CN113430277A - Primer group for identifying sex-linked dwarf gene and application thereof - Google Patents
Primer group for identifying sex-linked dwarf gene and application thereof Download PDFInfo
- Publication number
- CN113430277A CN113430277A CN202110870820.6A CN202110870820A CN113430277A CN 113430277 A CN113430277 A CN 113430277A CN 202110870820 A CN202110870820 A CN 202110870820A CN 113430277 A CN113430277 A CN 113430277A
- Authority
- CN
- China
- Prior art keywords
- primer
- chicken
- primer pair
- sex
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention relates to the field of animal breeding, in particular to a primer group of an identified linked dwarf gene and application thereof. In the invention, an upstream primer for detecting DW gene is designed in a GHR gene deletion segment, an upstream primer for detecting DW gene is designed at the upstream of the GHR deletion segment, downstream primers are designed at the downstream of the GHR deletion segment in a unified way, and amplification is simultaneously carried out by utilizing the inside of the deletion segment and two ends of the deletion segment through multiple PCR reaction, so that ZDWZDWAnd ZDWW individuals can only detect amplification products of the non-deleted region, ZdwW and ZdwZdwIndividuals can only detect the deleted fragment, while heterozygotes ZDWZdwThe individual can detect two fragments simultaneously, and the primer group can quickly and accurately identify the chicken individual sex-linked dwarf geneThe genotype of the locus.
Description
Technical Field
The invention relates to the field of animal breeding, in particular to a primer group of an identified linked dwarf gene and application thereof.
Background
The chicken sex-linked dwarf gene (dw gene) is an allele formed by deletion mutation of nearly 1.7kb in a 3 '-untranslated region (3' -UTR) of a Growth Hormone Receptor (GHR) gene on a chicken sex chromosome. The dw gene was discovered by Behtank, a soviet union in 1935. The dw gene is positioned between the in locus of the liver necrosis gene and the we locus of the wingless gene on the Z chromosome of the chicken and is close to the silver (S) and golden (S) feather genes, the slow feather (K) and the fast feather (K) genes, and the exchange values of the dw gene, the silver gene and the slow feather gene are 7 percent and 6.6 percent respectively.
The dw gene is one of the 8 known dwarf genes, which is different from most other dwarf genes with obvious pathogenic or lethal effects. Many researches show that the gene is the only invisible sex-linked mutant gene which is harmless to the health of chickens and is beneficial to human beings. Compared with the normal body type chicken, the gene recessive homozygous dwarf chicken bred by the breeding method only has 2/3 of the body weight of the normal body type chicken, and has the advantages of low basal metabolic rate, less feed consumption, high breeding density, strong adaptability, strong stress resistance and the like.
The DW gene belongs to sex-linked inheritance, and the normal gene DW is dominant to the DW, so that only dwarf homozygous cocks and dwarf gene-carrying hens show dwarf traits. The apparent external features are a 20% reduction of the tibia, while ZDWZdwThe heterozygote cock has normal phenotype and can not be matched with ZDWZDWThe homozygous non-dwarf cocks of (1) are distinguished. Therefore, the genotype of chicken carried by the sex-linked dwarf gene can be accurately identified on the molecular level, and the breeding efficiency of the dwarf chicken can be improved.
Disclosure of Invention
In order to solve the problems, the invention provides a primer group for identifying a sex-linked dwarf gene and application thereof. The primer group provided by the invention can rapidly and accurately identify the genotype of chicken carried by sex-linked dwarf gene.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a primer group for identifying sex linked dwarf genes, which comprises a primer pair 1 and a primer pair 2;
the nucleotide sequence of the forward primer of the primer pair 1 is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 1 is shown as SEQ ID NO: 3 is shown in the specification;
the nucleotide sequence of the forward primer of the primer pair 2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 2 is shown as SEQ ID NO: 3, respectively.
The invention also provides application of the primer group in identifying chicken carrying the sex linked dwarf gene.
The invention also provides a reagent or a kit for identifying chicken carried by the sex-linked dwarf gene, and the reagent or the kit comprises the primer group.
The invention also provides a method for identifying chicken carried by the sex-linked dwarf gene, which comprises the following steps:
taking cDNA obtained by reverse transcription of genome DNA or total RNA of a sample chicken as a template, and carrying out PCR amplification by using the primer group to obtain an amplification product;
the judgment of the amplification product comprises: when the sample chicken contains the amplification product of 600 bp-700 bp, the sample chicken is a sex-linked dwarf gene carrying chicken.
Preferably, the PCR reaction procedure comprises: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; extension at 72 ℃ for 5 min.
Preferably, the reaction system for PCR amplification is 20 μ L, and comprises:10 mu L of PCR SuperMix, 0.4 mu L of each of the forward primer of the primer pair 1 and the forward primer of the primer pair 2 in the primer group, 0.2 mu L of each of the reverse primer of the primer pair 1 and the reverse primer of the primer pair 2 in the primer group, 2.5 mu L of DNA template and the rest of deionized water.
Preferably, theThe concentration of PCR SuperMix is 10 mu moL/L; the working concentration of the forward primer of the primer pair 1, the reverse primer of the primer pair 1, the forward primer of the primer pair 2 and the reverse primer of the primer pair 2 in the primer group is 10 mu moL/L; of the DNA templateThe concentration was 100 ng/. mu.L.
Preferably, the method for determining comprises electrophoresis or sequencing.
Preferably, the determining of the amplification product further comprises: when the sample chicken contains an amplification product of 600 bp-700 bp and an amplification product of more than 700bp and less than or equal to 800bp, the sample chicken is a heterozygous chicken carrying a sex linked dwarf gene;
when only the amplification product of 600 bp-700 bp is contained, the sample chicken is homozygous chicken carrying sex linked dwarf gene;
when only the amplification product of more than 700bp and less than or equal to 800bp is contained, the sample chicken is homozygous chicken not carrying the sex linkage dwarf gene.
The invention also provides application of the primer group or the reagent or the kit or the method in the auxiliary breeding of the new variety of the dwarf chicken flock.
Has the advantages that:
the invention provides a primer group for identifying sex linked dwarf genes, which comprises a primer pair 1 and a primer pair 2; the nucleotide sequence of the forward primer of the primer pair 1 is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 1 is shown as SEQ ID NO: 3 is shown in the specification; the nucleotide sequence of the forward primer of the primer pair 2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 2 is shown as SEQ ID NO: 3, respectively. In the invention, an upstream primer for detecting DW gene is designed in a GHR gene deletion segment, an upstream primer for detecting DW gene is designed at the upstream of the GHR deletion segment, downstream primers are designed at the downstream of the GHR deletion segment in a unified way, and amplification is simultaneously carried out by utilizing the inside of the deletion segment and two ends of the deletion segment through multiple PCR reaction, so that ZDWZDWAnd ZDWW can only detect the amplification product of the non-deleted segment, ZdwW and ZdwZdwOnly the deleted fragment was detected, and heterozygote ZDWZdwIndividuals can simultaneously detect two fragments, and the genotype of chicken carried by the sex linked dwarf gene can be quickly and accurately identified through a specific primer group.
Drawings
FIG. 1 shows different genes in application example 1Gel electrophoresis picture of type chicken, wherein M Lane is DNA molecular weight marker (100-1500 bp Ladder), in the picture 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 Lane is Yangtai little black chicken, has a 713bp band, genotype is ZDWZDW(ii) a 11 Lane is a white space cock with 714bp band and genotype ZDWZDW(ii) a The 12 lane is a pure line cock of the dwarf chicken, which has a 614bp band and the genotype is ZdwZdw;
FIG. 2 is a gel electrophoresis of chicken of different genotypes in application example 1, wherein the M lane is DNA molecular weight marker (100-1500 bp Ladder), the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 lanes are Yangtai Xiaohei chicken, there are two 713bp and 614bp bands, and the genotype is ZDWZdw(ii) a 11 Lane is a white space cock with 714bp band and genotype ZDWZDW(ii) a The 12 lane is a pure line cock of the dwarf chicken, which has a 614bp band and the genotype is ZdwZdw(ii) a Lane 13 is negative control deionized water;
FIG. 3 is a gel electrophoresis of chicken of different genotypes as in application example 1, wherein lane M is a DNA molecular weight marker (100-1500 bp Ladder), lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 are Yangtai Xiaohei chicken with a 713bp band and genotype ZDWW; 11 Lane is a white leghorn hen with a 714bp band and genotype ZDWW; lane 12 is a pure line hen with 614bp band and genotype ZdwW; lane 13 is negative control deionized water;
FIG. 4 is a gel electrophoresis of chickens with different genotypes as in application example 1, in which lane M is a DNA molecular weight marker (100-1500 bp Ladder), and lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 are Yangtai little black chickens, and have a 614bp band and genotype ZdwLanes W and 11 are white leghorn hens with a 714bp band and genotype ZDWW; lane 12 is a pure line hen with 614bp band and genotype ZdwW; lane 13 is negative control deionized water;
FIG. 5 is a gel electrophoresis of chickens of different genotypes as in comparative example 1, in which M runsDNA molecular weight markers (100-1500 bp Ladder) are shown in the lane, and genotype is Z in lanes 1, 2 and 3DWZdwYangtai black cock; 4. lanes 5 and 6 show genotype ZDWZDWYangtai little black chicken; 7. lanes 8 and 9 show genotype ZDWW Yangtai black chicken hen; 10. lanes 11 and 12 show genotype ZdwW Yangtai black hen.
Detailed Description
The invention provides a primer group for identifying sex linked dwarf genes, which comprises a primer pair 1 and a primer pair 2;
the nucleotide sequence of the forward primer of the primer pair 1 is shown as SEQ ID NO: 1, and the following components: 5'-atgcctatttctgtgagg-3', respectively; the nucleotide sequence of the reverse primer of the primer pair 1 is shown as SEQ ID NO: 3, showing: 3 '-atgtcctatctccttctactg-5';
the nucleotide sequence of the forward primer of the primer pair 2 is shown as SEQ ID NO: 2, as shown in the figure: 5'-gggatgttcattgccttt-3', respectively; the nucleotide sequence of the reverse primer of the primer pair 2 is shown as SEQ ID NO: 3, showing: 3 '-atgtcctatctccttctactg-5'.
The primer pair 1 is designed according to the upstream and the downstream of the GHR gene deletion section of the sex-linked dwarf chicken; wherein, the forward primer of the primer pair 1 is designed at the upstream 242bp of the deletion segment of the GHR gene, and the reverse primer is designed according to the downstream 372bp of the deletion segment of the GHR gene; the primer pair 1 is used for detecting the chicken non-dwarf allele DW gene; the primer pair 12 is designed according to the inside of the GHR gene deletion section and the downstream of the deletion section of the sex-linked dwarf chicken; wherein, the forward primer of the primer pair 2 is designed in the deletion segment of the GHR gene, and the reverse primer is designed according to the downstream 372bp of the deletion segment of the GHR gene; the primer pair 2 is used for detecting the chicken sex linked dwarf mutant allele dw gene. The specific primer group can rapidly and accurately identify the genotype of the chicken carried by the sex-linked dwarf gene. The method for synthesizing the primer set is not particularly limited, and is preferably synthesized by Biotechnology engineering (Shanghai) Co., Ltd.
The invention also provides application of the primer group in identifying chicken carrying the sex linked dwarf gene. The specific primer group can rapidly and accurately identify the genotype of the chicken carried by the sex-linked dwarf gene.
The invention also provides a reagent or a kit for identifying chicken carried by the sex-linked dwarf gene, and the reagent or the kit comprises the primer group.
The invention also provides a method for identifying chicken carried by the sex-linked dwarf gene, which comprises the following steps:
taking cDNA obtained by reverse transcription of genome DNA or total RNA of a sample chicken as a template, and carrying out PCR amplification by using the primer group to obtain an amplification product;
the judgment of the amplification product comprises: when the sample chicken contains the amplification product of 600 bp-700 bp, the sample chicken is a sex-linked dwarf gene carrying chicken.
In the present invention, the DNA template is preferably a genomic DNA of a sample chicken. The invention has no special requirements on the extraction method of the DNA template, and preferably adopts a blood/cell/tissue genome DNA extraction kit (DP304) provided by Tiangen Biochemical technology (Beijing) Co., Ltd to extract the genome DNA of the sample chicken.
In the present invention, the PCR reaction procedure preferably includes: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; extending for 5min at 72 ℃; the reaction system for PCR amplification is 20 μ L, and preferably comprises:10 mu L of PCR SuperMix, 0.4 mu L of forward primer of primer pair 1 and forward primer of primer pair 2 in the primer group, 0.2 mu L of reverse primer of primer pair 1 and reverse primer of primer pair 2 in the primer group, 2.5 mu L of DNA template and residual deionized water; the above-mentionedThe concentration of PCR SuperMix is preferably 10 mu moL/L; the working concentration of the forward primer of the primer pair 1, the reverse primer of the primer pair 1, the forward primer of the primer pair 2 and the reverse primer of the primer pair 2 in the primer group is preferably 10 mu moL/L; the concentration of the DNA template is preferably 100 ng/. mu.L. The invention isThe reverse primers of the primer pair 1 and the primer pair 2 are the same and are common reverse primers, and the volumes of the forward primer of the primer pair 1, the forward primer of the primer pair 2 and the common reverse primer are preferably the same in the reaction system. The invention has no special requirements on the sources of all reagents of the reaction system for PCR amplification, and can adopt commercial products well known by the technicians in the field; the invention is as describedPCR Supermix is preferably purchased from Beijing Quanjin Biotechnology LtdPCR SuperMix (+ dye), cat # AS 111-11.
In the present invention, the judging method preferably includes electrophoresis or sequencing, more preferably electrophoresis.
In the present invention, the judgment of the amplification product includes: when the sample chicken contains the amplification product of 600 bp-700 bp, the sample chicken is a sex linked dwarf gene carrying chicken; the judgment of the amplification product preferably further comprises: when the sample chicken contains an amplification product of 600 bp-700 bp and an amplification product of more than 700bp and less than or equal to 800bp, the sample chicken is a heterozygous chicken carrying a sex linked dwarf gene; the genotype of the heterozygous chicken carrying the sex-linked dwarf gene is preferably ZDWZdw;
When only the amplification product of 600 bp-700 bp is contained, the sample chicken is homozygous chicken carrying sex linked dwarf gene; the genotype of the homozygous chicken carrying the sex linked dwarf gene is preferably ZdwW or ZdwZdw(ii) a Further typing is preferably based on the gender of the chicken sample;
when only the amplification product which is more than 700bp and less than or equal to 800bp is contained, the sample chicken is homozygous chicken which does not carry sex linkage dwarf gene; the genotype of the homozygous chicken not carrying the sex linked dwarf gene is preferably ZDWW or ZDWZDW(ii) a Further typing is preferably based on the gender of the sample chicken.
The invention also provides application of the primer group or the reagent or the kit or the method in the auxiliary breeding of the new variety of the dwarf chicken flock. The primer group can quickly and accurately identify the genotype of the sex-linked dwarf gene carrying chicken, and can assist in breeding new dwarf chicken flock varieties.
In order to further illustrate the present invention, the primer set for identifying linked dwarf genes and the application thereof provided by the present invention are described in detail below with reference to the examples and the accompanying drawings, but they should not be construed as limiting the scope of the present invention.
Example 1
A primer group for identifying sex-linked dwarf genes consists of a primer pair 1 for detecting chicken non-dwarf alleles DW genes and a primer pair 2 for detecting chicken sex-linked dwarf alleles DW genes; the primer group is synthesized by biological engineering (Shanghai) GmbH;
the nucleotide sequence of the forward primer of the primer pair 1 is shown as SEQ ID NO: 1, and the following components: 5'-atgcctatttctgtgagg-3', respectively; the nucleotide sequence of the reverse primer of the primer pair 1 is shown as SEQ ID NO: 3, showing: 3 '-atgtcctatctccttctactg-5'; the size of an amplification product of the primer pair 1 is 713 bp;
the nucleotide sequence of the forward primer of the primer pair 2 is shown as SEQ ID NO: 2, as shown in the figure: 5'-gggatgttcattgccttt-3', respectively; the nucleotide sequence of the reverse primer of the primer pair 2 is shown as SEQ ID NO: 3, showing: 3 '-atgtcctatctccttctactg-5'; the size of the amplification product of the primer pair 1 is 614 bp.
Application example 1
The primer set of example 1 was used to identify the genotype of the sexually linked dwarf gene-carrying chicken.
1. To-be-identified chicken
The method is applied to identify Yangtai small black chicken groups for Jiangsu North agricultural and major farming and pasturing science and technology Limited, 975 male and female chickens, 58 female chickens and 76 female chickens in the commercial generation are selected, and the blood of each chicken to be identified is collected and stored at the temperature of minus 20 ℃.
2. Known genotype chicken
1)5 genotypes are ZDWZDWThe white-coming cock is from China university of agriculturePoultry genetic resource and breeding test base of animal science and technology academy.
2)5 genotypes are ZDWW white leghorn hens from the animal science and technology academy of Chinese agricultural university poultry genetic resources and breeding test base.
3)5 genotypes are ZdwZdwThe dwarf pure line cock is from poultry genetic resources and breeding test bases of animal science and technology academy of Chinese agriculture university.
4)5 genotypes are ZdwW, a short and small pure line hen, which is from poultry genetic resources and breeding test bases of animal science and technology academy of Chinese agriculture university.
3. Identification of genotype
1) Preparation and preservation of samples
10 μ L of each of the chickens to be identified and the chickens of known genotypes was taken from the anticoagulant-containing chicken blood, genomic DNA was extracted using a blood/cell/tissue genomic DNA extraction kit (DP304) provided by Tiangen Biochemical technology, Inc. (Beijing), and the DNA samples were stored in a freezer at-20 ℃ for later use.
2) PCR amplification
Each chicken to be identified was subjected to PCR amplification using the primer set of example 1 using the following PCR reaction system and the following PCR reaction procedure using genomic DNA as a template. The reaction system is 20 μ L system:PCR SuperMix (+ dye) (purchased from Beijing Quanjin Biotechnology Co., Ltd., product No. AS111-11) 10. mu.L (concentration: 10. mu. moL/L), 0.4. mu.L each of the forward primer of primer pair 1 and the forward primer of primer pair 2 (concentration: 10. mu. moL/L), 0.2. mu.L each of the reverse primer of primer pair 1 and the reverse primer of primer pair 2 (concentration: 10. mu. moL/L), 2.5. mu.L of DNA template (concentration: 100 ng/. mu.L), and 6.3. mu.L of deionized water. The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; extending for 5min at 72 ℃; after the circulation reaction, the reaction mixture was kept at 72 ℃ for 5 min. The PCR amplification product was stored at 4 ℃ until use.
3) Detection and result determination of PCR amplification product
And (3) agarose gel electrophoresis detection: 5 mu LPCR amplification products are taken, 1.2 percent of agar gel electrophoresis (120V, 40min) is carried out, the amplification products are used for sample application and detected by a gel imager, and the detection results are shown in a table 1 and figures 1 to 4 (figures 1 to 4 are electrophoresis images which randomly select 10 Yangtai small black chickens with different genotypes, respectively use white sailing chickens and short pure chickens as positive controls and use water as negative controls).
TABLE 1 detection results of different chickens tested
The detection result shows that the genotype is ZDWZDWThe Yangtai black cock and the genotype are ZDWThe PCR amplification products of the Yangtai small black hen of W all showed a band of 700bp to 800bp (FIGS. 1 and 3). In FIGS. 1 and 3, the chicken to be identified is shown in the first lane on the left side of the lane shown as Marker. Sequencing the PCR product of each chicken to be identified, and the result shows that the genotype is ZDWZDWThe Yangtai black cock and the genotype are ZDWThe sequence of the PCR amplification product of the Yangtai black hen is shown as SEQ ID NO: 4, and (2) is as follows: gggatgttcattgcctttctctgacgtgaacagaagtgcatgacgtgcagtgaatgcagatcttgctcatgatgtctcccactgaactcactgatgctctctttgtgaccaagggctacaggactgagcccaaacattgggtgggatttttacgttcagaacgtactctatggtaaatgtgcattaggtattctgctaatttgctgctatatttttctaacagctacattatttagttacatataaaatttcatagatgatagacactaatgcaagtaaagcctatgtttgtttggaaaaagtttcttactctgtttctattgccaaaaatagttaaatacctcaatcaaactcagaatgtcattttggtactttactggtcacacaagccattattcgccggtcagaagatgtgtctttcagtttctatttaactttccttatgtcagtgttttgtttgttttcctcgaagtttaataaatgtattgtctttgatctgtcccgacagaatgtgttttattgcagataattcagtgtttgtggaaaacagagattctgccaggagaaatcgagtatttcatagtgagtgaagaagaatacagctttcctttgaacacaagcaatatctgctggcattggtgttttcacttattgatatttatttagttaaaaatagaactacatacctgaatcagtagaaggagataggacat, the size is 713 bp.
Genotype is ZdwThe PCR amplification products of the Yangtai little black chicken of W all show a band of 600bp to 700bp (FIG. 4). In FIG. 4, the first lane on the left is Marker, and the other lanes are chickens to be identified. Sequencing the PCR product of each chicken to be identified, and the result shows that the genotype is ZDWThe sequences of the PCR amplification products of the Yangtai small black hen are shown as SEQ ID NO: and 5, as follows: atgcctatttctgtgaggcagatgtgaaaaaatgtattgctgtgatttcacaggaagaggatgagccgcgtgttcaggagcaaagctgtaacgaggacacttacttcaccacagaaagccttaccactaccggtatcaatcttggagcttcaatggcagaaaccccaagtatggaaatgcctgtcccagactacacttctattcatattgttcactctccacaaggccttgtgctcaatgcactcaatcaaactcagaatgtcattttggtactttactggtcacacaagccattattcgccggtcagaagatgtgtctttcagtttctatttaactttccttatgtcagtgttttgtttgttttcctcgaagtttaataaatgtattgtctttgatctgtcccgacagaatgtgttttattgcagataattcagtgtttgtggaaaacagagattctgccaggagaaatcgagtatttcatagtgagtgaagaagaatacagctttcctttgaacacaagcaatatctgctggcattggtgttttcacttattgatatttatttagttaaaaatagaactacatacctgaatcagtagaaggagataggacat, the sizes are all 614 bp.
Genotype is ZDWZdwThe PCR amplification products of Yangtai little black chicken show one band of 600 bp-700 bp and one band of 700 bp-800 bp (figure 2). In FIG. 2, the first lane on the left is Marker, and the other lanes are chickens to be identified. Sequencing the PCR product of each chicken to be identified, and the result shows that the genotype is ZDWZdwThe sequences of PCR amplification products of the Yangtai black cock are shown as SEQ ID NO: 4 and as shown in SEQ ID NO: 5, the sizes are 713bp and 614bp respectively.
Comparative example 1
An identification method similar to application example 1, except that the primer sets were identified as follows: the nucleotide sequence of the forward primer of the primer pair 3 is shown as SEQ ID NO: 6, showing: 5'-ggcagaaaccccaagtatg-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO: 7, and: 5'-tcgggacagatcaaagaca-3', respectively; primer pair 4 forward primer nucleotide sequence is shown as SEQ ID NO: 8, showing: 5'-tgcagcaaaaattaaaaacag-3', the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9 is as follows: is 5'-cgtattcaattcctgtgtttc-3'.
The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 54 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; extension at 72 ℃ for 5 min.
The reaction system for PCR amplification is a 20-mu L system:PCR SuperMix (+ dye) (purchased from Beijing Quanjin Biotechnology Co., Ltd., product No. AS111-11) 10. mu.L (concentration: 10. mu. moL/L), 0.4. mu.L each of the forward primer of primer pair 3 and the forward primer of primer pair 4 (concentration: 10. mu. moL/L), 0.4. mu.L each of the reverse primer of primer pair 3 and the reverse primer of primer pair 4 (concentration: 10. mu. moL/L), 2.5. mu.L of DNA template (concentration: 100 ng/. mu.L), and 5.9. mu.L of deionized water.
The judgment of the amplification product of the primer set is as follows: when the sample chicken contains an amplification product of 200 bp-300 bp and an amplification product of more than 500bp and less than 600bp, the sample chicken is a heterozygous chicken carrying a sex linked dwarf gene; the genotype of the heterozygous chicken carrying the sex linked dwarf gene is ZDWZdw;
When only the amplification product of 200 bp-300 bp is contained, the sample chicken is homozygous chicken carrying sex linkage dwarf gene; the genotype of the homozygous chicken carrying the sex linked dwarf gene is ZdwW or ZdwZdw(ii) a Further typing is distinguished according to the sex of the sample chicken;
when only the amplification product of more than 500bp and less than 600bp is contained, the sample chicken is homozygous chicken not carrying the sex linkage dwarf gene; the genotype of the homozygous chicken not carrying the sex linked dwarf gene is ZDWW or ZDWZDW(ii) a Further typing was based on the gender of the sample chicken.
The DNA samples of the blood of Yangtai small black chickens, the samples of which were randomly selected genotypes in application example 1, were 3 each, and the measurement results are shown in FIG. 5 (wherein, lanes M are DNA molecular weight markers (100-1500 bp Ladder), and lanes 1, 2, and 3 are genotypes ZDWZdwYangtai black cock; 4.5. genotype in lane 6 is ZDWZDWYangtai little black chicken; 7. lanes 8 and 9 show genotype ZDWW Yangtai black chicken hen; 10. lanes 11 and 12 show genotype ZdwW young black hen, yangtai).
As can be seen from FIG. 5, the primer set in comparative example 1 had significant primer dimer, which resulted in poor discrimination of the non-dwarf allele DW gene and no discrimination of the genotype ZDWZdwThe cock of (1) is heterozygote.
In conclusion, the genotype of the chicken carried by the sex-linked dwarf gene can be quickly and accurately identified through the specific primer group; in addition, the designed primer has strong specificity and stable and reliable result, the genotype of the chicken to be identified can be determined within 3 hours, the primer can be used for early selection, and the cock or the hen carrying the sex-linked dwarf gene in the normal population is eliminated or eliminated according to the genotype, so that the feeding cost is reduced, and the population uniformity is improved.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> university of agriculture in China
<120> primer group for identifying sex-linked dwarf gene and application thereof
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgcctattt ctgtgagg 18
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggatgttca ttgccttt 18
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgtcctatc tccttctact g 21
<210> 4
<211> 713
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gggatgttca ttgcctttct ctgacgtgaa cagaagtgca tgacgtgcag tgaatgcaga 60
tcttgctcat gatgtctccc actgaactca ctgatgctct ctttgtgacc aagggctaca 120
ggactgagcc caaacattgg gtgggatttt tacgttcaga acgtactcta tggtaaatgt 180
gcattaggta ttctgctaat ttgctgctat atttttctaa cagctacatt atttagttac 240
atataaaatt tcatagatga tagacactaa tgcaagtaaa gcctatgttt gtttggaaaa 300
agtttcttac tctgtttcta ttgccaaaaa tagttaaata cctcaatcaa actcagaatg 360
tcattttggt actttactgg tcacacaagc cattattcgc cggtcagaag atgtgtcttt 420
cagtttctat ttaactttcc ttatgtcagt gttttgtttg ttttcctcga agtttaataa 480
atgtattgtc tttgatctgt cccgacagaa tgtgttttat tgcagataat tcagtgtttg 540
tggaaaacag agattctgcc aggagaaatc gagtatttca tagtgagtga agaagaatac 600
agctttcctt tgaacacaag caatatctgc tggcattggt gttttcactt attgatattt 660
atttagttaa aaatagaact acatacctga atcagtagaa ggagatagga cat 713
<210> 5
<211> 614
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atgcctattt ctgtgaggca gatgtgaaaa aatgtattgc tgtgatttca caggaagagg 60
atgagccgcg tgttcaggag caaagctgta acgaggacac ttacttcacc acagaaagcc 120
ttaccactac cggtatcaat cttggagctt caatggcaga aaccccaagt atggaaatgc 180
ctgtcccaga ctacacttct attcatattg ttcactctcc acaaggcctt gtgctcaatg 240
cactcaatca aactcagaat gtcattttgg tactttactg gtcacacaag ccattattcg 300
ccggtcagaa gatgtgtctt tcagtttcta tttaactttc cttatgtcag tgttttgttt 360
gttttcctcg aagtttaata aatgtattgt ctttgatctg tcccgacaga atgtgtttta 420
ttgcagataa ttcagtgttt gtggaaaaca gagattctgc caggagaaat cgagtatttc 480
atagtgagtg aagaagaata cagctttcct ttgaacacaa gcaatatctg ctggcattgg 540
tgttttcact tattgatatt tatttagtta aaaatagaac tacatacctg aatcagtaga 600
aggagatagg acat 614
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggcagaaacc ccaagtatg 19
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcgggacaga tcaaagaca 19
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgcagcaaaa attaaaaaca g 21
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cgtattcaat tcctgtgttt c 21
Claims (10)
1. A primer group for identifying a sex-linked dwarf gene is characterized by comprising a primer pair 1 and a primer pair 2;
the nucleotide sequence of the forward primer of the primer pair 1 is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 1 is shown as SEQ ID NO: 3 is shown in the specification;
the nucleotide sequence of the forward primer of the primer pair 2 is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the reverse primer of the primer pair 2 is shown as SEQ ID NO: 3, respectively.
2. The use of the primer set of claim 1 for identifying chicken carrying the sex linked dwarf gene.
3. A reagent or kit for identifying chicken carrying sex-linked dwarf gene, which comprises the primer set of claim 1.
4. A method for identifying chicken carried by sex-linked dwarf gene is characterized by comprising the following steps:
carrying out PCR amplification by using a primer group according to claim 1 by taking the cDNA reverse transcribed from the genome DNA or the total RNA of a sample chicken as a template to obtain an amplification product;
the judgment of the amplification product comprises: when the sample chicken contains the amplification product of 600 bp-700 bp, the sample chicken is a carrier of sex linked dwarf gene.
5. The method of claim 4, wherein the PCR reaction program comprises: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; extension at 72 ℃ for 5 min.
6. The method according to claim 4, wherein the reaction system for PCR amplification is 20 μ L, and comprises:10 mu L of PCR SuperMix, 0.4 mu L of each of the forward primer of the primer pair 1 and the forward primer of the primer pair 2 in the primer group, 0.2 mu L of each of the reverse primer of the primer pair 1 and the reverse primer of the primer pair 2 in the primer group, 2.5 mu L of DNA template and the rest of deionized water.
7. The method of claim 6, wherein the step of determining the target position is performed by a computerThe concentration of PCR SuperMix is 10 mu moL/L; the working concentration of the forward primer of the primer pair 1, the reverse primer of the primer pair 1, the forward primer of the primer pair 2 and the reverse primer of the primer pair 2 in the primer group is 10 mu moL/L; the concentration of the DNA template was 100 ng/. mu.L.
8. The method of claim 4, wherein the determining comprises electrophoresis or sequencing.
9. The method of claim 4, wherein the determining of the amplification product further comprises: when the sample chicken contains an amplification product of 600 bp-700 bp and an amplification product of more than 700bp and less than or equal to 800bp, the sample chicken is a heterozygous chicken carrying a sex linked dwarf gene;
when only the amplification product of 600 bp-700 bp is contained, the sample chicken is homozygous chicken carrying sex linked dwarf gene;
when only the amplification product of more than 700bp and less than or equal to 800bp is contained, the sample chicken is homozygous chicken not carrying the sex linkage dwarf gene.
10. Use of the primer set of claim 1, the reagent or kit of claim 3, or the method of any one of claims 4 to 9 for assisting in breeding new breeds of dwarf chicken flocks.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110870820.6A CN113430277A (en) | 2021-07-30 | 2021-07-30 | Primer group for identifying sex-linked dwarf gene and application thereof |
PCT/CN2022/105580 WO2022258078A1 (en) | 2021-07-30 | 2022-07-14 | Primer set for identifying sex-linked dwarf gene and application thereof |
ZA2022/13940A ZA202213940B (en) | 2021-07-30 | 2022-12-22 | Primer set for identifying sex-linked dwarf gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110870820.6A CN113430277A (en) | 2021-07-30 | 2021-07-30 | Primer group for identifying sex-linked dwarf gene and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN113430277A true CN113430277A (en) | 2021-09-24 |
Family
ID=77762588
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110870820.6A Pending CN113430277A (en) | 2021-07-30 | 2021-07-30 | Primer group for identifying sex-linked dwarf gene and application thereof |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN113430277A (en) |
WO (1) | WO2022258078A1 (en) |
ZA (1) | ZA202213940B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022258078A1 (en) * | 2021-07-30 | 2022-12-15 | 中国农业大学 | Primer set for identifying sex-linked dwarf gene and application thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116287318B (en) * | 2023-04-14 | 2023-10-20 | 江苏省家禽科学研究所 | Seed production method of high-propagation slow-feather high-quality broiler new strain |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102747077A (en) * | 2012-06-18 | 2012-10-24 | 中国农业大学 | Method for identifying chicken sex-linked dwarf gene and special primer thereof |
CN104593358A (en) * | 2014-12-22 | 2015-05-06 | 江苏省家禽科学研究所 | Primer for identifying Shaobai chicken as well as application and method for quickly identifying Shaobai chicken |
AU2019101693A4 (en) * | 2019-12-24 | 2020-02-06 | Jiangsu Institute of Poultry Science | A Primer for Identification of Shaobo Chicken and Its Application and A Method for Rapid Identification of Shaobo Chicken |
CN112442541A (en) * | 2019-08-27 | 2021-03-05 | 北京康普森农业科技有限公司 | Detection method of chicken sex-linked dwarf gene |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109997788B (en) * | 2019-04-19 | 2021-04-20 | 广西壮族自治区畜牧研究所 | Breeding method of short and small yellow-feather yellow-shank chickens |
CN113430277A (en) * | 2021-07-30 | 2021-09-24 | 中国农业大学 | Primer group for identifying sex-linked dwarf gene and application thereof |
-
2021
- 2021-07-30 CN CN202110870820.6A patent/CN113430277A/en active Pending
-
2022
- 2022-07-14 WO PCT/CN2022/105580 patent/WO2022258078A1/en unknown
- 2022-12-22 ZA ZA2022/13940A patent/ZA202213940B/en unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102747077A (en) * | 2012-06-18 | 2012-10-24 | 中国农业大学 | Method for identifying chicken sex-linked dwarf gene and special primer thereof |
CN104593358A (en) * | 2014-12-22 | 2015-05-06 | 江苏省家禽科学研究所 | Primer for identifying Shaobai chicken as well as application and method for quickly identifying Shaobai chicken |
CN112442541A (en) * | 2019-08-27 | 2021-03-05 | 北京康普森农业科技有限公司 | Detection method of chicken sex-linked dwarf gene |
AU2019101693A4 (en) * | 2019-12-24 | 2020-02-06 | Jiangsu Institute of Poultry Science | A Primer for Identification of Shaobo Chicken and Its Application and A Method for Rapid Identification of Shaobo Chicken |
Non-Patent Citations (1)
Title |
---|
冒世杰等: "含有性连锁矮小型基因DW和/或dw基因溧阳鸡的检测方法研究", 《中国家禽》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022258078A1 (en) * | 2021-07-30 | 2022-12-15 | 中国农业大学 | Primer set for identifying sex-linked dwarf gene and application thereof |
Also Published As
Publication number | Publication date |
---|---|
WO2022258078A1 (en) | 2022-12-15 |
ZA202213940B (en) | 2023-03-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Fan et al. | Genome-wide patterns of genetic variation in two domestic chickens | |
CN108220408B (en) | Grain-saving green-shin recessive white feather broiler new strain breeding method | |
CN110273010B (en) | Identification and application method of MC1R gene haplotype | |
WO2022258078A1 (en) | Primer set for identifying sex-linked dwarf gene and application thereof | |
CN113913538B (en) | SNP molecular marker related to chicken carcass traits and application | |
CN111850133B (en) | Low-temperature-resistant associated SNP molecular marker of litopenaeus vannamei, detection primer and application of detection primer | |
CN110129453B (en) | Method for identifying genotype of fast and slow feathers of chicken | |
CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
EP1437418A1 (en) | Selecting animals for desired genotypic or potential phenotypic properties based on a single nucleotide polymorphism (SNP) in intron 3 of the IGF2 gene | |
CN111926086B (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
CN111910008B (en) | Molecular marker related to chicken growth and development and application thereof | |
CN113862375A (en) | SNP (Single nucleotide polymorphism) marker of AANAT (ananas site-directed translation) and ASMT (antisense-fluorescent marker) genes of cattle and application thereof | |
CN107937568B (en) | Application and method of PRLR gene | |
CN111961732B (en) | Molecular marker influencing full bore weight of chicken and application thereof | |
CN111500742A (en) | Chicken growth trait gene diagnostic kit and application thereof | |
CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
CN111378765B (en) | SNP (Single nucleotide polymorphism) marker of fast-growing grass carp individual and application of SNP marker | |
CN110835651B (en) | Primer and kit for detecting indel multiple allele markers of chicken CDKN3 gene promoter region and application of primer and kit | |
CN114214432A (en) | Molecular marker for identifying melanin diffusion gene locus of chicken and application of molecular marker in assisted breeding | |
CN108624703B (en) | method and kit for predicting growth traits and meat quality indexes of cattle | |
CN113528675A (en) | Molecular marker for identifying duck slaughter traits based on myostatin gene MSTN, and identification method and application thereof | |
CN112695101A (en) | Method for identifying early sex of quail, matched kit and special primer pair | |
CN112176073A (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
CN111826449A (en) | Method for obtaining molecular marker related to gynogenesis bighead malformation character and application thereof | |
CN110578005B (en) | Identification primer and kit for chicken sex-linked light reed flower feather gene, identification method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |