CN101954077A

CN101954077A - Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof

Info

Publication number: CN101954077A
Application number: CN201010280657XA
Authority: CN
Inventors: 孙树汉; 商京丽; 魏伟
Original assignee: Second Military Medical University SMMU
Current assignee: Second Military Medical University SMMU
Priority date: 2010-09-14
Filing date: 2010-09-14
Publication date: 2011-01-26
Anticipated expiration: 2030-09-14
Also published as: CN101954077B

Abstract

The invention relates to the field of biomedicine. 5-fluorouracil (5-FU) is widely applied to the chemotherapy of gastral malignant tumors, but primary and acquired medicament resistant phenomena in the chemotherapy of colon cancer are universal; cell apoptosis is an important approach that chemotherapeutics play a role, and APAF-1 serving as regulatory protein is mainly involved in signal transduction of a mitochondrion approach of apoptosis; miR-23a can be combined with APAF1 serving as a target gene thereof so as to reduce the expression of the APAF1, and the apoptosis caused by the mitochondrion approach due to the chemotherapy is reduced so as to enhance the tolerance of the tumors to the chemotherapeutics; and the number of apoptotic cells is increased by reducing the expression amount of the in-vivo miR-23a so as to enhance the sensibility of the chemotherapeutics. The invention provides a PLKO-anti-miR-23a vaccine adjuvant for enhancing the chemotherapeutic effect of the chemotherapeutics, particularly the 5-FU. In-vitro experiments prove that the vaccine adjuvant can enhance the apoptosis level of colon cancer cells caused by the 5-FU serving as the chemotherapeutics obviously, and in-vivo experiments show that the vaccine adjuvant can enhance the chemotherapeutic effect of the 5-FU obviously, inhibit tumor growth and prolong the survival period of immunodeficient mice.

Description

A kind of expression plasmid adjuvant of strengthening the tumor chemotherapeutic drug chemotherapy effect and preparation method thereof that is used to

Technical field

The present invention relates to biomedical sector, be specifically related to a kind of PLKO-anti-miR-23a expression plasmid adjuvant of strengthening the chemotherapeutics chemotherapy effect and preparation method thereof that is used to.

Background technology

5-fluorouracil (5-FU) is widely used in the chemotherapy of malignant tumor of digestive tract, because its determined curative effect, is in the irreplaceable status of other chemotherapeutic always, but some cases are main chemotherapy and insensitive to this medicine.5-FU is the treatment colorectal cancer, gastric cancer, the medicine that cancer of biliary duct is commonly used, the effective percentage of single therapy only about 20%.Chemotherapeutic unite use (as: 5-FU+ vincristine+semustine), the chemotherapy effective percentage of advanced CRC is obviously improved, patient's median survival time obviously prolongs.However, colorectal cancer chemotherapy Central Plains is sent out with the acquired drug-resistance phenomenon very general.The gene genetic polymorphism makes the patient have individuation difference to chemosensitivity.How to select suitable chemotherapy regimen and select the adjuvant of enhancing chemotherapy effect that the patient is benefited from treatment, extremely important.

Apoptosis is the important channel that chemotherapeutics plays a role.Cell has propagation, differentiation and apoptosis three specific characters, and under normal circumstances, the three coordinates mutually, keeps balance.Tumor tissues is except having proliferation activity, and the apoptosis of tumor cells rate reduces, and the clean rate of growth of tumor cell will be improved, and prognosis is then poorer.The process that takes place according to apoptosis is divided into two approach: one is the death receptor approach, promptly by the apoptosis enzyme caspase in the extracellular signal active cell; Article one, be the mitochondrion approach, promptly discharge apoptotic proteins enzyme activity factor and activate caspases by mitochondrion.These activatory caspase albumen can cause apoptosis with intracellular important protein degradation.Mitochondrion plays a crucial role in the apoptosis mechanism, and it not only can self discharge material mediated apoptosis such as cytochrome C, can also change the active state of self with other apoptosis inducing factor combineds effect, thereby better regulate apoptosis.APAF-1 (apoptosis peptide inducible factor 1) is as regulating the signal transduction that albumen mainly participates in the mitochondrion approach.APAF-1 is distributed widely in multiple tissues such as human brain, the heart, liver, spleen, lung, pancreas, kidney, thymus, small intestinal, colon, skeletal muscle, ovary, testis, peripheral blood leucocyte and the cell.Under the chemotherapeutics effect, mitochondria dysfunction causes cytochrome C to discharge; Be discharged into cytoplasmic cytochrome C and can combine with APAF-1 under the condition that dATP exists, make it form polymer, and impel caspase-9 to combine formation apoptosis body with it, caspase-9 is activated immediately; The caspase-9 that is activated can activate other caspase, as caspase-3 etc.; Caspase-3 activates dna fragmentation factor again, causes the endonuclease enzyme activation of quiescent condition, finally causes dna break, causes apoptosis.

MicroRNA (miRNA) is the non-coded protein strand microRNA of about 21～25 bases of a class length, extensively be present in multicellular organism and the virion, mainly be attached on the specific said target mrna by the nucleic acid array complementation coupling, suppressing said target mrna translation process or degraded said target mrna, is a kind of molecule that plays the negative regulation effect.More and more studies show that at present, the miRNA wide participation organism various physiological processes, and correlational study report shows that also its expression and functional disorder may influence multiple pathological phenomenons such as tumor generation, development and chemotherapy.At present, the report for miRNA intervention chemotherapy of tumors increases gradually.For example: people such as FANYIN MENG confirm: the expression that suppresses miR-21 and miR-200b in the chemotherapy of cancer of biliary duct can strengthen sensitivity (the FANYIN MENG of chemotherapeutics, ROGERHENSON, MOLLY LANG, HANIA WEHBE, SHAILMAHESHWARI, JOSHUA T.MENDELL, JINMAI JIANG, THOMAS D.SCHMITTGEN, and TUSHAR PATEL GASTROENTEROLOGY2006; 130:2113-2129).Chan JA, Krichevsky AM, find that Deng researcher miR-21 can strengthen gliomatous drug resistance (Chan JA by disturbing expression of apoptosis-related genes, Krichevsky AM, Kosik KS.MicroRNA-21is an antiapoptotic factor in humanglioblastoma cells.Cancer Res.2005Jul 15; 65 (14): 6029-33.).

Hsa-mir-23a (Mature sequence MIMAT0000078) is a kind of miRNA that handles the back high expressed in tumors such as people's cancer of biliary duct, gastric cancer, colon cancer and breast carcinoma through chemotherapeutics 5-FU.Present report for hsa-mir-23a, for example: in cancer of biliary duct, the expression of mir-23a is significantly raised, (FANYIN MENG, ROGER HENSON, MOLLY LANG, HANIAWEHBE, SHAIL MAHESHWARI, JOSHUA T.MENDELL, JINMAI JIANG, THOMAS D.SCHMITTGEN, and TUSHAR PATEL GASTROENTEROLOGY2006; 130:2113-2129); After colon cancer is handled through the 5-FU chemotherapy, the expression of miR-23a obviously raises, (Lorena Rossi, Enzo Bonmassar, Isabella Faraoni, Modification of miRgene expression pattern in human colon cancer cells following exposure to5-fluorouracil in vitro Pharmacological Research 56 (2007) 248-253); MiR-23a strengthens gliomatous formation by the adjusting of expressing for LMNB1 and myelin forms, thereby promote propagation (the Shu-Ting Lin of neuroglial cytoma, Ying-Hui Fu, miR-23regulation oflamin B1 is crucial foroligodendrocyte development and myelination DiseaseModels ﹠amp; Mechanisms 2,178-188 (2009) doi:10.1242/dmm.001065).

So far do not see that a kind of research and should being used for of expression plasmid adjuvant of the expression miRNA-23a inhibitor that is used to strengthen the chemotherapy of tumors effect strengthens the report of the chemotherapy effect of tumor.

Summary of the invention

The object of the present invention is to provide a kind of expression plasmid adjuvant of strengthening the tumor chemotherapeutic drug chemotherapy effect and preparation method thereof that is used to.

The present invention's imagination, miR-23a can combine with its target gene APAF1, thereby reduces the APAF1 expression of gene, reduces the apoptosis of the mitochondrion approach that causes because of chemotherapy.Thereby strengthen the toleration of tumor to chemotherapeutics.On the contrary, cross the inhibitor of expressing miR-23a, expression decline can the causing apoptosis cell of miR-23a in the body is increased, thereby strengthen the sensitivity of chemotherapeutics 5-FU.Therefore the present invention's inhibitor expression plasmid of intending in vivo or directly changing in the tumor miR-23a can strengthen the chemosensitivity of tumor.

The invention provides a kind of expression plasmid adjuvant that is used to strengthen the tumor chemotherapeutic drug chemotherapy effect, it is a basic framework with slow virus carrier plasmid PLKO.1, contains the positive-sense strand of neck ring structure: 5 ' CCGGTATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGATTTT TTG 3 ' and antisense strand: the plasmid of 5 ' AATTCAAAAAATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTG AT A, 3 ' sequence.

But the complementary expression plasmid of the ripe body sequence (AUCACAUUGCCAGGGAUUUCC) of above-mentioned plasmid stably express and miR-23a.The expressed sequence of this expression plasmid is cloned in other the expression vector and expresses the expression plasmid adjuvant that also can make up other.

Above-mentioned tumor chemotherapeutic drug is 5-fluorouracil (5-FU) or can causes the chemotherapeutics that miR-23a expresses to be increased in chemotherapy of tumors.

When expression plasmid adjuvant of the present invention and 5-FU use in conjunction, can improve the sensitivity of tumor at 5-FU, improve the chemotherapy effect of tumor.This vaccine can oneself cause that apoptosis increases simultaneously, so also can should be used for strengthening chemotherapy effect with other chemotherapy drugs in combination.This vaccine can be used as the expression plasmid adjuvant that strengthens chemotherapy effect and uses.

The invention provides a kind of expression plasmid adjuvant that is used to strengthen the tumor chemotherapeutic drug chemotherapy effect; be plasmid to be injected in the tumor body by this plasmid of direct injection in the tumor or by local implantation slow release pump; allow the constantly amplification and express the inhibitor of miR-23a in the tumor body of this adjuvant; thereby inhibitor is combined with the miR-23a of inside tumor; suppress the pressure of tumor endogenous cause of ill chemotherapeutics and cause expressing excessively of miR-23a; thereby be to strengthen when chemotherapy drugs in combination is used the sensitivity of tumour medicine, strengthen chemotherapy effect.The application mode of plasmid adjuvant of the present invention comprises: intratumor injection, intramuscular injection, subcutaneous injection, intravenous injection, lumbar injection, mucosa absorption, application modes such as gastrointestinal absorption.Can use with chemotherapy drugs in combination also can be at the tumor by local intratumor injection.

The present invention also provides a kind of preparation method that is used to strengthen the plasmid adjuvant of tumor chemotherapeutic drug chemotherapy effect, and concrete steps are as follows:

Expression miR-23a inhibitor sequence with neck ring structure:

Positive-sense strand: 5 ' CCGGTATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGATTTT TTG 3 ' (SEQ ID NO:1)

Antisense strand: 5 ' AATTCAAAAAATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTG AT A 3 ' (SEQ ID NO:2)

Add the sticky end that can combine restriction enzyme site with the carrier terminal matching at the two ends of sequence, the sequence that will have the neck ring structure is resuspended in nucleotide sequence in the distilled water behind synthetic, and concentration is 1ug/ul.With the synthetic duplex of this tube nucleus nucleotide sequence annealing.

The annealing system is:

-5ul?of?Sense?oligo

-5ul?of?Antisense?oligo

-5ul?of?10x?NEB?buffer?2

-35ul?ddH2O

Altogether the 50ul system was hatched 4 minutes in 95 ℃ of water-baths, hatched 10 minutes in 70 ℃ in the beaker that fills 1500ml water, reduced to room temperature then naturally, the formation duplex structure.Slow virus carrier plasmid PLKO.1 behind restriction enzyme site AgeI and EcoRI enzyme action, is gone into the double chain oligonucleotide sequence clone in the PLKO.1 carrier behind the enzyme action.Be transformed in the escherichia coli competence, aim sequence in a large number increases.After identifying correctly, order-checking carries out next step applying detection.

The present invention shows through the zoopery result: 1. after passing through transfection expression in the in-vitro transfection CCL188, further identify that by realtime PCR the expression of miR-23a changes situation, determine that further the miRNA-23a inhibitor sequence of this plasmid expression is at external stably express (as shown in Figure 3).2. in the immunodeficiency Mus, inoculate transplanted tumor,, and be seeded in the influence of further observing in the immunodeficiency Mus the change of chemotherapy effect by this adjuvant of direct intratumor injection or by the steady colon cancer cell line that changes PLKO-anti-miR23a of foundation.Prove this vaccine adjuvant stably express in vivo once more, and the chemotherapy of tumor has been played potentiation.Therefore proved that PLKO-anti-miR23a can be used as vaccine adjuvant and bring into play obvious antineoplastic in chemotherapy of tumors.3. provided by the invention the amplification in a large number by escherichia coli expressed the plasmid of miR23a inhibitor, is the method for sophisticated plasmid amplification in vitro, and sophisticated amplification in vitro technology and isolation and purification method are arranged at present.4. with the plasmid of escherichia coli amplification in vitro miR23a inhibitor, produce simply, with low cost, give the interior injection operation of patient body convenient, can inject plasmid repeatedly behind the implantation slow release pump, little to patient trauma.5. compare with other tumor chemotherapeutic drugs, directly the intratumor injection side effect is little.

Description of drawings

Fig. 1: be PLKO-anti-miR23a expression plasmid reorganization strategic map;

Fig. 2: be recombiant plasmid sequencing result figure.

Fig. 3: the in-vitro transfection recombiant plasmid is after realtime PCR identifies that miR-23a expresses the cartogram that changes.

The specific embodiment:

Below in conjunction with drawings and Examples the present invention is further described, but enforcement of the present invention is not limited only to this.

Embodiment 1: the structure of recombiant plasmid PKLO-anti-miR23a

Design has the expression miR-23a inhibitor sequence of neck ring structure:

Positive-sense strand: 5 ' CCGGTATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGATTTT TTG 3 '

Antisense strand: 5 ' AATTCAAAAAATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTG AT A 3 '

The annealing system is:

-5ul?of?Sense?oligo

-5ul?of?Antisense?oligo

-5ul?of?10x?NEB?buffer?2

-35ul?ddH2O

Altogether the 50ul system was hatched 4 minutes in 95 ℃ of water-baths, hatched 10 minutes in 70 ℃ in the beaker that fills 1500ml water, reduced to room temperature then naturally, the formation duplex structure.Slow virus carrier plasmid PLKO.1 (Openbiosystems USA) behind restriction enzyme site AgeI and EcoRI enzyme action, is gone into the double chain oligonucleotide sequence clone in the PLKO.1 carrier behind the enzyme action (as shown in Figure 1).Be transformed in the escherichia coli competence, choose the monoclonal aim sequence that further increases.Carry out next step applying detection (as shown in Figure 2) after entrusting the order-checking of Invitrogen company to identify correctly.

Embodiment 2: a large amount of preparations of recombiant plasmid PKLO-anti-miR23a (adopting the plasmid of green skies biotech company to take out test kit greatly)

1. get in bacterium to the 50 milliliter centrifuge tube that spends the night, 5000g collected bacterial precipitation in centrifugal 1 minute, abandoned supernatant.Repeat once, every pipe is collected 100 milliliters of bacterium precipitations of spending the night altogether again.

2. every pipe adds 5 ml soln I, resuspended bacterial precipitation.Guarantee to precipitate and scatter fully, do not have visible bacterial aggregate.Confirm to have added RNase A in the solution I.Maximum speed vortex 10-20 second or longer time, hanged precipitation.Fully mixing should be uniform suspension facing to the observation of light place, does not have obvious bacterial aggregate or wadding piece.If there is not the vortex instrument, can precipitation be scattered gradually with rifle piping and druming precipitation.

3. every pipe adds 5 ml soln II, puts upside down centrifuge tube 4-6 time gently, and room temperature was placed 3-5 minute, made the complete cracking of antibacterial, and solution is transparent.

4. every pipe adds 5 ml soln III, puts upside down 4-6 mixing of centrifuge tube immediately, and visible white floccule produces.

5. the most at a high speed (＞5,000rpm) the centrifugal 10-20 of room temperature minute.If speed is higher for example 10, about 000rpm, general centrifugal 10 minutes enough.Can be ready to plasmid purification column when centrifugal, self-control funnel etc., and on purification column, put on mark.

6. the rapid supernatant after centrifugal of previous step is poured into or is drawn in the plasmid purification column.High speed centrifugation 2 minutes is abandoned the collection liquid in pipe.After plasmid is poured plasmid purification column into, can wait for, directly centrifugal.After abandoning the liquid in the collecting pipe, keep collecting pipe and continue to use.

7. in plasmid purification column, add 7 ml soln IV, high speed centrifugation 2 minutes, flush away impurity is abandoned the collection liquid in pipe.Can wait for after adding solution IV, directly centrifugal.After abandoning the liquid in the collecting pipe, keep collecting pipe and continue to use.

8. the most centrifugal 2 minutes, remove residual liquid and trace ethanol is volatilized fully.Attention: abandon and collect behind the liquid in pipe centrifugally again, could thoroughly remove the solution IV of trace.The solution IV of trace can influence the quality of plasmid.

9. plasmid purification column is placed on 50 milliliters of centrifuge tubes, add 2 ml soln V, placed 2 minutes to managing on the inner cylinder.Also can be with redistilled water or MiliQ level pure water replace solution V, but the pH of water should be not less than 6.5.It is long slightly standing time that solution V adds the back, can be slightly helpful for increasing yield plasmid.10. high speed centrifugation 2 minutes adds 10 ml soln VI in the gained liquid, be added to behind the mixing in the former plasmid purification column.Must mixing behind the adding solution VI! Can put upside down mixing, be sure not centrifugal behind the mixing.

11. high speed centrifugation 2 minutes is abandoned the collection liquid in pipe.

12. in plasmid purification column, add 15 ml soln IV, high speed centrifugation 2 minutes, further flush away impurity is abandoned the collection liquid in pipe.Can wait for after adding solution IV, directly centrifugal.After abandoning the liquid in the collecting pipe, keep collecting pipe and continue to use.

13. the most centrifugal 2 minutes, remove residual liquid and trace ethanol volatilized fully.Attention: abandon and collect behind the liquid in pipe centrifugally again, could thoroughly remove the solution IV of trace.The solution IV of trace can influence the quality of plasmid.

14. plasmid purification column is placed on 50 milliliters of centrifuge tubes, add 2 ml soln V to managing on the inner cylinder, placed 2 minutes.

15. high speed centrifugation 2 minutes, gained liquid is ultrapure plasmid.

16.DNA quantitative analysis is with the TE buffer dilution DNA solution of an amount of volume.With ultraviolet spectrophotometer measuring device OD ₂₆₀And OD ₂₈₀, the content of calculating DNA.OD ₂₆₀/ OD ₂₈₀The content 300ng/ul of=1.82DNA.

Embodiment 3:PLKO-anti-miR23a strengthens the chemotherapy effect of chemotherapeutic 5-FU to colon cancer transplanted tumor

One, the foundation of human colon cancer cell strain HCT116 transplanted tumor model:

To collect 1 * 10 ⁷Individual HCT116 cell (available from Chinese Academy of Sciences's cell bank) is resuspended with serum-free medium, and it is subcutaneous to be inoculated in back, 6-8 week immunodeficiency Mus right side, inoculates that tumor grows after 10 days, treats that the mice system is 100mm ³The time, mice is divided into three groups at random.A: tail vein injection 60 a μ l/ PBS; B: tail vein injection 60 μ l/ 5-FU+ intratumor injection PLKO.1 empty plasmids; C: tail vein injection 60 μ l/ 5-FU+ intratumor injection PLKO-anti-miR23a expression plasmids.

Measure the tumor length and width weekly, application of formula V=0.4 * LW ²Calculate gross tumor volume, tail vein injection plasmid and chemotherapeutics 5-FU are once in a week.

The result shows that intratumor injection PLKO-anti-miR23a expression plasmid+5-FU tail vein injection group obviously suppresses tumor growth, and its effect that suppresses tumor growth is obviously strong than using 5-FU tail vein injection group separately.

Two, the foundation of human colon cancer cell strain HT29 transplanted tumor model

To collect 1 * 10 ⁷Individual HT29 cell (available from Chinese Academy of Sciences's cell bank) is resuspended with serum-free medium, and it is subcutaneous to be inoculated in back, 6-8 week immunodeficiency Mus right side, inoculates that tumor grows after 10 days, treats that the mice system is 100mm ³The time, mice is divided into three groups at random.A: tail vein injection 60 a μ l/ PBS; B: tail vein injection 60 μ l/ 5-FU+ intratumor injection PLKO.1 empty plasmids; C: tail vein injection 60 μ l/ 5-FU+ intratumor injection PLKO-anti-miR23a expression plasmids.

The result shows that intratumor injection PLKO-anti-miR23a expression plasmid+5-FU tail vein injection group obviously suppresses tumor growth, and its effect that suppresses tumor growth is obviously carefully strong than using the 5-FU tail vein injection separately.

Claims

1. plasmid adjuvant that is used to strengthen the tumor chemotherapeutic drug chemotherapy effect, it is a basic framework with slow virus carrier plasmid PLKO.1, contains the plasmid of the positive-sense strand sequence shown in SEQ ID NO:1 and the antisense strand sequence shown in SEQ ID NO:2 of neck ring structure.

2. the plasmid adjuvant that is used to strengthen the tumor chemotherapeutic drug chemotherapy effect according to claim 1, wherein said tumor chemotherapeutic drug are 5-fluorouracil or can cause the chemotherapeutics that miR-23a expresses to be increased in chemotherapy of tumors.

3. preparation method that is used to strengthen the plasmid adjuvant of tumor chemotherapeutic drug chemotherapy effect as claimed in claim 1 or 2, concrete steps are as follows:

Expression miR-23a inhibitor sequence with neck ring structure:

The annealing system is:

-5ul?of?Sense?oligo

-5ul?of?Antisense?oligo

-5ul?of?10x?NEB?buffer?2

-35ul?ddH2O

Altogether the 50ul system was hatched 4 minutes in 95 ℃ of water-baths, hatched 10 minutes in 70 ℃ in the beaker that fills 1500ml water, reduced to room temperature then naturally, the formation duplex structure.Slow virus carrier plasmid PLKO.1 behind restriction enzyme site AgeI and EcoRI enzyme action, is gone into the double chain oligonucleotide sequence clone in the PLKO.1 carrier behind the enzyme action.