CN110551824A - SNP molecular marker related to sperm storage capacity of hen and application thereof - Google Patents

SNP molecular marker related to sperm storage capacity of hen and application thereof Download PDF

Info

Publication number
CN110551824A
CN110551824A CN201810555246.3A CN201810555246A CN110551824A CN 110551824 A CN110551824 A CN 110551824A CN 201810555246 A CN201810555246 A CN 201810555246A CN 110551824 A CN110551824 A CN 110551824A
Authority
CN
China
Prior art keywords
hen
storage capacity
molecular marker
sperm
hens
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810555246.3A
Other languages
Chinese (zh)
Other versions
CN110551824B (en
Inventor
李世军
周慧敏
莫长欢
马帅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201810555246.3A priority Critical patent/CN110551824B/en
Publication of CN110551824A publication Critical patent/CN110551824A/en
Application granted granted Critical
Publication of CN110551824B publication Critical patent/CN110551824B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

the invention provides an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, wherein 1 SNP molecular marker related to the sperm storage capacity of the hen is screened from the genome of the hen and is positioned on the chromosome 1 of the hen through the technical methods of genome-wide association analysis (GWAS) and restriction endonuclease length polymorphism (PCR-RFLP). The polymorphism of the SNP site is obviously related to the sperm storage capacity DN (the number of days between insemination and the last fertilized egg production) and FN (the number of fertilized eggs produced by the hen after insemination) of the hen, and the SNP molecular marker polymorphism site is represented as CC genotype, is a favorable marker of the sperm storage capacity of the hen, and can be used for screening and improving the sperm storage capacity of the hen.

Description

SNP molecular marker related to sperm storage capacity of hen and application thereof
Technical Field
The invention belongs to the technical field of livestock molecular markers, and particularly relates to 1 SNP molecular marker related to the sperm storage capacity of hens and application thereof.
Background
The sperm storage capacity of a hen refers to the ability of a hen to store sperm and continue to produce fertilized eggs after natural mating or Artificial Insemination (AI). In a population of many breeds or lines, researchers have found that hens have significant individual differences in their sperm storage capacity, reflected in The number of fertilized eggs (FN) or The number of days of Duration (DN) of a day post-infection of The hens following a natural mating or artificial insemination. In the process of poultry breeding and hatching egg production, the sperm storage capacity of hens is a key factor for determining the frequency of artificial insemination, for example, the sperm storage property of turkeys is as long as one to two months, so that the artificial insemination of the turkeys needs to be performed once a month in the production process of hatching eggs, and even for the turkeys which are about to be started for production, the artificial insemination can be performed half a month in advance to improve the yield of the hatching eggs (Bakst, 2010). While the semen storage property of White leghorns (White leghorns) and red chicks (JingHong brown chickens) is only about two weeks generally, the semen storage property of sheldrake (Anas platyrhyncha domestica) is only about 13 days (Lake and Stewart, 1978; Blackburn et al, 2009; Liu et al, 2015), and artificial insemination on White leghorns (White leghorns) and red hens generally needs to be performed once a week in order to ensure more than 90% of egg fertilization rate in production. Under the condition that the artificial insemination technology is generally adopted in the current large-scale intensive production, the hens with long semen storage capacity are selected, the semen storage character of the hens is improved, the artificial insemination frequency in the hatching egg production process can be effectively reduced, the feeding amount of breeding cocks is further reduced, the feeding cost is reduced, meanwhile, the stress response of the hens to the artificial insemination is reduced, and the production benefit is increased. SNPs and genome regions associated with the traits are detected by using genome-wide association analysis (GWAS), so that the working efficiency and the statistical effectiveness can be greatly improved. The research is to perform whole genome correlation analysis on chicken semen storage capacity by utilizing a chicken whole genome SNP chip (600K, Affymetrix), and detect SNPs and genome regions related to the chicken semen storage traits in a whole genome range. The research works in national fund (project number: 31372301, project name: screening of new genes related to chicken essence storage capacity difference and molecular mechanism initial exploration) and key research and transformation plan (project number: CGZH2017000237) in autonomous Tibetan autonomous region and major breeding project of autonomous innovation fund: the method is completed under the funding of a heat-resistant high-yield gene and a combination thereof (item number: 2662018PY088) discovered by a Tu-Lai resource group.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, and 1 SNP molecular marker related to the sperm storage capacity is found on the chromosome 1 of a hen genome for the first time through whole genome association analysis.
The invention is realized by the following technical scheme:
An SNP molecular marker related to the sperm storage capacity of hens, which is positioned on chromosome 1, and the nucleotide sequence (SEQ ID NO.1) of the molecular marker is as follows:
AAAAGCATTTGCATGAGATATATTARCATTTTATTCATGACAAAAGGAAAT
the base R at position 26 in the above sequence is A or C, resulting in polymorphism.
Obtained by screening according to the following method:
1) Collecting experimental samples: collecting a test chicken blood sample for DNA extraction;
2) And (3) determining the sperm storage capacity of the hen: measuring the number (FN) of fertilized eggs laid by hens and the number (DN) of continuous days after one-time artificial insemination of the test chicken, repeatedly measuring for three times, and taking the average value of the measured results of the three times as the semen storage capacity of the test chicken;
3) Extracting and detecting chicken genome DNA: extracting chicken genome DNA from a test chicken blood sample, and preparing a hen whole genome DNA sample;
4) Genotype judgment and correlation analysis of genotype and chicken sperm storage capacity:
Hybridizing genome DNA extracted from a test chicken blood sample with a chicken 600K high-density SNP chip (Affymetrix Axiom), then performing quality control test on original genotype data of all individuals by adopting PLINK software, performing association analysis on test semen storage capacity and genotypes by utilizing TASSEL statistical analysis software, and selecting SNP with a genome level reaching the whole genome and being remarkable.
The polymorphism of the SNP locus is obviously related to semen storage capacity DN (the number of days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination) (P is less than 0.05), CC genotype is a favorable marker of the semen storage capacity of the hen, and the SNP molecular marker can be used for screening and improving the semen storage traits of the hen.
Compared with the prior art, the invention has the following advantages and beneficial effects:
The invention utilizes a Genome wide association analysis (GWAS) technical method to screen and obtain SNPs molecular markers related to chicken semen storage capacity (Duration of fertility) in the whole Genome range of hens, and further utilizes a restriction fragment length polymorphism (PCR-RFLP) analysis method to verify the correlation between the SNP and the chicken semen storage capacity (Duration of fertility) in an expanded population. Provides 1 new SNP molecular marker for selecting and improving the sperm storage capacity of the hen by utilizing molecular marker assisted breeding.
Detailed Description
Example 1 screening of SNP molecular markers associated with the ability to store sperm in hens
1) Collecting experimental samples:
The experimental group is 701 healthy hens which are from a core breeding chicken farm of 'Jinghong No. 1' laying hens and a parental group (200 days old), and all hens are hatched in the same batch. The chickens were bred in Wuhanyukou poultry Co., Ltd, and were bred in a single cage under 14-hour lighting conditions, and were fed with free food and water. During the raising period, the conditions of temperature, humidity, ventilation, illumination and the like are the same, and the method is a conventional method.
2) And (3) measuring semen storage capacity:
taking 20 days as a period, semen is collected from the cock once, and the semen is required to be free of excrement, feather scraps and blood pollution, otherwise, the semen is discarded uniformly. The mixed semen is used for inseminating the hen (20 microliters/hen), the stimulation of an inseminating instrument is avoided during inseminating, and simultaneously, in order to avoid inseminating infection, the inseminating head is replaced once after inseminating once. The specific operation is carried out according to the technical protocol for artificial insemination of chicken (DB 12/T290-2006). Hatching eggs were collected and labeled with cage numbers. The same batch of hatching eggs were incubated at constant temperature (37.8 ℃, relative humidity 50%) for 7 days before egg candling, and fertilized and unfertilized hatching eggs were recorded.
The number of fertilized eggs (FN, The number of fertilized eggs after AI) and The number of days of Duration (DN) were measured after one artificial insemination of each hen, FN and DN were measured in triplicate, and The average of The results of The three measurements was taken as The sperm storing capacity of The test chicken.
After the experiment for measuring the sperm storage character of the hens is finished, 0.5mL of blood is collected from the infrawing veins of the test hens, the blood is placed into 1.5mL of EP tube added with 0.3mL of anticoagulant in advance, and the blood is uniformly mixed and stored at the temperature of minus 20 ℃ for DNA extraction.
3) extraction and detection of DNA:
Extracting chicken genome DNA from a test chicken blood sample by adopting a phenol-chloroform method, and judging the integrity of the DNA by using gel electrophoresis; performing quality detection on the extracted DNA; the concentration was adjusted to 50 ng/. mu.L, and a hen whole genome DNA sample was prepared.
4) Genotype judgment and correlation analysis of genotype data and chicken essence storage capacity:
according to the sperm storage capacity of the 701 hen groups in the former part, 60 hens with long and short sperm storage capacity are screened respectively, and the genome DNA of the hens is hybridized with a 600K high-density SNP chip (Affymetrix Axiom). The genotype information of 552395 SNPs loci is successfully detected in the whole genome range, and the number of the remaining SNPs is 341176 through quality control (the rejection rate (Call rate) of SNPs is less than 90%, and the rejection Minimum Allele Frequency (MAF) of SNPs is less than 5%). The applicant utilizes the TASSEL statistical analysis software to perform correlation analysis on the semen storage capacity and the genotype data of the test chicken flock, and the correlation analysis model is a mixed linear model:
Y=S+K+e
Wherein Y represents a tabular value; s represents a genotype effect; k represents a genetic relationship matrix as a random effect of the model; e is the residual effect.
when the association P value of a certain SNP with the hen semen storage trait is less than 4.18E-06, the SNP is considered to be significantly associated with the hen semen storage trait.
5) Analysis results
association analysis found 1 SNP (AX-75548263, P <4.18E-06) which was significantly associated with the hen sperm storage trait, see Table 1.
TABLE 1 SNP sites significantly associated with the ability of hens to store sperm
*P<4.18E-06;
Example 2 validation of the SNP molecular marker
To verify the reliability of the results of genome-wide association analysis, we performed restriction fragment length polymorphism (PCR-RFLP) analysis on SNPs (AX-75548263) significantly associated with the sperm storage trait in genome-wide association analysis using a population of 701 hens for which sperm storage capacity was determined, and compared DN and FN sperm storage capacities of individuals of different genotypes in the population, as shown in Table 2. The results showed that the polymorphism at this SNP site was significantly associated with sperm storing capacity DN and FN (P < 0.05).
TABLE 2 correlation analysis of SNP sites with the ability of hens to store sperm.
note: DN is the number of days between insemination (once) and the last fertilized egg produced by the hen; FN is the number of fertilized eggs laid by the hens after insemination (once); significant differences were indicated between SNP genotypes with different shoulder markers in the same trait (P < 0.05). Indicates significant difference, P < 0.05; indicates a very significant difference P < 0.01; the trait values in the table are mean ± sem.
Through PCR-RFLP analysis, the genotype information of the SNP site AX-75548263 of 697 hens is obtained, wherein the number of AA genotypes is 300, the number of CC genotypes is 21, and the number of AC genotypes is 376. The SNP locus AX-75548263 polymorphism is obviously related to the sperm storage capacities FN and DN of the hens (P <0.05), and the number of fertilized eggs laid by the hens after insemination (once) by the hens with CC genotype is obviously more than that of the hens with AA and AC genotype (P < 0.05). Meanwhile, the number of days between the fertilization (once) of the hens with the CC genotype and the production of the last fertilized egg by the hens is obviously more than that of the hens with the AA and AC genotypes (p is less than 0.05), so that the CC genotype is a favorable marker for the sperm storage capacity of the hens and can be used for screening and improving the sperm storage traits of the hens.
Sequence listing
<110> university of agriculture in Huazhong
<120> SNP molecular marker related to sperm storage capacity of hen and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaaagcattt gcatgagata tattarcatt ttattcatga caaaaggaaa t 51

Claims (3)

1. An SNP molecular marker related to the sperm storage capacity of a hen, which is characterized in that the nucleotide sequence of the molecular marker is as follows:
AAAAGCATTTGCATGAGATATATTARCATTTTATTCATGACAAAAGGAAAT
the base R at position 26 in the above sequence is A or C, resulting in polymorphism.
2. The SNP molecular marker related to the sperm storing ability of hens as claimed in claim 1, wherein the polymorphic site of the molecular marker shows CC genotype and is a favorable marker of the sperm storing ability of hens.
3. the use of the SNP molecular markers related to the chicken sperm storing ability of claim 1 in the screening and improvement of the chicken sperm storing ability.
CN201810555246.3A 2018-05-31 2018-05-31 SNP molecular marker related to sperm storage capacity of hen and application thereof Active CN110551824B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810555246.3A CN110551824B (en) 2018-05-31 2018-05-31 SNP molecular marker related to sperm storage capacity of hen and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810555246.3A CN110551824B (en) 2018-05-31 2018-05-31 SNP molecular marker related to sperm storage capacity of hen and application thereof

Publications (2)

Publication Number Publication Date
CN110551824A true CN110551824A (en) 2019-12-10
CN110551824B CN110551824B (en) 2023-02-03

Family

ID=68735340

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810555246.3A Active CN110551824B (en) 2018-05-31 2018-05-31 SNP molecular marker related to sperm storage capacity of hen and application thereof

Country Status (1)

Country Link
CN (1) CN110551824B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112735515A (en) * 2020-12-25 2021-04-30 华中农业大学 Method for screening candidate sites of breeding hen sperm storage capacity character and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105506086A (en) * 2015-12-25 2016-04-20 华中农业大学 SNP molecular markers related to chicken-fertilization duration time characters and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105506086A (en) * 2015-12-25 2016-04-20 华中农业大学 SNP molecular markers related to chicken-fertilization duration time characters and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AFFYMETRIX: "Axiom_GW_GT_Chicken] 600K Affymetrix Axiom® HD Genotyping Array", 《NCBI,GEO DATASETS》 *
ANDREAS KRANIS 等: "Development of a high density 600K SNP genotyping array for chicken", 《BMC GENOMICS》 *
王文浩等: "京海黄鸡禽流感抗病性状的全基因组关联分析", 《中国畜牧兽医》 *
许东伟: "京红京粉祖代蛋鸡贮精能力重复率估计、差异相关基因筛选及cSNP关联分析", 《万方学位论文》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112735515A (en) * 2020-12-25 2021-04-30 华中农业大学 Method for screening candidate sites of breeding hen sperm storage capacity character and application
CN112735515B (en) * 2020-12-25 2024-02-02 华中农业大学 Method for screening candidate sites of sperm storage capacity traits of breeding hens and application

Also Published As

Publication number Publication date
CN110551824B (en) 2023-02-03

Similar Documents

Publication Publication Date Title
CN114480673B (en) Chicken low-density SNP liquid phase chip based on targeted capture sequencing and application thereof
KR102077917B1 (en) Genetic maker for parentage and thereof in Olive flounder
CN108220408B (en) Grain-saving green-shin recessive white feather broiler new strain breeding method
CN108676897B (en) SNP marker influencing daily gain traits of pigs and application thereof
CN101619354A (en) Method for identifying fast and slow feather molecules of chickens
CN116287318B (en) Seed production method of high-propagation slow-feather high-quality broiler new strain
CN113430277A (en) Primer group for identifying sex-linked dwarf gene and application thereof
CN111979332B (en) SNP molecular marker for selecting fertilization rate of hen during sperm storage capacity and application thereof
CN110551823B (en) SNP molecular marker related to sperm storage capacity of hen and application thereof
CN109943639B (en) SNP molecular marker for selecting hen semen storage capacity and application thereof
CN113430285B (en) Molecular marker related to Muscovy duck breeding traits and application
CN113549699B (en) Genome selection method for egg yield of white-feather broilers
CN110499369B (en) SNP molecular marker for selecting hen semen storage capacity and application thereof
CN110551824B (en) SNP molecular marker related to sperm storage capacity of hen and application thereof
CN111979331B (en) SNP molecular marker related to fertilization rate during hen sperm storage capacity
CN108570508B (en) Molecular marker related to chicken beak malformation character and application thereof
CN109439763B (en) Molecular marker for identifying 817 broiler chickens and yellow-leg free-range chickens and application
CN114271237B (en) Method for breeding long-short velvet self-sexing pigeons
CN111979335A (en) SNP molecular marker for selecting fertilization rate of hen during sperm storage capacity and application thereof
CN111979334A (en) SNP molecular marker related to fertilization rate during hen sperm storage capacity
CN108004332B (en) It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown
CN109943640B (en) SNP molecular marker related to sperm storage capacity of hen and application thereof
CN110452990B (en) SNP molecular marker for selecting laying rate of hens in later laying period and application thereof
CN107937568A (en) A kind of new opplication and its method of PRLR genes
CN110878363B (en) Detection method and application of correlation between VIPR1 gene and chicken testicular character

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant