CN109943640B - SNP molecular markers related to sperm storage ability of hens and their applications - Google Patents
SNP molecular markers related to sperm storage ability of hens and their applications Download PDFInfo
- Publication number
- CN109943640B CN109943640B CN201711388334.0A CN201711388334A CN109943640B CN 109943640 B CN109943640 B CN 109943640B CN 201711388334 A CN201711388334 A CN 201711388334A CN 109943640 B CN109943640 B CN 109943640B
- Authority
- CN
- China
- Prior art keywords
- hen
- sperm
- hens
- sperm storage
- storage capacity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 230000009303 sperm storage Effects 0.000 title claims abstract description 29
- 235000013601 eggs Nutrition 0.000 claims abstract description 24
- 230000009027 insemination Effects 0.000 claims abstract description 23
- 239000003147 molecular marker Substances 0.000 claims abstract description 16
- 230000002349 favourable effect Effects 0.000 claims abstract description 4
- 239000003550 marker Substances 0.000 claims abstract description 4
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 abstract description 10
- 238000012098 association analyses Methods 0.000 abstract description 8
- 238000000034 method Methods 0.000 abstract description 5
- 238000012216 screening Methods 0.000 abstract description 5
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 abstract description 3
- 210000000349 chromosome Anatomy 0.000 abstract description 2
- 108091008146 restriction endonucleases Proteins 0.000 abstract 1
- 241000287828 Gallus gallus Species 0.000 description 23
- 235000013330 chicken meat Nutrition 0.000 description 23
- 210000000582 semen Anatomy 0.000 description 21
- 238000003860 storage Methods 0.000 description 18
- 238000012360 testing method Methods 0.000 description 10
- 239000008280 blood Substances 0.000 description 8
- 210000004369 blood Anatomy 0.000 description 8
- 230000012447 hatching Effects 0.000 description 7
- 238000010219 correlation analysis Methods 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 4
- 238000009395 breeding Methods 0.000 description 4
- 230000001488 breeding effect Effects 0.000 description 4
- 241000286209 Phasianidae Species 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000013011 mating Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000272522 Anas Species 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 210000003746 feather Anatomy 0.000 description 1
- 230000004720 fertilization Effects 0.000 description 1
- 244000144992 flock Species 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000005286 illumination Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 235000013594 poultry meat Nutrition 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000003938 response to stress Effects 0.000 description 1
- 230000000638 stimulation Effects 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
- 238000009423 ventilation Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an SNP molecular marker associated with the sperm storage capability of a hen and application thereof, wherein 1 SNP molecular marker associated with the sperm storage capability of the hen is screened on the genome of the hen for the first time and is positioned on the No. 3 chromosome of the hen through the technical methods of genome-wide association analysis (GWAS) and restriction endonuclease length polymorphism (PCR-RFLP). The polymorphism of the SNP locus is obviously related to the sperm storage capacity character DN (the number of days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination), and the SNP molecular marker is a GG genotype, is a favorable marker for the sperm storage capacity of the hen, and can be used for screening and improving the sperm storage capacity of the hen.
Description
Technical Field
The invention belongs to the technical field of livestock molecular markers, and particularly relates to 1 SNP molecular marker related to the sperm storage capacity of hens and application thereof.
Background
The sperm storage capacity of a hen refers to the ability of a hen to store sperm and continue to produce fertilized eggs after natural mating or Artificial Insemination (AI). In a population of many breeds or lines, researchers have found that hens have significant individual differences in their sperm storage capacity, reflected in The number of fertilized eggs (FN) or The number of days of Duration (DN) of a day post-infection of The hens following a natural mating or artificial insemination. In the process of poultry breeding and hatching egg production, the sperm storage capacity of hens is a key factor for determining the frequency of artificial insemination, for example, the sperm storage property of turkeys is as long as one to two months, so that the artificial insemination of the turkeys needs to be performed once a month in the production process of hatching eggs, and even for the turkeys which are about to be started for production, the artificial insemination can be performed half a month in advance to improve the yield of the hatching eggs (Bakst, 2010). While the semen storage property of White leghorns (White leghorns) and red chicks (JingHong brown chickens) is only about two weeks generally, the semen storage property of sheldrake (Anas platyrhyncha domestica) is only about 13 days (Lake and Stewart, 1978; Blackburn et al, 2009; Liu et al, 2015), and artificial insemination on White leghorns (White leghorns) and red hens generally needs to be performed once a week in order to ensure more than 90% of egg fertilization rate in production. Under the condition that the artificial insemination technology is generally adopted in the current large-scale intensive production, the hens with long semen storage capacity are selected, the semen storage character of the hens is improved, the artificial insemination frequency in the hatching egg production process can be effectively reduced, the feeding amount of breeding cocks is further reduced, the feeding cost is reduced, meanwhile, the stress response of the hens to the artificial insemination is reduced, and the production benefit is increased. SNPs and genome regions associated with the traits are detected by using genome-wide association analysis (GWAS), so that the working efficiency and the statistical effectiveness can be greatly improved. The research is the first report that the chicken whole genome SNP chip (600K, Affymetrix) is used for carrying out whole genome correlation analysis on chicken semen storage capability, and SNPs and genome regions related to the chicken semen storage traits are detected in the whole genome range.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, and 1 SNP molecular marker related to the sperm storage capacity is found on the 3 # chromosome of a hen genome for the first time through whole genome association analysis.
The invention is realized by the following technical scheme:
an SNP molecular marker related to the sperm storing capability of a hen, wherein the nucleotide sequence of the molecular marker is GTCACCACTGCTCACACGAGACCCASAATGTTTTCTCTTACCTACATGCAC, and the 26 th base S is C or G, so that polymorphism is caused. Obtained by screening according to the following method:
1) collecting experimental samples: collecting a test chicken blood sample for DNA extraction;
2) and (3) determining the sperm storage capacity of the hen: measuring the number (FN) of fertilized eggs laid by hens and the number (DN) of continuous days after one-time artificial insemination of the test chicken, repeatedly measuring for three times, and taking the average value of the measured results of the three times as the semen storage capacity of the test chicken;
3) extracting and detecting chicken genome DNA: extracting chicken genome DNA from a test chicken blood sample, and preparing a hen whole genome DNA sample;
4) genotype judgment and correlation analysis of genotype and chicken sperm storage capacity:
hybridizing genome DNA extracted from a test chicken blood sample with a chicken 600K high-density SNP chip (Affymetrix Axiom), then performing quality control test on original genotype data of all individuals by adopting PLINK software, performing association analysis on test semen storage capacity and genotypes by utilizing TASSEL statistical analysis software, and selecting SNP with a genome level reaching the whole genome and being remarkable.
The polymorphism of the SNP locus is obviously related to semen storage capacity DN (the number of days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination) (P is less than 0.05), GG genotype is a favorable marker of the semen storage capacity of the hen, and the SNP molecular marker can be used for screening and improving the semen storage traits of the hen.
Compared with the prior art, the invention has the following advantages and beneficial effects:
the invention firstly utilizes a Genome wide association analysis (GWAS) technical method to screen and obtain SNPs molecular markers related to chicken semen storage capacity (Duration of preference) in the whole Genome range of hens, and further adopts a restriction fragment length polymorphism (PCR-RFLP) analysis method to verify the correlation of the SNP and the chicken semen storage capacity (Duration of preference) in an expanded population. Provides 1 new SNP molecular marker for selecting and improving the sperm storage capacity of the hen by utilizing molecular marker assisted breeding.
Detailed Description
Example 1 screening of SNP molecular markers associated with the ability to store sperm in hens
1) Collecting experimental samples:
the experimental group is 701 healthy hens, is derived from a parent group (200 days old) of a core breeding chicken farm of 'Jinghong No. 1' laying hens, and all the hens are hatched in the same batch. The chickens were bred in Wuhanyukou poultry Co., Ltd, and were bred in a single cage under 14-hour lighting conditions, and were fed with free food and water. During the raising period, the conditions of temperature, humidity, ventilation, illumination and the like are the same, and the method is a conventional method.
2) And (3) measuring semen storage capacity:
taking 20 days as a period, semen is collected from the cock once, and the semen is required to be free of excrement, feather scraps and blood pollution, otherwise, the semen is discarded uniformly. The mixed semen is used for inseminating the hen (20 microliters/hen), the stimulation of an inseminating instrument is avoided during inseminating, and simultaneously, in order to avoid inseminating infection, the inseminating head is replaced once after inseminating once. The specific operation is carried out according to the technical protocol for artificial insemination of chicken (DB 12/T290-2006). Hatching eggs were collected and labeled with cage numbers. The same batch of hatching eggs were incubated at constant temperature (37.8 ℃, relative humidity 50%) for 7 days before egg candling, and fertilized and unfertilized hatching eggs were recorded.
The number of fertilized eggs (FN, The number of fertilized eggs after AI) and The number of days of Duration (DN) were measured after one artificial insemination of each hen, FN and DN were measured in triplicate, and The average of The results of The three measurements was taken as The sperm storing capacity of The test chicken.
After the experiment for measuring the sperm storage character of the hens is finished, 0.5mL of blood is collected from the infrawing veins of the test hens, the blood is placed into 1.5mL of EP tube added with 0.3mL of anticoagulant in advance, and the blood is uniformly mixed and stored at the temperature of minus 20 ℃ for DNA extraction.
3) Extraction and detection of DNA:
extracting chicken genome DNA from a test chicken blood sample by adopting a phenol-chloroform method, and judging the integrity of the DNA by using gel electrophoresis; performing quality detection on the extracted DNA; the concentration was adjusted to 50 ng/. mu.L, and a hen whole genome DNA sample was prepared.
4) Genotype judgment and correlation analysis of genotype data and chicken essence storage capacity:
according to the sperm storage capacity of the 701 hen groups in the former part, 60 hens with long and short sperm storage capacity are screened respectively, and the genome DNA of the hens is hybridized with a 600K high-density SNP chip (Affymetrix Axiom). The genotype information of 552395 SNPs loci is successfully detected in the whole genome range, and the number of the remaining SNPs is 341176 through quality control (the rejection rate (Call rate) of SNPs is less than 90%, and the rejection Minimum Allele Frequency (MAF) of SNPs is less than 5%). The applicant utilizes the TASSEL statistical analysis software to perform correlation analysis on the semen storage capacity and the genotype data of the test chicken flock, and the correlation analysis model is a mixed linear model:
Y＝S+K+e
wherein Y represents a tabular value; s represents a genotype effect; k represents a genetic relationship matrix as a random effect of the model; e is the residual effect.
When the association P value of a certain SNP with the hen semen storage trait is less than 4.18E-06, the SNP is considered to be significantly associated with the hen semen storage trait.
5) Analysis results
Association analysis found 1 SNP (AX-80861605, P <4.18E-06) which was significantly associated with the hen sperm storage trait, see Table 1.
TABLE 1 SNP sites significantly associated with the ability of hens to store sperm
*P<4.18E-06；
Example 2 validation of the SNP molecular marker
To verify the reliability of the results of genome-wide association analysis, we performed restriction fragment length polymorphism (PCR-RFLP) analysis on SNPs (AX-80861605) significantly associated with the sperm storage trait in genome-wide association analysis using a population of 701 hens for which sperm storage capacity was determined, and compared DN and FN sperm storage capacities of individuals of different genotypes in the population, as shown in Table 2. The results showed that the polymorphism at this SNP site was significantly associated with sperm storing capacity DN and FN (P < 0.05).
TABLE 2 correlation analysis of SNP sites with the ability of hens to store sperm.
Note: DN is the number of days between insemination (once) and the last fertilized egg produced by the hen; FN is the number of fertilized eggs laid by the hens after insemination (once); significant differences were indicated between SNP genotypes with different shoulder markers in the same trait (P < 0.05). Indicates significant difference, P < 0.05; indicates a very significant difference P < 0.01; the trait values in the table are mean ± sem.
Through PCR-RFLP analysis, the genotype information of 554 hen SNP sites AX-80861605 is obtained, wherein 365 CC genotypes are provided, 140 GC genotypes are provided, and 49 GG genotypes are provided. The SNP locus AX-80861605 polymorphism is obviously related to the sperm storage capacities FN and DN of the hens (P <0.05), and the number of fertilized eggs laid by the hens after insemination (once) by the hens with the GG genotype is obviously more than that of the hens with the CC genotype (P < 0.01). Meanwhile, the days between the insemination of the hen with the GG genotype (once) and the production of the last fertilized egg by the hen are obviously more than those of the hen with the CC genotype (p is less than 0.01), so that the GG genotype is a favorable marker for the sperm storage capacity of the hen and can be used for screening and improving the sperm storage property of the hen.
Sequence listing
<110> university of agriculture in Huazhong
<120> SNP molecular marker related to sperm storage capacity of hen and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtcaccactg ctcacacgag acccacaatg ttttctctta cctacatgca c 51
<210> 2
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcaccactg ctcacacgag acccagaatg ttttctctta cctacatgca c 51
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711388334.0A CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular markers related to sperm storage ability of hens and their applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711388334.0A CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular markers related to sperm storage ability of hens and their applications |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109943640A CN109943640A (en) | 2019-06-28 |
| CN109943640B true CN109943640B (en) | 2021-08-03 |
Family
ID=67004324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711388334.0A Active CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular markers related to sperm storage ability of hens and their applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109943640B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506086A (en) * | 2015-12-25 | 2016-04-20 | 华中农业大学 | SNP molecular markers related to chicken-fertilization duration time characters and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BRPI0415079A (en) * | 2003-10-06 | 2006-12-12 | Novartis Ag | biomarkers for prognosis of drug-induced diarrhea |
| CN100425703C (en) * | 2004-04-14 | 2008-10-15 | 华中农业大学 | MHC-B-LB gene PCR-RFLP/abel relative to chicken egg productivity |
-
2017
- 2017-12-20 CN CN201711388334.0A patent/CN109943640B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506086A (en) * | 2015-12-25 | 2016-04-20 | 华中农业大学 | SNP molecular markers related to chicken-fertilization duration time characters and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| rs313486173;Ensembl release 92;《EMBL-EBI》;20170831;第1页 * |
| Sperm Mobility: Phenotype in Roosters (Gallus domesticus) Determined by Mitochondrial Function;D. P. Froman等;《BIOLOGY OF REPRODUCTION》;20041110;第72卷;第562–567页 * |
| 鸡贮精腺差异表达基因neurexophilin的单核苷酸多态性分析;刘桂琼等;《中国畜牧兽医学会动物繁殖学分会第十五届学术研讨会论文集》;20100831;第345-349页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109943640A (en) | 2019-06-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ahmad et al. | The domestication makeup: Evolution, survival, and challenges | |
| CN114480673A (en) | Chicken low-density SNP liquid phase chip based on targeted capture sequencing and application thereof | |
| CN109971865B (en) | SNP marker significantly related to weight traits of litopenaeus vannamei and application | |
| KR102077917B1 (en) | Genetic maker for parentage and thereof in Olive flounder | |
| CN101619354A (en) | Method for identifying fast and slow feather molecules of chickens | |
| CN106701931B (en) | SNP marker related to rapid growth of Micropterus salmoides 'Youbei No. 1' and application thereof | |
| JP2010538643A5 (en) | ||
| CN102352410B (en) | Method for rapidly improving number of eggs produced by Bian chicken through DNA (deoxyribonucleic acid) labeling | |
| CN109943639B (en) | SNP molecular markers for selecting sperm storage ability of hens and their applications | |
| CN111979332B (en) | SNP molecular marker for selecting fertilization rate of hen during sperm storage capacity and application thereof | |
| CN110551823B (en) | SNP molecular marker related to sperm storage capacity of hen and application thereof | |
| CN115927649A (en) | SNP Genetic Marker Related to Chicken Belly Fat Rate and Its Application | |
| CN110499369B (en) | SNP molecular marker for selecting hen semen storage capacity and application thereof | |
| CN111979331B (en) | SNP molecular marker related to fertilization rate during hen sperm storage capacity | |
| CN109943640B (en) | SNP molecular markers related to sperm storage ability of hens and their applications | |
| CN110551824B (en) | SNP molecular marker related to sperm storage capacity of hen and application thereof | |
| CN114271237B (en) | A kind of breeding method of long-short-velvet self-separating male and female pigeons | |
| CN108004332B (en) | It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown | |
| CN101016565A (en) | Method of identifying chicken variety by DNA strip shape coding | |
| CN110452990B (en) | SNP Molecular Markers for Selecting Egg Production Rates in Late Laying Hens and Their Applications | |
| CN107868835B (en) | SNP molecular marker related to sheep tail width and application thereof | |
| CN111979335A (en) | SNP molecular marker for selecting fertilization rate of hen during sperm storage capacity and application thereof | |
| CN111979334A (en) | SNP molecular marker related to fertilization rate during hen sperm storage capacity | |
| CN111197089B (en) | SNP Molecular Markers for Selecting Egg Production Rates in Late Laying Hens and Their Applications | |
| CN118460741B (en) | USP37 gene molecular marker related to pigeon egg laying interval characters and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |