CN110551823B

CN110551823B - SNP molecular marker related to sperm storage capacity of hen and application thereof

Info

Publication number: CN110551823B
Application number: CN201810553869.7A
Authority: CN
Inventors: 李世军; 莫长欢; 马帅; 周慧敏
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2018-05-31
Filing date: 2018-05-31
Publication date: 2023-02-03
Anticipated expiration: 2038-05-31
Also published as: CN110551823A

Abstract

The invention provides SNP molecular markers related to the sperm storage capacity of hens and application thereof, wherein 1 SNP molecular marker related to the sperm storage capacity of the hens is screened from a hen genome and is positioned on a hen No. 3 chromosome through a genome-wide association analysis (GWAS) and restriction endonuclease length polymorphism (PCR-RFLP) technical method. The polymorphism of the SNP locus is obviously associated with the sperm storage capacity DN (days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination), and the SNP molecular marker polymorphism locus is represented by GG genotype, is a negative marker of the sperm storage capacity of the hen, and can be used for screening and improving the sperm storage capacity of the hen.

Description

SNP molecular marker related to sperm storage capacity of hen and application thereof

Technical Field

The invention belongs to the technical field of livestock molecular markers, and particularly relates to 1 SNP molecular marker related to the sperm storage capacity of hens and application thereof.

Background

The sperm storage capacity of a hen refers to the ability of a hen to store sperm and continue to produce fertilized eggs after natural mating or Artificial Insemination (AI). In a population of many breeds or lines, researchers have found that hens have significant individual differences in their sperm storage capacity, reflected in differences in The number of fertilized eggs (FN) or The number of fertilized egg eggs (DN) or The day of life (The day post-infection free The last egg) of hens following a single natural mating or artificial insemination. In the process of poultry breeding and hatching egg production, the sperm storage capacity of hens is a key factor for determining the frequency of artificial insemination, for example, the sperm storage property of turkeys is as long as one to two months, so that the artificial insemination of the turkeys needs to be performed once a month in the production process of hatching eggs, and even for the turkeys which are about to be started for production, the artificial insemination can be performed half a month in advance to improve the yield of the hatching eggs (Bakst, 2010). While the semen storage property of White leghorns (White leghorns) and red chicks (JingHong brown chickens) is generally only about two weeks, the semen storage property of sheldrake (Anas platyrhyncha domestica) is also about 13 days (Lake and Stewart, 197burn et al, 2009 liu et al, 2015), and artificial insemination for the White leghorns and red hens is generally performed once a week in order to ensure the fertilization rate of over 90 percent of eggs in production. Under the condition that the artificial insemination technology is generally adopted in the current large-scale intensive production, the hens with long semen storage capacity are selected, the semen storage character of the hens is improved, the artificial insemination frequency in the hatching egg production process can be effectively reduced, the feeding amount of breeding cocks is further reduced, the feeding cost is reduced, meanwhile, the stress response of the hens to the artificial insemination is reduced, and the production benefit is increased. SNPs and genome regions associated with the traits are detected by using genome-wide association analysis (GWAS), so that the working efficiency and the statistical effectiveness can be greatly improved. The research is to perform whole genome correlation analysis on chicken semen storage capacity by utilizing chicken whole genome SNP chips (600K, affymetrix), and to detect SNPs and genome regions related to the semen storage traits of hens in a whole genome range. The research works in national fund (project number: 31372301, project name: screening of new genes related to chicken sperm storage capacity difference and molecular mechanism initial exploration) and key research and transformation plan (project number: CGZH 2017000237) of autonomous innovation fund and major breeding project of autonomous innovation fund: the method is completed under the funding of discovering chicken heat-resistant high-yield genes and combinations thereof (item number: 2662018PY 088) by utilizing a Tu-Lai resource group.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to the sperm storage capacity of a hen and application thereof, and 1 SNP molecular marker related to the sperm storage capacity is found on the chromosome 3 of a hen genome through whole genome association analysis.

The invention is realized by the following technical scheme:

an SNP molecular marker related to the sperm storage capacity of hens, which is positioned on chromosome 3, and the nucleotide sequence (SEQ ID NO. 1) of the molecular marker is as follows:

CTGATGCTGCCCAATCCTGAGTGGARGCAACTTCCCACAGTGCCAAAACCT

the base R at position 26 in the above sequence is A or G, resulting in polymorphism.

Obtained by screening according to the following method:

1) Collecting experimental samples: collecting a test chicken blood sample for DNA extraction;

2) And (3) determining the sperm storage capacity of the hen: measuring the number (FN) of fertilized eggs laid by hens and the number (DN) of continuous days after the artificial insemination of the test chicken for one time, repeatedly measuring for three times, and taking the average value of the measured results of the three times as the semen storage capacity of the test chicken;

3) Extracting and detecting chicken genome DNA: extracting chicken genome DNA from a test chicken blood sample, and preparing a hen whole genome DNA sample;

4) Genotype judgment and correlation analysis of genotype and chicken sperm storage capacity:

hybridizing genome DNA extracted from a test chicken blood sample with a chicken 600K high-density SNP chip (Affymetrix Axiom), then performing quality control test on original genotype data of all individuals by adopting PLINK software, performing association analysis on test semen storage capacity and genotype by utilizing TASSEL statistical analysis software, and selecting SNP which achieves the genome level of a whole genome and is remarkable.

The polymorphism of the SNP locus is obviously related to semen storage capacity DN (the number of days between insemination and the last fertilized egg production of the hen) and FN (the number of fertilized eggs produced by the hen after insemination) (P is less than 0.05), GG genotype is an unfavorable marker of the semen storage capacity of the hen, and the SNP molecular marker can be used for screening and improving the semen storage traits of the hen.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention utilizes a Genome wide association analysis (GWAS) technical method to screen and obtain SNPs molecular markers related to chicken semen storage capacity (Duration of fertility) in the whole Genome range of hens, and further utilizes a restriction fragment length polymorphism (PCR-RFLP) analysis method to verify the correlation between the SNP and the chicken semen storage capacity (Duration of fertility) in an expanded population. Provides 1 new SNP molecular marker for selecting and improving the sperm storage capacity of the hen by utilizing molecular marker assisted breeding.

Detailed Description

Example 1 screening of SNP molecular markers associated with the ability to store sperm in hens

1) Collecting experimental samples:

the experimental group is 701 healthy hens which are from a core breeding chicken farm of 'Jinghong No. 1' laying hens and a parental group (200 days old), and all hens are hatched in the same batch. The feed is bred in Wuhanyukou poultry Limited company, and single-cage breeding and 14-hour illumination system are carried out, and the feed and drinking water are freely taken. During the raising period, the conditions of temperature, humidity, ventilation, illumination and the like are the same, and the method is a conventional method.

2) And (3) measuring sperm storage capacity:

taking 20 days as a period, semen is collected from the cock once, and the semen is required to be free of excrement, feather scraps and blood pollution, otherwise, the semen is discarded uniformly. The mixed semen is used for inseminating the hen (20 microliters/hen), the stimulation of an inseminating instrument is avoided during inseminating, and simultaneously, in order to avoid inseminating infection, the inseminating head is replaced once after inseminating once. The specific operation is carried out according to the technical protocol for artificial insemination of chicken (DB 12/T290-2006). Hatching eggs were collected and labeled with cage numbers. The same batch of hatching eggs were incubated at constant temperature (37.8 ℃, 50% relative humidity) for 7 days before egg candling, and fertilized and unfertilized hatching eggs were recorded.

The number of fertilized eggs (FN, the number of fertilized eggs after AI) and The number of days of Duration (DN) were measured after one artificial insemination of each hen, FN and DN were measured in triplicate, and The average of The results of The three measurements was taken as The sperm storing capacity of The test chicken.

After the experiment for measuring the sperm storage character of the hens is finished, 0.5mL of blood is collected from the infrawing veins of the test hens, the blood is placed into 1.5mL of an EP tube added with 0.3mL of anticoagulant in advance, and the blood is stored at the temperature of 20 ℃ below zero after being mixed evenly for DNA extraction.

3) And (3) extracting and detecting DNA:

extracting chicken genome DNA from a test chicken blood sample by adopting a phenol-chloroform method, and judging the integrity of the DNA by using gel electrophoresis; performing quality detection on the extracted DNA; the concentration was adjusted to 50 ng/. Mu.L, and a hen whole genome DNA sample was prepared.

4) Genotype judgment and correlation analysis of genotype data and chicken sperm storage capacity:

according to the sperm storage capacity of the 701 hen groups in the former part, 60 hens with long and short sperm storage capacity are screened respectively, and the genome DNA of the hens is hybridized with a 600K high-density SNP chip (Affymetrix Axiom). The genotype information of 552395 SNPs loci is successfully detected in the whole genome range, and the number of the residual SNPs is 341176 through quality control (the removal rate (Call rate) of SNPs is less than 90 percent, the removal Minimum Allele Frequency (MAF) of SNPs is less than 5 percent). The applicant utilizes the TASSEL statistical analysis software to perform correlation analysis on the semen storage capacity and the genotype data of the test chicken flock, and the correlation analysis model is a mixed linear model:

Y＝S+K+e

wherein Y represents a tabular value; s represents a genotype effect; k represents a genetic relationship matrix as a random effect of the model; e is the residual effect.

When the association P value of a certain SNP with the hen semen storage trait is less than 4.18E-06, the SNP is considered to be significantly associated with the hen semen storage trait.

5) Analysis results

Association analysis finds 1 SNP (adenosine monophosphate-associated protein) which is obviously associated with the hen sperm storage trait (AX-76413026, P < -4.18E-06), and the table 1 shows.

TABLE 1 SNP sites significantly associated with the ability of hens to store sperm

*P<4.18E-06；

Example 2 validation of the SNP molecular marker

In order to verify the reliability of the results of the genome-wide association analysis, we performed restriction fragment length polymorphism (PCR-RFLP) analysis on SNPs (AX-76413026) significantly associated with the semen storage trait in the genome-wide association analysis using a hen population for which the semen storage capacity was determined, and compared the semen storage capacities DN and FN of individuals of different genotypes in the population, as shown in Table 2. The results showed that the polymorphism at this SNP site was significantly associated with sperm storing capacity DN and FN (P < 0.05).

Table 2 correlation analysis results of SNP sites and hen sperm storage capacity.

Note: DN = number of days between insemination (once) and the last fertilized egg produced by the hen; FN = number of fertilized eggs laid by hens after insemination (once); significant differences were indicated between SNP genotypes with different shoulder markers in the same trait (P < 0.05). * Indicating significant difference, P <0.05; * Indicates very significant difference P <0.01; the trait values in the table are mean ± sem.

Through PCR-RFLP analysis, 719 hen SNP sites AX-76413026 genotype information was obtained, wherein 228 AA genotypes, 33 GG genotypes, and 458 AG genotypes were obtained. The SNP locus AX-76413026 polymorphism is significantly related to both chicken sperm storing capacities FN and DN (P < 0.05), and the number of fertilized eggs laid by hens fertilized (once) with GG genotype is significantly less than that of hens fertilized (P < 0.01) with AA and AG genotype. Meanwhile, the days between the insemination (once) of the hen with the GG genotype and the last fertilized egg output of the hen are obviously less than that of hens with AA and AG genotypes (p is less than 0.05), so that the GG genotype is an unfavorable marker for the sperm storage capacity of the hen and can be used for screening and improving the sperm storage traits of the hen.

Sequence listing

<110> university of agriculture in Huazhong

<120> SNP molecular marker related to sperm storage capacity of hen and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgatgctgc ccaatcctga gtggargcaa cttcccacag tgccaaaacc t 51

Claims

The application of the SNP molecular marker in screening and improving the sperm storage capacity of the Jinghong No.1 hen is characterized in that: the molecular marker sequence is CTGATGCTGCCCAATCCTGAGTGGARGCAACTTCCCACAGTGCCAAACCT, the 26 th base R of the sequence is A or G, polymorphism is caused, and the polymorphism site is shown as GG genotype and is an unfavorable marker of the sperm storage capacity of the hen.