CN109943640A - SNP marker relevant to the smart ability of hen storage and its application - Google Patents
SNP marker relevant to the smart ability of hen storage and its application Download PDFInfo
- Publication number
- CN109943640A CN109943640A CN201711388334.0A CN201711388334A CN109943640A CN 109943640 A CN109943640 A CN 109943640A CN 201711388334 A CN201711388334 A CN 201711388334A CN 109943640 A CN109943640 A CN 109943640A
- Authority
- CN
- China
- Prior art keywords
- hen
- smart
- ability
- storage
- snp marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The present invention provides a SNP marker associated with the smart ability of hen storage and its applications, pass through whole-genome association (GWAS) and restriction enzyme length polymorphism (PCR-RFLP) technical method, 1 SNP marker associated with the smart ability of hen storage is screened on hen genome for the first time, is located at No. 3 chromosomes of hen.The storage essence capability profile DN(insemination of the polymorphism of the SNP site and hen is once to the number of days being spaced between last piece of fertile egg of hen output) and primary the produced fertile egg of rear hen of FN(insemination number) be significantly associated with, the SNP marker is GG genotype, it is then the advantageous label that hen stores up smart ability, can be used for screening and improvement that hen stores up smart ability.
Description
Technical field
The invention belongs to livestock molecular marker technical fields, and in particular to 1 SNP molecule relevant to the smart ability of hen storage
Label and its application.
Background technique
The storage essence ability of hen refer to hen natural mating or artificial insemination (Artificial insemination,
AI sperm can be stored after) and continues to produce the ability (Duration of fertility) of fertile egg.In many kinds or product
In the group of system, researcher has found that the storage essence ability of hen can have apparent individual difference, is reflected as a natural mating
Or hen produces fertile egg number (FN, The number of fertile eggs after AI) or continues after artificial insemination
The difference of number of days (DN, The days post-insemination until the last fertile egg).It is educated in poultry
In kind and hatching egg production process, the smart ability length of the storage of hen is to determine the key factor of progress artificial insemination frequency, such as turkey
Storage essence character be up to one or two moon, therefore in the production process of turkey hatching egg, one month is only needed to its artificial insemination
It carries out once, even for the turkey that will open production, two weeks progress artificial insemination can be shifted to an earlier date to improve the acquisition of hatching egg
(Bakst,2010).And the Chu Jingxing of Bai Laihang (White leghorn) He Jinghong hen (JingHong brown layers)
Shape generally only has two weeks or so, and the storage essence character of sheldrake (Anas platyrhyncha domestica) also only has 13 days or so
(Lake and Stewart,1978；Blackburn et al.,2009；Liu et al., 2015), in production in order to guarantee
90% or more fertility rate of hatching egg carries out artificial insemination to them and generally requires progress in one week once.Extensive at present intensive
In the case that technology of artificial insemination is generally used in production, the long hen of smart ability is stored up in selection, stores up smart character to hen and carries out
Improvement can be effectively reduced the frequency of artificial insemination in hatching egg production process, and then reduce the number of animals raised of stock cock, to subtract
Few feeding cost, while the stress reaction that hen generates artificial insemination is reduced, increase productivity effect.It is associated with using full-length genome
It analyzes (GWAS) and detects SNPs associated with character and genome area, be greatly improved working efficiency and statistics effect.This
Research is that current the first utilizes chicken whole genome SNP chip (600K, Affymetrix) to carry out full-length genome to the smart ability of chicken storage
Association analysis detects the report of SNPs associated with the smart character of hen storage and genome area within the scope of full-length genome.
Summary of the invention
The purpose of the present invention is to provide a SNP marker relevant to the smart ability of hen storage and its applications, pass through
Whole-genome association finds 1 and the associated SNP molecule mark of the smart ability of storage on No. 3 chromosomes of hen genome for the first time
Note.
The invention is realized by the following technical scheme:
A kind of SNP marker relevant to the smart ability of hen storage, the nucleotides sequence of the molecular labeling are classified as
GTCACCACTGCTCACACGAGACCCASAATGTTTTCTCTTACCTACATGCAC, the 26th base S is C or G, is caused
Polymorphism.It is screened and is obtained by following methods:
1) laboratory sample acquires: acquisition test chicken blood sample is extracted for DNA；
2) hen stores up the measurement of smart ability: hen produces fertile egg number (FN) and holds after a measurement artificial insemination of test chicken
Continuous number of days (DN), duplicate measurements three times, take the average value of measured result three times, the storage essence ability as the test chicken；
3) extraction and detection of chicken genomic DNA: extracting chicken genomic DNA from test chicken blood sample, prepares the full base of hen
Because of a group DNA sample；
4) genotype determines and genotype stores up the association analysis of smart ability with chicken:
By the genomic DNA extracted in test chicken blood sample with chicken 600K high density SNP chip (Affymetrix
Axiom) hybridize, then carry out Quality Control inspection using original gene type data of the PLINK software to all individuals, utilize TASSEL
Smart ability is stored up in test to statistical analysis software and genotype is associated analysis, therefrom chooses the genome water for reaching full-length genome
Put down significant SNP.
(insemination is once between last piece of fertile egg of hen output by the polymorphism of above-mentioned SNP site and the smart ability DN of storage
The number of days at interval) with FN (number of the produced fertile egg of hen after insemination is primary) it is significantly associated with (P < 0.05), GG genotype is mother
Chicken stores up the advantageous label of smart ability, this SNP marker can be used for the screening and improvement that hen stores up smart character.
Compared with prior art, the present invention has the following advantages and beneficial effects:
The present invention uses whole-genome association (GWAS, Genome wide association study) skill for the first time
Art method screened within the scope of hen full-length genome obtain storing up smart ability (Duration of fertility) to chicken it is relevant
SNPs molecular labeling further uses restriction enzyme length polymorphism (PCR-RFLP, restricted fragment
Length polymorphism) analysis method stores up smart ability (Duration of to this SNP and chicken in widened group
Fertility) correlation is verified.It is selected and is improved to store up smart ability to hen using molecular mark
Provide 1 new SNP marker.
Specific embodiment
The screening of the SNP marker relevant to the smart ability of hen storage of embodiment 1
1) laboratory sample acquires:
Test group is 701 healthy hens, from " red No. 1 of capital " laying hen core breeding chicken house parent for group (200
Age in days), all hens hatch with batch.It raises in Wuhan exit of valley Qin Ye Co., Ltd, executes single cage raising, 14 small time
According to system, it is freely eaten and drinks water.During raising, the conditions such as temperature, humidity, ventilation, illumination are all the same, are conventional method.
2) measurement of smart ability is stored up:
It with 20 days for a cycle, is required to semen collection of cock, in sperm without excrement, plumage bits, blood pollution, otherwise one
Rule is discarded.Hen is carried out semen deposition (20 microlitres/only) using mixed semen, when semen deposition avoids the stimulation of semen deposition instrument, is simultaneously
It avoids that semen deposition infection occurs, after accomplishing that every semen deposition is primary, replaces first service device head.Concrete operations are according to " chicken artificial insemination skill
Art regulation " (DB12/T290-2006) execution.It collects hatching egg and marks cage number.With batch hatching egg Constant temperature hatch (37.8 DEG C, phase
To humidity 50%) egg, record fertilization and unfertilized hatching egg are shone after 7 days.
Measure number (FN, The number of fertile that fertile egg is produced after the artificial insemination of every hen
Eggs after AI) and continuous days (DN, The days post-insemination until the last fertile
Egg), duplicate measurements FN and DN three times, take the average value of measured result three times, the storage essence ability as the test chicken.
After the storage essence property determination experiment of hen, to venous blood collection 0.5mL under test chicken group's wing, it is placed in 1.5mL thing
It is first added in the EP pipe of 0.3mL anti-coagulants, is saved in case DNA is extracted for -20 DEG C after mixing.
3) extraction and detection of DNA:
Chicken genomic DNA is extracted from test chicken blood sample using phenol chloroform method, then judges that DNA's is complete with gel electrophoresis
Whole property；Quality testing is carried out to the DNA after extraction；Concentration is adjusted to 50ng/ μ L, prepares hen complete genome DNA sample.
4) genotype determines and genotype data stores up the association analysis of smart ability with chicken:
According to the storage essence ability of 701 hen groups in front portion, long and short hen each 60 of smart ability are stored up in screening,
Their genomic DNA is hybridized with chicken 600K high density SNP chip (Affymetrix Axiom).Within the scope of full-length genome
It successfully is detected the genotype information in 552395 sites SNPs, (rejects recall rate (Call rate) to be less than by quality control
90% SNPs；Reject the minimum SNPs of gene frequency (Minor allele frequency, MAF) less than 5%), most
Remaining SNPs number is 341176 afterwards.Applicant using TASSEL statistical analysis software by the storage essence ability of test chicken group with
Genotype data is associated analysis, and relation analysis model is mixed linear model:
Y=S+K+e
Wherein Y indicates phenotypic number；S indicates genotype effects；K indicates affiliation matrix, the stochastic effects as model；
E is residual error effect.
When some SNP and hen, which store up smart trait associations P value, is less than 4.18E-06, we are considered as this SNP and hen
Smart character is stored up significantly to be associated with.
5) result is analyzed
Association analysis finds that 1 is stored up the significantly associated SNP (AX-80861605, P < 4.18E-06) of smart character with hen, is seen
Table 1.
Table 1 and hen store up the significantly associated SNP site of smart ability
*P<4.18E-06；
The validity of the verifying of embodiment 2 SNP marker
In order to verify the reliability to whole-genome association result, we, which utilize, has measured 701 that store up smart ability
Hen group carries out restricted with the significantly associated SNP (AX-80861605) of the smart character of storage in whole-genome association
Segment length polymorphism analysis (PCR-RFLP), and storage essence the ability DN and FN of different genotype individual in the group are compared
Compared with the results are shown in Table 2.The polymorphism of this SNP site is significantly associated with (P < 0.05) with storage essence ability DN and FN as the result is shown.
2 SNP site of table and hen store up smart ability association analysis result.
Note: DN=insemination (primary) to the number of days being spaced between last piece of fertile egg of hen output；FN=insemination (one
It is secondary) number of the produced fertile egg of hen afterwards；Having in same character indicates significant difference (P between different shoulder target SNP genotype
<0.05).* significant difference, P < 0.05 are indicated；* indicates extremely significant P < 0.01 of difference；Character value is average ± standard in table
Accidentally.
It is analyzed by PCR-RFLP, has obtained 554 hen SNP site AX-80861605 genotype informations, wherein CC base
Because type has 365, GC genotype has 140, and GG genotype has 49.SNP site AX-80861605 polymorphism and chicken Chu Jingneng
Power FN is in significant related (P < 0.05) to DN, a digital display of the hen insemination (primary) of GG genotype the produced fertile egg of hen afterwards
Write the hen (p < 0.01) for being more than CC genotype.Simultaneously GG genotype hen insemination (primary) to last piece of hen output by
The number of days being spaced between smart egg is significantly more than the hen (p < 0.01) of CC genotype, therefore GG genotype is that hen stores up smart ability
Advantageous label can be used for screening and improvement that hen stores up smart character.
Claims (3)
1. a SNP marker relevant to the smart ability of hen storage, it is characterised in that: the nucleotide sequence of the molecular labeling
Are as follows:
GTCACCACTGCTCACACGAGACCCASAATGTTTTCTCTTACCTACATGCAC
The base S that above-mentioned sequence is the 26th is C or G, leads to polymorphism.
2. SNP marker relevant to the smart ability of hen storage according to claim 1, which is characterized in that the molecule
Label shows as GG genotype, then is the advantageous label that hen stores up smart ability.
3. SNP marker relevant to the smart ability of hen storage described in claim 1 is in hen stores up smart ability selection and improves
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711388334.0A CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular marker related to sperm storage capacity of hen and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711388334.0A CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular marker related to sperm storage capacity of hen and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109943640A true CN109943640A (en) | 2019-06-28 |
| CN109943640B CN109943640B (en) | 2021-08-03 |
Family
ID=67004324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711388334.0A Active CN109943640B (en) | 2017-12-20 | 2017-12-20 | SNP molecular marker related to sperm storage capacity of hen and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109943640B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1683554A (en) * | 2004-04-14 | 2005-10-19 | 华中农业大学 | MHC-B-LB gene PCR-RFLP/abel relative to chicken egg productivity |
| CN1875275A (en) * | 2003-10-06 | 2006-12-06 | 诺瓦提斯公司 | Biomarkers for the prediction of drug-induced diarrhoea |
| CN105506086A (en) * | 2015-12-25 | 2016-04-20 | 华中农业大学 | SNP molecular markers related to chicken-fertilization duration time characters and application thereof |
-
2017
- 2017-12-20 CN CN201711388334.0A patent/CN109943640B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1875275A (en) * | 2003-10-06 | 2006-12-06 | 诺瓦提斯公司 | Biomarkers for the prediction of drug-induced diarrhoea |
| CN1683554A (en) * | 2004-04-14 | 2005-10-19 | 华中农业大学 | MHC-B-LB gene PCR-RFLP/abel relative to chicken egg productivity |
| CN105506086A (en) * | 2015-12-25 | 2016-04-20 | 华中农业大学 | SNP molecular markers related to chicken-fertilization duration time characters and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| D. P. FROMAN等: "Sperm Mobility: Phenotype in Roosters (Gallus domesticus) Determined by Mitochondrial Function", 《BIOLOGY OF REPRODUCTION》 * |
| ENSEMBL RELEASE 92: "rs313486173", 《EMBL-EBI》 * |
| 刘桂琼等: "鸡贮精腺差异表达基因neurexophilin的单核苷酸多态性分析", 《中国畜牧兽医学会动物繁殖学分会第十五届学术研讨会论文集》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109943640B (en) | 2021-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111225986B (en) | Chicken whole genome SNP chip and application thereof | |
| US20210395803A1 (en) | Egg-type chicken whole-genome snp chip and use thereof | |
| CN110191965B (en) | Pig whole genome 50K SNP chip and application | |
| CN107619857B (en) | Method for detecting CNV (CNV) marker of beef cattle KLF8 gene and application of CNV marker | |
| Jax et al. | Avian transcriptomics: opportunities and challenges | |
| CN107760789B (en) | Genotyping detection kit for parent-child identification and individual identification of yaks | |
| CN114480673B (en) | Chicken low-density SNP liquid phase chip based on targeted capture sequencing and application thereof | |
| CN115198023B (en) | Hainan cattle liquid-phase breeding chip and application thereof | |
| Laine et al. | An ecologist's guide for studying DNA methylation variation in wild vertebrates | |
| CN108004302A (en) | A kind of association analysis method of transcript profile reference and its application | |
| CN109680078A (en) | Utilize the method for SNP site selection signal change of gradient Index Assessment economic characters candidate gene | |
| CN110551823B (en) | SNP molecular marker related to sperm storage capacity of hen and application thereof | |
| CN109943639A (en) | For selecting hen to store up the SNP marker and its application of smart ability | |
| CN104342489B (en) | A kind of method detecting chicken beard gene type | |
| CN109943640A (en) | SNP marker relevant to the smart ability of hen storage and its application | |
| CN115948521A (en) | Method for detecting aneuploid missing chromosome information | |
| CN109706231A (en) | A kind of high-throughput SNP classifying method for litopenaeus vannamei molecular breeding | |
| CN114921572A (en) | SNP molecular marker for identifying Taihe black-bone chicken variety and application thereof | |
| CN108410995A (en) | The screening of the more unrestrained sheep physiological period ovary genes in Xinjiang and identification method | |
| CN110499369A (en) | For selecting hen to store up the SNP marker and its application of smart ability | |
| Chu et al. | The genomic characteristics affect phenotypic diversity from the perspective of genetic improvement of economic traits | |
| CN104573409B (en) | The multiple check method of the assignment of genes gene mapping | |
| CN110551824B (en) | SNP molecular marker related to sperm storage capacity of hen and application thereof | |
| CN110452990A (en) | For selecting hen to lay eggs the SNP marker and its application of later period laying rate | |
| Mukhopadhyay et al. | Cattle genomics: Genome projects, current status, and future applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |