head is replaced once after inseminating once. The specific operation is carried out according to the technical protocol for artificial insemination of chicken (DB 12/T290-2006). Hatching eggs were collected and labeled with cage numbers. The same batch of hatching eggs were incubated at constant temperature (37.8 ℃, 50% relative humidity) for 7 days before egg candling, and fertilized and unfertilized hatching eggs were recorded.

The number of fertilized eggs (FN, the number of fertilized eggs after AI) and The number of days of Duration (DN) were measured after one artificial insemination of each hen, FN and DN were measured in triplicate, and The average of The results of The three measurements was taken as The sperm storing capacity of The test chicken.

After the experiment for measuring the sperm storage character of the hens is finished, 0.5mL of blood is collected from the infrawing veins of the test hens, the blood is placed into 1.5mL of an EP tube added with 0.3mL of anticoagulant in advance, and the blood is stored at the temperature of 20 ℃ below zero after being mixed evenly for DNA extraction.

3) And (3) extracting and detecting DNA:

extracting chicken genome DNA from a test chicken blood sample by adopting a phenol-chloroform method, and judging the integrity of the DNA by using gel electrophoresis; performing quality detection on the extracted DNA; the concentration was adjusted to 50 ng/. Mu.L, and a hen whole genome DNA sample was prepared.

4) Genotype judgment and correlation analysis of genotype data and chicken essence storage capacity:

according to the sperm storage capacity of the 701 hen groups in the former part, 60 hens with long and short sperm storage capacity are respectively screened, and the genome DNA of the hens is hybridized with a 600K high-density SNP chip (Affymetrix Axiom) of the hens. The genotype information of 552395 SNPs sites is successfully detected in the whole genome range, and the number of the residual SNPs is 341176 through quality control (the removal detection rate (Call rate) of SNPs is less than 90 percent, and the removal Minimum Allele Frequency (MAF) of SNPs is less than 5 percent). The applicant utilizes the TASSEL statistical analysis software to perform correlation analysis on the semen storage capacity and the genotype data of the test chicken flock, and a correlation analysis model is a mixed linear model:

Y＝S+K+e

wherein Y represents a tabular value; s represents a genotype effect; k represents an affinity matrix as a random effect of the model; e is the residual effect.

When the association P value of a certain SNP with the hen semen storage trait is less than 4.18E-06, the SNP is considered to be significantly associated with the hen semen storage trait.

5) Analysis results

Association analysis finds 1 SNP (AX-75548263, P (P) Ap 4.18E-06) which is obviously associated with the sperm storage property of hens, and the SNP is shown in Table 1.

TABLE 1 SNP sites significantly associated with the ability of hens to store sperm

*P<4.18E-06；

Example 2 validation of the SNP molecular marker

In order to verify the reliability of the results of the genome-wide association analysis, we performed restriction fragment length polymorphism (PCR-RFLP) analysis on SNP (AX-75548263) significantly associated with the semen storage trait in the genome-wide association analysis by using a population of 701 hens of which the semen storage capacity was determined, and compared the semen storage capacities DN and FN of individuals of different genotypes in the population, and the results are shown in Table 2. The results showed that the polymorphism at this SNP site was significantly associated with sperm storing capacity DN and FN (P < 0.05).

Table 2 correlation analysis results of SNP sites and hen sperm storage capacity.

Note: DN = number of days between insemination (once) and the last fertilized egg produced by the hen; FN = number of fertilized eggs laid by hens after insemination (once); significant differences were indicated between SNP genotypes with different shoulder markers in the same trait (P < 0.05). * Indicating significant difference, P <0.05; * Indicates a very significant difference P <0.01; the trait values in the table are mean ± sem.

Through PCR-RFLP analysis, 697 hen SNP sites AX-75548263 genotype information were obtained, wherein 300 AA genotypes, 21 CC genotypes and 376 AC genotypes were obtained. The SNP locus AX-75548263 polymorphism is obviously related to both chicken sperm storage capacities FN and DN (P < 0.05), and the number of fertilized eggs laid by hens with CC genotypes after insemination (once) is obviously more than that of hens with AA and AC genotypes (P < 0.05). Meanwhile, the number of days between the fertilization (once) of the hens with the CC genotype and the production of the last fertilized egg by the hens is obviously more than that of the hens with the AA and AC genotypes (p is less than 0.05), so that the CC genotype is a favorable marker for the sperm storage capacity of the hens and can be used for screening and improving the sperm storage traits of the hens.

Sequence listing

<110> university of agriculture in Huazhong

<120> SNP molecular marker related to hen semen storage capacity and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaaagcattt gcatgagata tattarcatt ttattcatga caaaaggaaa t 51

Claims

The application of the SNP molecular marker in screening and improving the sperm storage capacity of the Jinghong No.1 hen is characterized in that: the molecular marker sequence is AAAAGCATTTGCATGAGATATATTARCATTTTATTCATGACAAAAGGAAAT, the base R at the 26 th site of the sequence is A or C, polymorphism is caused, and the polymorphism site is CC genotype, so that the molecular marker is a favorable marker for the sperm storage capacity of hens.