CN110420328B

CN110420328B - Application of SYT14 inhibitor in preparation of medicine for treating lung cancer

Info

Publication number: CN110420328B
Application number: CN201910655340.0A
Authority: CN
Inventors: 王效静; 闵生萍; 刘飞; 吴楠
Original assignee: First Affiliated Hospital of Bengbu Medical College
Current assignee: First Affiliated Hospital of Bengbu Medical College
Priority date: 2019-07-19
Filing date: 2019-07-19
Publication date: 2021-10-29
Anticipated expiration: 2039-07-19
Also published as: CN110420328A

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of a SYT14 inhibitor. Through extensive and intensive research, SYT14 can be used as a lung cancer treatment target for the first time. The SYT14 inhibitor can inhibit the proliferation rate of lung cancer cells, inhibit the metastasis capacity of the lung cancer cells, promote the apoptosis of the lung cancer cells and inhibit the invasion capacity of the lung cancer cells, thereby treating the lung cancer and opening up a new direction for treating the lung cancer.

Description

Application of SYT14 inhibitor in preparation of medicine for treating lung cancer

Technical Field

The invention belongs to the field of biomedical research, and particularly relates to application of a SYT14 inhibitor in preparation of a lung cancer treatment drug.

Background

Primary bronchogenic carcinoma (lung cancer for short) is the most common malignant tumor in recent years, and the rate of incidence is high at the top of various tumors. Despite the emerging therapeutic approaches to lung cancer, 5-year survival rates are only 14.1%, with 60% of patients dying within 1 year after diagnosis. Chemotherapy is the primary treatment for lung cancer, and over 90% of lung cancers require chemotherapy. Chemotherapy is divided into therapeutic chemotherapy and adjuvant chemotherapy. Different chemotherapeutic drugs and different chemotherapeutic schemes are selected according to different histological types of the lung cancer. Chemotherapy can kill tumor cells and also damage normal cells of the human body. Chemotherapy inhibits the bone marrow hematopoietic system, primarily the decline of leukocytes and platelets, and can be treated with granulocyte colony stimulating factor and platelet stimulating factor. Therefore, there is an urgent need to find a feasible therapeutic strategy for lung cancer.

Disclosure of Invention

In order to overcome the problems of the prior art, the present invention aims to provide a novel use of an inhibitor of SYT 14.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in a first aspect of the invention, there is provided the use of an inhibitor of SYT14 for the manufacture of a medicament for the treatment of lung cancer.

Further, the lung cancer treatment drug has at least one of the following functions:

inhibiting proliferation rate of lung cancer cell, inhibiting metastasis of lung cancer cell, promoting apoptosis of lung cancer cell, and inhibiting invasion of lung cancer cell.

Further, the SYT14 inhibitor refers to a molecule having an inhibitory effect on SYT 14.

Having inhibitory effects on SYT14 include, but are not limited to: inhibit SYT14 activity, or inhibit transcription or expression of SYT14 gene.

The SYT14 inhibitor can be siRNA, shRNA, antibody and small molecule compound.

As exemplified in the examples herein, the SYT14 inhibitor may be an siRNA or shRNA. The target sequence of the siRNA or the target sequence of the shRNA is shown as SEQ ID NO:1 is shown. Specifically, the method comprises the following steps: TGTGATATTGGAACCTTCT are provided.

In one embodiment, the nucleotide sequence of the siRNA is as set forth in SEQ ID NO: 2, respectively. Specifically, the method comprises the following steps: UGUGAUAUUGGAACCUUCU are provided.

In one embodiment, the nucleotide sequence of the shRNA is as set forth in SEQ ID NO: 3, respectively. Specifically, the method comprises the following steps: CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT are provided.

The lung cancer treatment drug necessarily comprises a SYT14 inhibitor, and a SYT14 inhibitor is used as an effective component of the aforementioned functions.

In the lung cancer treatment drug, the effective component playing the roles can be only an SYT14 inhibitor, and other molecules playing the roles can also be contained.

That is, the SYT14 inhibitor is the only active ingredient or one of the active ingredients of the lung cancer therapeutic drug.

The lung cancer treatment medicine can be a single-component substance or a multi-component substance.

The form of the lung cancer treatment drug is not particularly limited, and the lung cancer treatment drug can be in the forms of various substances such as solid, liquid, gel, semifluid, aerosol and the like.

The lung cancer treatment drug mainly aims at mammals such as rodents, primates and the like.

In a second aspect of the invention, a method of treating lung cancer is provided by administering to a subject an inhibitor of SYT 14.

The subject may be a mammal or a mammalian lung cancer cell. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The lung cancer cell may be an ex vivo lung cancer cell.

The subject may be a patient suffering from lung cancer or an individual in whom treatment for lung cancer is desired. Or the subject is an isolated lung cancer cell from a lung cancer patient or an individual expected to treat lung cancer.

The SYT14 inhibitor may be administered to a subject before, during, or after receiving treatment for lung cancer.

In a third aspect of the present invention, there is provided a medicament for the treatment of lung cancer, comprising an effective amount of an inhibitor of SYT 14.

The SYT14 inhibitor can be siRNA, shRNA, antibody and small molecule compound.

In a fourth aspect of the present invention, there is provided a combination therapy for lung cancer comprising an effective amount of an inhibitor of SYT14 and at least one other drug for treating lung cancer.

The combination therapy drug combination may be in any one of the following forms:

firstly), the SYT14 inhibitor and other lung cancer treatment drugs are respectively prepared into independent preparations, the preparation forms can be the same or different, and the administration routes can be the same or different.

When the other lung cancer-treating drug is an antibody, a parenteral administration type is generally employed. When other lung cancer treatment medicines are chemical medicines, the administration forms can be rich, and the administration can be carried out in the gastrointestinal tract or the parenteral tract. Known routes of administration for each chemical are generally recommended.

Two) the SYT14 inhibitor and the other lung cancer therapeutic agent are formulated into a combination preparation, and when the SYT14 inhibitor and the other lung cancer therapeutic agent are administered by the same administration route and administered simultaneously, they may be formulated into a combination preparation.

In a fifth aspect of the present invention, a method for treating lung cancer is provided, comprising administering to a subject an effective amount of a SYT14 inhibitor and administering to the subject an effective amount of another lung cancer treatment agent and/or administering to the subject another means for treating lung cancer.

An effective amount of a SYT14 inhibitor and an effective amount of at least one other lung cancer therapeutic agent may be administered simultaneously or sequentially.

Based on that SYT14 is the lung cancer treatment target discovered for the first time, the compound has at least additive curative effect in combination with other lung cancer treatment medicaments except SYT14 inhibitors, and further enhances the treatment effect on the lung cancer.

Other lung cancer therapeutic agents include, but are not limited to: antibody drugs, chemical drugs or targeted drugs, etc.

The SYT14 inhibitor may be administered parenterally or parenterally. The other lung cancer therapeutic agent may be administered gastrointestinal or parenteral. For antibody drugs, parenteral administration is generally employed.

In a sixth aspect of the invention, there is provided the use of an inhibitor of SYT14 in the manufacture of a medicament for use in any one or more of the following: inhibiting proliferation rate of lung cancer cell, inhibiting metastasis of lung cancer cell, promoting apoptosis of lung cancer cell, and inhibiting invasion of lung cancer cell.

In a seventh aspect of the invention, there is provided use of SYT14 in the preparation and screening of a medicament for the treatment of lung cancer.

In one embodiment, SYT14 is used as a target of action.

In one embodiment, the use is in particular: and (3) screening candidate substances by taking SYT14 as an action object to find out a SYT14 inhibitor as a potential lung cancer treatment drug.

In one embodiment, the use is in particular: and (3) screening the double-stranded RNA or shRNA capable of reducing the expression level of the SYT14 gene in the lung cancer cell as a lung cancer treatment drug by using the SYT14 gene as an action target.

In one embodiment, the target sequence of the double-stranded RNA or shRNA is shown in SEQ ID NO. 1.

Compared with the prior art, the invention has the following beneficial effects:

through extensive and intensive research, SYT14 can be used as a lung cancer treatment target for the first time. The SYT14 inhibitor can inhibit the proliferation rate of lung cancer cells, inhibit the metastasis capacity of the lung cancer cells, promote the apoptosis of the lung cancer cells and inhibit the invasion capacity of the lung cancer cells, thereby treating the lung cancer and opening up a new direction for treating the lung cancer.

Drawings

FIG. 1: qPCR measures the efficiency of target gene depletion at the mRNA level.

FIG. 2: results of automatic analysis of Celigo cells revealed that depletion of SYT14 gene inhibited proliferation of lung cancer cells. (cell line H1299 non-small cell lung carcinoma, statistics of

cell number

1, 2, 3, 4 and 5 days after virus infection)

FIG. 3: cell numbers were collected from experimental and control groups at different time points after viral infection.

FIG. 4: graph comparing the fold change in cell number over time for shSYT14 and control (shCtrl). (statistical data calculated from the ratio of the number of cells collected at different time points to the number of cells collected on the first day.)

FIG. 5: transwell experiments showed that SYT14 abolished metastatic capacity affecting H1299 lung cancer cells.

FIG. 6: the number of transferred cells in the SYT 14-treated group was analyzed with respect to the number of transferred cells in the control group (shCtrl).

FIG. 7: transwell experiments showed that SYT14 abolished the invasive potential of H1299 lung cancer cells.

FIG. 8: the number of invasive cells in the SYT 14-treated group was analyzed with respect to the number of invasive cells in the control group (shCtrl).

FIG. 9: the influence of the reduction of SYT14 gene on the proliferation of H1299 lung cancer cells is verified by detecting the activity of Caspase 3/7.

FIG. 10: annexin V-APC single-staining showed apoptotic results of lung cancer cells in shSYT14 group and control group (shCtrl) H1299. (the figure shows typical peak picture of sample flow cytometry of experimental group and control group)

FIG. 11: the Annexin V-APC single staining method detects the apoptosis ratio of shSYT14 group and control group (shCtrl).

FIG. 12 shows MTT assay results showing the proliferation of H1299 lung cancer cells in the test and control groups at different time points after viral infection. (comparison of absorbance of light at 490nm wavelength with time by microplate reader, OD490 here reflecting the number of viable cells)

FIG. 13: MTT experimental results comparative plots of the ratio of active cells of shSYT14 group to control group (shCtrl) as a function of time were analyzed. (statistics calculated from the ratio of the OD490 values of the active cells collected at different time points to the OD490 values of the active cells collected on the first day.)

In the drawings, there is shown in the drawings,

bar graphs represent the mean of three experiments and error bars represent Standard Deviation (SD).

P <0.01 for shCtrl compared to target gene shRNA lentivirus treatment group.

shCtrl, 0.01< P <0.05 compared to target gene shRNA lentivirus treatment group.

Detailed Description

The invention develops the lung cancer gene related information in the TCGA database and further refers to a large number of literatures. Meanwhile, functional gene screening methods such as expression profile difference analysis, high-throughput cell screening technology and the like are combined. Finally, a possible specific oncogene SYT14 promoting lung cancer transformation is successfully screened out, and the gene has not been further developed and researched in the field of lung cancer so far.

Subsequently, the present invention confirmed the role of the SYT14 gene in the development of lung cancer from a cell functional point of view. Detecting the expression conditions of mRNA and protein level target genes in two groups of lung cancer cell lines by constructing a target gene shRNA lentivirus, transfecting lung cancer cells with the lentivirus and comparing the lung cancer cells with transfection control vector lentivirus; and then cell proliferation, apoptosis, cell cycle and other detection are carried out through cytofunctional experiments, and the results show that the lung cancer cell proliferation inhibition degree of the shRNA group is obviously higher than that of the control group and the increase degree of the cell apoptosis rate of the shRNA group is higher than that of the control group compared with the control group.

According to the research results, a new method for diagnosing and treating the gene is further explored and developed, so that more choices can be provided for the diagnosis and treatment of the lung cancer patient.

SYT14 inhibitors

Refers to a molecule having inhibitory effect on SYT 14. Having inhibitory effects on SYT14 include, but are not limited to: inhibit SYT14 activity, or inhibit transcription or expression of SYT14 gene. The SYT14 inhibitor includes but is not limited to siRNA, shRNA, antibody, small molecule compound.

Inhibition of SYT14 activity refers to a decrease in SYT14 activity. Preferably, SYT14 activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% as compared to prior to inhibition.

Inhibition of transcription or expression of the SYT14 gene refers to: by making the gene of SYT14 non-transcribed or by reducing the transcriptional activity of the gene of SYT14, by making the gene of SYT14 non-expressed or by reducing the expression activity of the gene of SYT 14.

The skilled person may use conventional methods for regulating transcription or expression of a gene of SYT14, such as gene knock-out, homologous recombination, interfering RNA, etc.

Inhibition of gene transcription or expression of SYT14 was confirmed by PCR and Western Blot detection of the expression level.

Preferably, transcription or expression of the SYT14 gene is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, most preferably no expression of the SYT14 gene as compared to wild type.

Small molecule compounds

The invention refers to a compound which is composed of several or dozens of atoms and has the molecular mass of less than 1000.

SYT14 inhibitor for preparing medicine

The SYT14 inhibitor is used as a main active ingredient or one of the main active ingredients for preparing the medicine for treating the lung cancer. Generally, the medicament may comprise one or more pharmaceutically acceptable carriers or excipients in addition to the active ingredient, according to the requirements of different dosage forms.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

A "pharmaceutically acceptable carrier or adjuvant" should be compatible with, i.e., capable of being blended with, an inhibitor of SYT14 without substantially reducing the effectiveness of the pharmaceutical composition as is normally the case. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

Combination therapeutic drug combinations and methods of administration

firstly), the SYT14 inhibitor and other lung cancer treatment drugs are respectively prepared into independent preparations, the preparation forms can be the same or different, and the administration routes can be the same or different. When in use, several medicines can be used simultaneously or sequentially. When administered sequentially, the other drugs should be administered to the body during the period that the first drug is still effective in the body.

The antibody is usually administered by intravenous injection, intravenous drip or arterial infusion. The usage and the dosage can refer to the prior art.

The small molecule compounds are usually administered by either gastrointestinal or parenteral administration. The siRNA, shRNA and antibody are generally administered parenterally. Can be administered locally or systemically.

When in use, an effective amount of the SYT14 inhibitor and an effective amount of other lung cancer treatment medicaments can be used simultaneously, or an effective amount of the SYT14 inhibitor and an effective amount of other lung cancer treatment medicaments can be used successively. When administered sequentially, the other drug should be administered to the organism during the period that the first drug is still effective for the organism.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

Example 1

(I) Experimental method

1. Interfering lentivirus production against SYT14 Gene

Specific target interference sequences are designed aiming at SYT14 genes, shRNA aiming at SYT14 is marked as shSYT14, and the target sequences aimed at shSYT14 are shown as SEQ ID NO:1, specifically: TGTGATATTGGAACCTTCT are provided. The sequence of siRNA corresponding to shSYT14 is shown in SEQ ID NO: 2, specifically:

UGUGAUAUUGGAACCUUCU are provided. The sequence of the sh SYT14 is shown as SEQ ID NO: 3, specifically: CCGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT are provided. The target sequence of the negative control (shCtrl) is shown as SEQ ID NO.4, and specifically comprises the following steps: TTCTCCGAACGTGTCACGT are provided.

Designing shRNA interference sequences according to target sequences, respectively constructing the shRNA interference sequences into Hu6-MCS-CMV-EGFP plasmid vectors, co-transfecting 293T cells with pHelper 1.0 vector plasmids and pHelper 2.0 vector plasmids, obtaining unpurified cell supernatants after transfection for 48-72h, and purifying and concentrating the supernatants to obtain the high-titer lentiviruses.

2. RT-PCR detection of target gene knockdown efficiency

Primer design was performed for the SYT14 gene. Extracting shCtrl and shSYT14 interfering lentivirus infected cells of the control group, respectively extracting RNA, carrying out reverse transcription to obtain cDNA, and detecting the mRNA expression of SYT14 in H1299 cells by RT-PCR with GAPDH as an internal reference.

3. Celigo cell counting method for detecting cell growth

After 4 days of lentivirus infection of H1299 cells, subculturing the H1299 cells in a 96-well plate, after 24 hours of plate paving, reading the cells expressing EGFP fluorescence by a celigo instrument, photographing, processing and calculating the number of cells of different groups in the well plate by software, continuously detecting for 5 days, drawing a growth curve graph of the cells, and analyzing the growth condition of the cells.

4. Transwell cell migration invasion (extracellular matrix (ECM) -free) assay for the effect of SYT14 gene depletion on cell metastasis

After 4 days of lentivirus infection of H1299 cells, the cells were inoculated into the upper chamber (upper chamber serum-free medium, lower chamber 30% FBS medium) at a density of 5000 cells/well, cultured in an incubator at 37 ℃ for a period of time, non-transferred cells in the chamber were removed, and after Giemsa staining for 3-5 min, pictures were taken with a microscope. And (5) counting the proportion of cells in each group and analyzing the cell transfer condition.

5. Transwell cell migration invasion (with ECM) detection of the Effect of SYT14 Gene depletion on cell migration

The method was described in reference to the extracellular matrix (ECM) -free protocol in fig. 4, with the only difference that the test device was tested using ECM-containing chambers.

6. Caspase3/7 detection of the Effect of SYT14 Gene depletion on apoptosis

The H1299 cells were passaged after 3 days of lentivirus infection and cultured for 2 additional days for detection. Add to 96-well plate at 10000 cells/well density. Then 100 ul of prepared Caspase-Glo reaction solution is added respectively, and the mixture is placed on a plate shaking machine to be shaken gently at the rotating speed of 300-. Then incubated at room temperature for 2 hours at 18-22 ℃ depending on the cell condition. The signal intensity was measured using an instrument and the data was analyzed.

7. FACS detection of apoptosis detection

And (3) after lentivirus infection is carried out on H1299 cells for 3 days, passage plating is carried out, after the cell fusion degree reaches 85%, the cells are digested and collected, Annnexin V-APC staining treatment is added, the cells are detected by using a flow cytometer, and analysis is carried out by using guava InCyte flow cytometer analysis software.

8. MTT detection of cell viability

After 3 days of lentivirus infection of H1299 cells, subculturing and plating in a 96-well plate, wherein the plating number is 2000, 20 mu L of 5mg/ml MTT solution is added for 4 hours before the termination of culture after plating for 24 hours, and 100 mu L of DMSO solution is added for detection by an enzyme-labeling instrument after 4 hours.

(II) results of the experiment

1. Verification of SYT14 gene reduction efficiency

After 3 days of shRNA lentivirus infection, expression level of SYT14 gene was inhibited in the mRNA level in H1299 cells of the experimental group (FIG. 1).

2. Effect of SYT14 Gene depletion on cell proliferation

As shown in fig. 2-4, cells were plated in 96-well plates upon shRNA lentivirus infection. Celigo continuously tests for 5 days, and found that the proliferation rate of H1299 cells in the experimental group is remarkably inhibited. It was shown that the SYT14 gene was significantly associated with the proliferative capacity of H1299 cells.

3. Effect of SYT14 Gene depletion on cell transfer

Transwell cell migration invasion (extracellular matrix (ECM) -free results are shown in FIGS. 5-6, the transfer capacity of H1299 cells in the experimental group is significantly inhibited 24H after shRNA lentivirus infection, indicating that the SYT14 gene is significantly related to the transfer capacity of H1299 cells.

The results of Transwell cell migration invasion (containing ECM) are shown in FIGS. 7-8, and the invasion capacity of the H1299 cell in the experimental group is significantly inhibited 32H after shRNA lentivirus infection. It was shown that the SYT14 gene was significantly associated with the invasive capacity of H1299 cells.

4. Effect of SYT14 Gene depletion on apoptosis

The detection result of Caspase3/7 is shown in FIG. 9, the activity of Caspase3/7 of H1299 cells in the experimental group is obviously increased when the shRNA lentivirus is subjected to 3-day passage and is detected after 5-day passage, which indicates that SYT14 gene is obviously related to the apoptosis of the H1299 cells.

FACS detection results are shown in FIGS. 10-11, after 3 days of shRNA lentivirus infection, H1299 cells undergoing apoptosis in experimental groups are remarkably increased when detected on day 5, and the SYT14 gene is remarkably related to the apoptosis of the H1299 cells.

5. Effect of SYT14 Gene depletion on cell proliferation

As shown in fig. 12-13, cells were plated in 96-well plates at 2000 plates 3 days after shRNA lentivirus infection. After 5 days of continuous detection, the proliferation rate of H1299 cells in the experimental group is obviously inhibited. It was shown that the SYT14 gene was significantly associated with the proliferative capacity of H1299 cells.

In conclusion, the invention successfully screens out a possible specific cancer gene SYT14 which promotes the transformation of the lung cancer cells, and the function of the specific cancer gene SYT14 is verified by cell functional experiments.

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

Sequence listing

<110> first subsidiary hospital of Anodont institute of medicine

Application of <120> SYT14 inhibitor in preparation of lung cancer treatment drug

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgtgatattg gaaccttct 19

<210> 2

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ugugauauug gaaccuucu 19

<210> 3

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggcctgtg atattggaac cttctctcga gagaaggttc caatatcaca ggttttt 57

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttctccgaac gtgtcacgt 19

Claims

Use of a SYT14 inhibitor for the manufacture of a medicament for the treatment of lung cancer, said SYT14 inhibitor being selected from siRNA or shRNA; the nucleotide sequence of the siRNA is shown as SEQ ID NO: 2, the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.
2. The use according to claim 1, wherein the lung cancer therapeutic agent has at least one of the following functions: inhibiting proliferation rate of lung cancer cell, inhibiting metastasis of lung cancer cell, promoting apoptosis of lung cancer cell, and inhibiting invasion of lung cancer cell.
3. The use according to claim 1, wherein the shRNA or siRNA target sequence is as set forth in SEQ ID NO:1 is shown.
4. The use according to claim 1, wherein the SYT14 inhibitor is the sole active ingredient or one of the active ingredients of the medicament for the treatment of lung cancer.
5. A medicament for treating lung cancer, comprising an effective amount of an inhibitor of SYT14, said inhibitor of SYT14 being selected from siRNA or shRNA; the nucleotide sequence of the siRNA is shown as SEQ ID NO: 2, the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.
6. The drug for the treatment of lung cancer according to claim 5, wherein the SYT14 inhibitor is the only active ingredient or one of the active ingredients of the drug for the treatment of lung cancer.
7. A lung cancer combination therapy comprising an effective amount of a SYT14 inhibitor and at least one other lung cancer therapeutic agent, said SYT14 inhibitor being selected from siRNA or shRNA; the nucleotide sequence of the siRNA is shown as SEQ ID NO: 2, the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.
Use of an inhibitor of SYT14 in the manufacture of a medicament having any one or more of the following effects: inhibiting the proliferation rate of lung cancer cells, inhibiting the metastasis capacity of the lung cancer cells, promoting the apoptosis of the lung cancer cells and inhibiting the invasion capacity of the lung cancer cells, wherein the SYT14 inhibitor is selected from siRNA or shRNA; the nucleotide sequence of the siRNA is shown as SEQ ID NO: 2, the nucleotide sequence of the shRNA is shown as SEQ ID NO: 3, respectively.
The use of SYT14 in screening for a drug for treating lung cancer, SYT14 as an action target; the use specifically refers to: and (3) screening candidate substances by taking SYT14 as an action object to find out a SYT14 inhibitor as a potential lung cancer treatment drug.