KR20220088294A - A pharmaceutical composition for enhancing the therapeutic effect of melanoma comprising an oligodendrocyte transcription factor 2 inhibitor as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for promoting melanoma metastasis and therapeutic effect, and more specifically, when a composition containing a transcription factor Olig2 (Oligendrocyte transcription factor 2) inhibitor is administered in combination with dabrafenib, dabra It was confirmed that the preventive or therapeutic effect of fenib was significantly improved, and when using the pharmaceutical composition of the present invention, even when using dabrafenib at a lower dose than before, melanoma can be effectively treated, so toxicity and You can be free from the problem of side effects.

Description

A pharmaceutical composition for enhancing the therapeutic effect of melanoma comprising an oligodendrocyte transcription factor 2 inhibitor as an active ingredient

The present invention relates to a pharmaceutical composition for enhancing the therapeutic effect of melanoma, and more particularly, a composition for enhancing the melanoma therapeutic effect of dabrafenib comprising an inhibitor of expression or activity of the transcription factor Olig2 (Oligodendrocyte transcription factor 2) is about

Due to the increase in the inflow of ultraviolet rays due to the destruction of the ozone layer due to recent living patterns such as the increase in outdoor activities and environmental pollution, exposure to various harmful substances and ultraviolet rays is becoming more frequent. As the number of skin cancer-related patients increases, the number of patients worldwide continues to increase. Skin cancer is a malignant tumor of the skin, and representative types include basal cell carcinoma, squamous cell carcinoma, and melanoma. Among them, melanoma can occur in any area where melanocytes exist, such as the skin, eyeballs, and cerebrospinal fluid membranes. known as a tumor.

The main site of metastasis of melanoma is the skin other than the primary lesion, but any other organs such as lymph nodes, bones, lungs, liver, and spleen can also be involved. In particular, melanoma has high resistance to conventional chemotherapeutic agents and radiation, and therefore is an intractable disease for which there is no special treatment method to date when abnormally advanced or recurrent.

Transcription factor Olig2 is a transcription factor expressed in the central nervous system during embryonic development and is known to play a role in regulating the differentiation and cell cycle progression of oligodendrocytes (oligodendrocytes) and promoting the growth of brain tumors. Transcription factor Olig2 was confirmed to be overexpressed in cells other than oligodendroglioma (oligodendroglioma), such as lung cancer, breast cancer, and melanoma (PCT application number: 10-2017-7027034). The effect on the efficacy of therapeutic agents has not yet been specifically studied.

Under the above background, the present inventors have made research efforts to discover substances for treating melanoma. As a result, dabrafenib ( When treated in combination with dabrafenib), it was confirmed that the growth of melanoma cells was more effectively inhibited than when dabrafenib alone was treated. The present invention was completed by confirming the fact that the recurrence of melanoma patients administered with brafenib can also be suppressed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating melanoma, comprising an inhibitor of BRAF inhibitor and Olig2 (Oligodendrocyte transcription factor 2) gene or protein expression or activity.

In addition, the present invention provides a pharmaceutical composition for enhancing the effect of preventing or treating melanoma used in combination with a BRAF inhibitor, wherein the composition comprises an inhibitor of the expression or activity of transcription factor Olig2 (Oligendrocyte transcription factor 2) as an active ingredient. Another object is to provide a pharmaceutical composition.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention includes a BRAF inhibitor and Olig2 (Oligodendrocyte transcription factor 2) expression or activity inhibitor of gene or protein, preventing or treating melanoma; Or it provides a pharmaceutical composition for preventing or treating metastasis of melanoma.

In one embodiment of the present invention, the BRAF inhibitor may be dabrafenib.

In addition, the present invention provides a method for preventing or treating melanoma in combination with a BRAF inhibitor; Or as a pharmaceutical composition for preventing or enhancing the effect of metastasis of melanoma, the composition provides a pharmaceutical composition comprising an inhibitor of expression or activity of transcription factor Olig2 (Oligendrocyte transcription factor 2) as an active ingredient .

In one embodiment of the present invention, the BRAF inhibitor may be dabrafenib.

In another embodiment of the present invention, the transcription factor Olig2 (Oligodendrocyte transcription factor 2) inhibitor is an antisense oligonucleotide specific for the transcription factor Olig2 (Oligodendrocyte transcription factor 2), small interfering RNA (siRNA), short hairpin It may be any one selected from the group consisting of RNA (short hairpin RNA; shRNA) and ribozyme.

In another embodiment of the present invention, the transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein activity inhibitor is a compound that specifically binds to the transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein, peptide, peptide mimetics, It may be any one selected from the group consisting of aptamers, antibodies, and natural products.

In another embodiment of the present invention, the combination may be administered simultaneously (simultaneous), separately (separate) or sequentially (sequential).

According to the present invention, when the Olig2 expression inhibitor is administered in combination with dabrafenib, it is confirmed that the melanoma treatment effect of dabrafenib is enhanced. is expected to be useful.

However, the effect of the present invention is not limited to the above effect, and it should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 is a result of confirming the expression level of Olig2 protein in proportion to the concentration of Olig2 gRNA of the CRISPR-Cas9 technique used to suppress Olig2 expression in 501mel cells, which are malignant melanoma cells.
Figure 2 is a result of confirming the survival rate of melanoma cells in which Olig2 expression is suppressed, Figure 2a is A375 cells, Figure 2b is confirming the survival rate of 501mel cells, Figure 2c is A375, Figure 2d is by counting 501mel cells, It is the result of confirming the survival rate.
Figure 3a is the result of confirming the metastatic ability of melanoma cells in which Olig2 expression is suppressed, Figure 3a is the metastatic capacity of A375 cells, Figure 3b is confirming the metastatic capacity of 501mel cells, Figure 3c is the invasive capacity of A375 cells, Figure 3d is the result of confirming the invasive ability of 501mel cells.
4 is a result of confirming cell viability while treating 501mel cells with CRISPR-Cas9 gRNA and dabrafenib for suppression of Olig2 expression, respectively or in combination.

As a result of the present inventors' research efforts to discover a substance for treating melanoma, the present inventors used an inhibitor of expression or activity of the transcription factor Olig2 (Oligodendrocyte transcription factor 2) and a targeted therapeutic agent, dabrafenib. In this case, it was confirmed that the survival rate of malignant melanoma cells was significantly inhibited compared to the case of treatment with dabrafenib alone, thereby enhancing the melanoma treatment efficiency of dabrafenib, thereby completing the present invention.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating melanoma, comprising an inhibitor of BRAF and Olig2 (Oligodendrocyte transcription factor 2) gene or protein expression or activity.

In the present invention, the term "BRAF inhibitor" may be dabrafenib, a targeted therapeutic agent used for the treatment of late-stage melanoma, and in the present invention, dabrafenib is known to regulate cell growth. By suppressing the expression of BRAF, a gene encoding the B-Raf protein, it is being used to treat melanoma and metastatic non-small cell lung cancer.

In another aspect of the present invention, the present invention provides a pharmaceutical composition for enhancing the effect of preventing or treating melanoma used in combination with a BRAF inhibitor, the composition comprising an inhibitor of expression or activity of transcription factor Olig2 (Oligendrocyte transcription factor 2) as an active ingredient It provides a pharmaceutical composition, characterized in that.

In the present invention, the term "protein" may be used synonymously with "polypeptide" or "polypeptide", and refers to a polymer of amino acid residues. Proteins apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymers.

The transcription factor Olig2 (Oligodendrocyte transcription factor 2, hereinafter Olig2) gene or protein expression or activity inhibitor refers to a substance that inhibits or interferes with the function of Olig2. Such inhibition or interference may be achieved by interfering with the transcription of the Olig2 gene or by inhibiting the translation of the mRNA of the Olig2 gene. Alternatively, the activity of the Olig2 protein may be reduced or inactivated by specifically binding to the active site of the Olig2 protein or by causing a protein structural modification.

In the present invention, the term "transcription factor Olig2 (Oligodendrocyte transcription factor 2) gene or expression inhibitor" is not limited thereto, but transcription factor Olig2 (Oligendrocyte transcription factor 2 mRNA specific antisense oligonucleotide, small interfering RNA) (small interfering RNA; siRNA), short hairpin RNA (shRNA), and ribozyme may be any one selected from the group consisting of.

The inhibitor of the activity may refer to a substance that makes the same type of activity lower than the intrinsic activity that the non-genetically engineered parent cell (eg, wild-type) does not have or has. Although the term "inhibitor of transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein activity" of the present invention is not limited thereto, a compound, peptide, or peptide mimetic that specifically binds to transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein It may be any one selected from the group consisting of s, aptamers, antibodies, and natural products.

Such nucleotides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (absent in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as “unit” or “monomer.”

The meaning of "complementarily binding" is related to Watson-Crick base pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T)/uracil (U). Oligonucleotides may include nucleosides with modified nucleobases. For example, 5-methyl cytosine is often used instead of cytosine. The term "complementarily binding" may include Watson-Crick base-binding between unmodified nucleobases and modified nucleobases (see, e.g., Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

The antisense nucleotide is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, in particular, to an adjacent sequence on the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and therefore not siRNA or shRNA.

The small interfering RNA refers to RNA capable of inducing RNAi (RNA interference) that inhibits gene activity. The small interfering RNA may be a miRNA or siRNA capable of inhibiting the expression of the Olig2 gene, and the small interfering RNA may have any form as long as it inhibits the expression or activity of the Olig2 gene. For example, siRNA obtained by chemical synthesis or biochemical synthesis or in vivo synthesis, or a duplex of about 40 bases or more

A double-stranded RNA of 10 bases or more, in which the strand RNA is degraded in the body, may be used.

The "aptamer" refers to a nucleic acid molecule having binding activity to a predetermined target molecule. The aptamer may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be in a linear or cyclic form. In general, the shorter the nucleotide sequence constituting the aptamer, the shorter the chemical synthesis and mass production. It is known that it is easier, has excellent cost advantages, is easy to chemically modify, has excellent in vivo stability, and has low toxicity.

The "antibody" refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody is a marker gene by cloning each gene into an expression vector according to a conventional method. The protein encoded by The form of the antibody is not particularly limited, and any part thereof is included in the antibody of the present invention as long as it has polyclonal antibody, monoclonal antibody or antigen-binding property, and all immunoglobulin antibodies may be included as well as humanized antibody, etc. It may also contain special antibodies of In addition, the antibody includes functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab')2 and Fv.

In the present invention, the term "combination" refers to co-administration, but is not limited thereto, but the Olig2 inhibitor of the present invention and dabrafenib are administered in combination simultaneously (simultaneous), separately (separate) or sequentially (sequential). it could be

The present inventors confirmed that the preventive or therapeutic effect of melanoma was improved when the oilg2 gene or protein expression or activity inhibitor and dabrafenib were administered in combination through specific examples.

In one embodiment of the present invention, when the expression of Olig2 in melanoma cells was suppressed, it was confirmed that the cell viability was significantly reduced (see Example 3-1), and metastatic ability and invasive ability were also greatly reduced. was confirmed through a specific experiment (see Example 3-2).

In another embodiment of the present invention, it was confirmed that melanoma growth can be inhibited by enhancing the effect of dabrafenib when treating melanoma cells in which the expression of Olig2 is suppressed, dabrafenib, a melanoma therapeutic agent. (see Example 4).

Through the above results, the inventors of the present invention specifically confirmed that when an inhibitor capable of inhibiting the expression or activity of Olig2 of the present invention is treated, metastasis and growth of melanoma can be significantly inhibited, When the inhibitor and dabrafenib were administered in combination, it was confirmed that even a small amount could enhance the melanoma inhibitory effect of dabrafenib. Through these results, it was confirmed that the Olig2 inhibitor can be widely used in the field of melanoma treatment.

The pharmaceutical composition may include one or more pharmaceutically acceptable carriers in addition to the active ingredients described above. The pharmaceutically acceptable carrier may be used in a mixture of saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and one or more of these components, and, if necessary, an antioxidant , buffers, bacteriostatic agents, and other conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.

The pharmaceutical composition may be administered in combination parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, intradermally or orally. The drug may be administered orally or directly to a target organ, and the dosage may vary depending on the patient's age, sex, health condition and weight, type of concurrent treatment, administration time, administration method, excretion rate, disease severity, and frequency of treatment. and the nature of the desired effect. In addition, it may be administered systemically or locally in consideration of conditions such as the disease to be treated, the need for site-specific treatment, and the amount of the drug to be administered.

The pharmaceutical composition may have any pharmaceutical formulation. For example, in a form suitable for oral administration as a tablet, capsule, pill, powder, sustained release formulation, solution, or suspension, in a form suitable for parenteral injection as a sterile solution, suspension or emulsion, or in a form suitable for topical administration as an ointment or cream. It may be in a suitable form or may be in a form suitable for rectal administration as a suppository. The composition may be a tablet, pill, injection, or a combination thereof. The pharmaceutical composition may be in unit dosage form suitable for single administration of precise dosages.

In providing the pharmaceutical composition or treating a disease using the pharmaceutical composition, the pharmaceutical composition may be used alone or in combination, or in combination with other therapeutic agents or diagnostic agents. In one embodiment, the pharmaceutical composition may be administered concurrently with other agents typically prescribed for the intended disease in accordance with generally accepted medical practice. In addition, the pharmaceutical composition can generally be used in a mammal, for example, a human in vivo (in vivo).

In addition, the present invention provides a method for preventing or treating melanoma comprising administering the pharmaceutical composition to a subject.

As used herein, the term “administration” means providing a given composition of the present invention to a subject by any suitable method.

As used herein, the term "subject" refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, dogs, cats, horses, and cattle. means mammals.

In addition, the present invention provides the use of the pharmaceutical composition for the prevention or treatment of melanoma.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental preparation and experimental method

1-1. cell culture

Human melanoma cells, A735, 501mel and HM3KO cells, were treated with Dulbecco's modified eagle supplemented with 10% Fetal Bovine Serum (Gibco, Los Angeles, CA, USA) and 1% penicillin/streptomycin. Culture in `s medium (DMEM; Welgene Inc., Korea). MNT1, a human melanoma cell, was prepared from minimal essential media (MEM; Welgene Inc.) supplemented with 20% FBS, 1% penicillin/streptomycin and 20 mM hydroxyethyl piperazineethanesulfonic acid (HEPES). Korea). Normal human melanocytes, NHEMs, were prepared from Human Melanocyte Growth Supplement (HMGS; Invitrogen Life Technologies, Carlsbad, CA, USA) and medium 254 containing 1% penicillin/streptomycin (Mediu 254, M-254). -500; Invitrogen Life Technologies, Carlsbad, CA, USA) in a humidified atmosphere at 37 °C and 5% CO ₂ .

1-2. Check cell viability

의 인큐베이터에서 추가로 1시간 동안 인큐베이션했다. 세포 생존력은 ELISA 판독기(Tecan, Mannedorf, Switzerland)에 의해 490nm 파장에서 확인하였고, 상대적 세포독성은 세포의 생존력을 백분율로 표현하여 측정한다.To check cell viability, cells were seeded at 1x10 ⁴ cells/well in a 96-well-plate, and then, each cell was transfected with CRISPR-Olig2, and 24 hours, 48 hours and 72 hours had elapsed. Next, cell viability was checked. In order to check the cell viability, the Ez-Cytox assay kit (Daeil Lab Service Co Ltd, Seoul, Korea) was used. Specifically, 10 μl of Ez-Cytox solution was added to each well-plate, and then the well-plate was added to 5% CO ₂ conditions and 37

was incubated for an additional 1 hour in an incubator of Cell viability was confirmed at 490 nm wavelength by an ELISA reader (Tecan, Mannedorf, Switzerland), and relative cytotoxicity was measured as a percentage of cell viability.

1-3. Cell count analysis

Cells were seeded in a 96-well plate at 1x10 ⁴ cells/well, and then transfected using CRISPR/Cas9 plasmid. After 72 hours, the cells were trypsin-treated. Mix 10 ul of trypan blue dye (Sigma Aldrich, St. Louis, MO, USA) equal to the cell suspension. After staining the cells with trypan blue dye, each sample was repeatedly counted three times using a hemocytometer.

1-4. Real time polymerase chain reaction analysis

For RT-PCR analysis, cells are seeded at 5x10 ⁵ cells/well in 6 well plates. To extract total RNA (Total RNA), the melanoma cells prepared in Example 1-1 were treated with TRIZOL reagent (Takara Bio, Inc., Tokyo, Japan), and then 1/5 of TRIZOL in chloroform (Chloroform, CHCl ₃ , 99%, Junsei Chemical, Japan) was treated and mixed. After mixing the Vortex mixer, centrifuge for 15 minutes at 13000 rpm at a temperature of 4 ℃. A certain amount of the transparent supernatant was taken and mixed with the same amount of isopropanol. After inverting the tube centrifuge at 4° C., 13000 rpm, 20 min. The supernatant was removed and the remaining pellet was diluted with diethyl pyrocarbonate treated water.

Synthesis of complementary DNA (cDNA) was performed by reverse transcription polymerase chain reaction (RT-PCR) using specific primers using a thermocycler SimpliAmp®, Thermo Fisher Scientific, MA, USA). The specific sequences of the primers are shown in Table 1 below. The synthesized cDNA was prepared in 1X Tris Acetate-EDTA (TAE) buffer (Elpis Biotech, Daejeon, Korea) and RedSafe?? Nucleic 2% agarose gel (Bioneer Co., Daejeon, Korea) was visualized using Acid Staining Solution (iNtRON Biotechnology, Seongnam, Korea).

Gene sequence of primers
(5' → 3') Tm
(℃) Amp
cycles Product
size Olig2
(human) F: GAATCCGCTGGTATCCACGA 55 33 335bp R: GCGGAGCGAGACGTTTAGAA β-actin
(human) F: GGCATCGTGATGGACTCCG 59 27 610bp R: GCTGGAAGGTGGACAGCGA

1-5. wound healing assay

Melanoma cells were seeded in 12-well plates at 1 x 10 ⁵ cells/well, then CRISPR/Cas9 plasmids were transfected into the cells, and when the cells occupied approximately 90% of the plate, a yellow micropipette Wound the monolayer by gently scraping it across the center of each well with a tip, and wash twice with phosphate-buffered saline (PBS). Healing of the wound was confirmed at the indicated time, and the image was taken with a microscope. All experiments were repeated three times. The difference in wound gap area was quantified compared to the control group through ImageJ software 1.45s (US National Institutes of Health, Bethesda, MD, USA). The area measurement was calculated by converting the area value at 0 hour by subtracting the area value at 24 hours and 48 hours into a percentage of the control group.

1-6. Transwell invasion and metastasis assay

For in vitro invasion assays, melanoma cells were seeded in 12 well plates and then cells were trypsinized 24 hours after transfection with CRISPR/Cas9 plasmids. Cells were re-seeded with polycarbonate membranes (Corning Incorporated, Corning, NY, USA) with 8.0 μm pore size in DMEM medium containing 1% FBS at 5 x 10 ₄ cells per chamber, followed by 18 h. incubated for a while. Specifically, the upper chamber was coated with Matrigel® (Corning, Kaiserslautern, Germany) diluted with serum-free DMEM medium, and the bottom of the upper chamber was coated with 1% gelatin. The bottom chamber was filled with DMEM medium containing 10% FBS. Cells that invaded through the Matrigel-coated membrane were fixed in 10% formalin and washed twice with PBS. In order to visualize the nucleus of the invaded cells, it was stained with 4',6-diamidino-2-phenylindole (DAPI). Invasive cells were detected by fluorescence microscopy at x100 magnification. Stained nuclei were counted and quantified using ImageJ software 1.45s (US National Institutes of Health, Bethesda, MD, USA).

Example 2. Preparation of Oligodendrocyte transcription factor 2 expression suppression cell model using CRISPR-Cas9 technology

To confirm the effect of the Olig2 inhibitor, CRISPR-Cas9 technique was used in 501mel cells, a malignant melanoma cell, to prepare cells in which the expression of the transfer factor Olig 2 (Oligodendrocyte transcription factor 2) was suppressed. Specifically, using UltraCruz transfection reagent (UltraCruz Transfection Reagent (Santacruz Biotechnology, Dallas, TX, USA)) for the cells prepared in Example 1-1, 20nt guide sgRNA and Cas9 nuclease encoding three The sc-400670-KO-2 consisting of different gRNA plasmids: Olig2 CRISPR/Cas9 KO plasmids (h2) (Santacruz Biotechnology, Dallas, TX, USA) were transfected. The three gRNAs of the plasmid may be gRNA1: 5'-GGCTGCGTCGTCCACCAAGA-3', gRNA2: 5'-CACCTCGTCGTCTACGTCGT-3' or gRNA3: 5'-CGCCCATAGCCGACACGTGG-3'.

As a result of confirming the Olig 2 expression level of the 501 mel cells prepared by the above method, as shown in FIG. 1 , it was confirmed that an Olig2 suppressed cell model in which the protein expression level of Olig2 was suppressed in proportion to the treatment concentration of Olig2 gRNA was prepared.

Example 3. Confirmation of changes in the expression of oligodendrocyte transcription factor 2 suppressed melanoma cells

3-1. Check the survival rate

In the malignant melanoma cells (A375 cells and 501mel cells) in which the expression of Olig2 prepared in Example 2 is suppressed, to check the cell viability according to the suppression of Olig2 protein expression, the administration concentration of CRISPR-Olig2 gRNA was The survival rate was specifically confirmed. As a result of confirming the cell viability on the 1st, 2nd, and 3rd days of the protein-suppressed malignant melanoma cell model, the cells as shown in Table 2 (501mel cell data), Figure 2a (A375 cells) and Figure 2b (501mel cells) It was confirmed that the survival rate decreased to a significant level. Even when the number of cells was confirmed through cytometry analysis, it was confirmed that the number of cells decreased to a significant level, as shown in FIGS. 2c (A375 cells) and 2d (501mel cells).

Con 1 μg of CRISPR-Olig2 CRISPR-Olig2 2μg % of Con Day1 100.00 87.45 86.63 Day2 100.00 86.14 73.90 Day3 100.00 76.66 71.02

3-2. metastatic confirmation

Examples 1-5 (wound healing assay) and Examples 1-6 (transwell assay) were used to determine whether changes in melanoma metastasis and invasive ability occurred in Olig2-inhibited cells (A375, 501mel). carried out.

As a result of performing a wound healing assay by comparison with the control group, in the case of A375 cells, as shown in FIG. 3a, when 24 hours elapsed, in the group treated with 1 μg of gRNA for Olig2 inhibition, a decrease of 9 ± 10.0% , decreased by 16 ± 7.5% in the group treated with 2 μg of gRNA, and after 48 hours, a decrease of 51 ± 3.8% in the group treated with 1 μg of gRNA and a decrease of 62 ± 16.5% in the group treated with 2 μg of gRNA could confirm that In the case of 501mel cells, as shown in Figure 3b,

At 24 hours, it was reduced by 8 ± 9.5% in the group treated with 1 µg of gRNA for Olig2 inhibition and 18 ± 17.0% in the group treated with 2 µg of gRNA, and after 48 hours, 1 µg of gRNA 28 ± 18.6% reduction in the group treated with gRNA 2㎍ was confirmed to be reduced by 55 ± 10.3%% in the group treated with gRNA.

The number of cells that migrated through the pores of the chamber through transwell metastasis analysis was confirmed by comparison with the control group. As a result, as shown in Fig. 3c, when 18 hours elapsed, it was confirmed that a decrease of 63 ± 5.2% in the group treated with 1 µg of gRNA for Olig2 inhibition and 58 ± 5.0% decreased in the group treated with 2 µg of gRNA. . To confirm the invasion ability of melanoma cells, instead of the extracellular matrix of the transwell membrane chamber, matrigel was diluted with 0% FBS DMEM medium, and then coated on the upper chamber. It was confirmed by staining with the control group. As a result, as shown in Fig. 3d, the relative cell invasion was reduced by 48 ± 8.2% in the group treated with 1 µg of gRNA for Olig2 inhibition, and reduced by 54 ± 8.6% in the group treated with 2 µg of gRNA. there was.

The present inventors confirmed that when Olig2 is inhibited through the above results, metastasis of melanoma can be inhibited to a significant level.

Example 4. Confirmation of survival rate of malignant melanoma cells when oligodendrocyte transcription factor 2 expression is suppressed by Dabrafenib treatment

In order to specifically confirm the effect of co-administration of the Olig2 composition of the present invention, Dabrafenib, a melanoma treatment previously approved by the US FDA as a B-Raf inhibitor, was used in normal cells or 501mel in which Olig2 expression is suppressed. After 3 days of treatment with the cells, the cell viability was checked. As a result, as shown in FIG. 4 and Table 3 below, when dabrafenib was administered to malignant melanoma cells in which Olig2 expression was suppressed, and when dabrafenib was treated to Olig2-expressing melanoma cells It was confirmed that the growth inhibitory effect of melanoma cells was superior.

Con CRISPR-Olig2 Dabrafenib CRISPR-Olig2
+ Dabrafenib % of Con 100.00 72.29 60.89 49.34

Through the above results, when the Olig2 inhibitor of the present invention is administered in combination with dabrafenib, which has been used as a treatment for melanoma, it is possible to more effectively inhibit the growth of melanoma than when dabrafenib is administered alone. I could confirm that there was.

The description of the present invention stated above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

Claims (9)

A pharmaceutical composition for the prevention or treatment of melanoma, comprising an inhibitor of BRAF inhibitor and Olig2 (Oligendrocyte transcription factor 2) gene or protein expression or activity inhibitor.
According to claim 1,
The BRAF inhibitor is dabrafenib (dabrafenib), characterized in that the pharmaceutical composition.
A pharmaceutical composition for preventing or treating metastasis of melanoma, comprising an inhibitor of BRAF inhibitor and Olig2 (Oligendrocyte transcription factor 2) gene or protein expression or activity.
A pharmaceutical composition for enhancing the effect of preventing or treating melanoma used in combination with a BRAF inhibitor, wherein the composition comprises an inhibitor of expression or activity of transcription factor Olig2 (Oligendrocyte transcription factor 2) as an active ingredient, A pharmaceutical composition.
5. The method of claim 4,
The BRAF inhibitor is dabrafenib (dabrafenib), characterized in that the pharmaceutical composition.
5. The method of claim 4,
The transcription factor Olig2 (Oligodendrocyte transcription factor 2) expression inhibitors include an antisense oligonucleotide specific for the transcription factor Olig2 (Oligodendrocyte transcription factor 2) mRNA, small interfering RNA (siRNA), short hairpin RNA; shRNA) and ribozyme (ribozyme), characterized in that any one selected from the group consisting of, a pharmaceutical composition.
5. The method of claim 4,
The transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein activity inhibitor is from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies and natural products that specifically bind to transcription factor Olig2 (Oligodendrocyte transcription factor 2) protein. Any one selected, the pharmaceutical composition. 5. The method of claim 4,
The composition is characterized in that the combination is administered simultaneously (simultaneous), separately (separate) or sequentially (sequential).
A pharmaceutical composition for preventing metastasis or enhancing the therapeutic effect of melanoma used in combination with a BRAF inhibitor, wherein the composition comprises an inhibitor of expression or activity of transcription factor Olig2 (Oligendrocyte transcription factor 2) as an active ingredient, a pharmaceutical composition.

Images