CN108236722B

CN108236722B - Application of IDNK inhibitor in preparation of liver cancer treatment drug

Info

Publication number: CN108236722B
Application number: CN201810039649.2A
Authority: CN
Inventors: 金成�; 顾元龙; 何友钊; 刘敏丰; 袁凤来
Original assignee: Wuxi No 3 Peoples Hospital
Current assignee: Wuxi No 3 Peoples Hospital
Priority date: 2018-01-16
Filing date: 2018-01-16
Publication date: 2020-09-18
Anticipated expiration: 2038-01-16
Also published as: CN108236722A

Abstract

The invention belongs to the field of biological medicine research, and particularly relates to application of an IDNK inhibitor in preparation of a liver cancer treatment drug. Through extensive and intensive research, the first research shows that the inhibition of the expression of the IDNK can obviously influence the proliferation of the liver cancer cell BEL-7404, influence the distribution of the cell cycle and promote the apoptosis of the cell. The gene is shown to be a key functional gene for promoting the generation and development of liver cancer and to be a potential therapeutic target of liver cancer.

Description

Application of IDNK inhibitor in preparation of liver cancer treatment drug

Technical Field

The invention belongs to the field of biological medicine research, and particularly relates to application of an IDNK inhibitor in preparation of a liver cancer treatment drug.

Background

Currently, surgical resection is the main treatment means for liver cancer, however, the postoperative recurrence rate of liver cancer patients is high, the prognosis is poor, about 80% of liver cancer patients die from recurrence and metastasis according to statistics, and most of liver cancer patients have distant organ metastasis when the diagnosis is confirmed. At present, effective means for early diagnosis and treatment of liver cancer patients are lacked, and the fundamental reason is that the mechanism of liver cancer recurrence and metastasis is not clear.

The study of tumor metastasis mechanisms has been the leading field in oncology research. Numerous studies have demonstrated that tumor metastasis is not random, but selective, organ tropism. The famous "seed and soil" hypothesis proposed by Paget et al: "seed" dispersal itself is random, but the microenvironment of a particular tissue or organ is tailored to the survival and growth of certain "seeds", providing them with "soil" for survival and development, thereby rendering the "seed" metastasis tissue and organ specific. Currently researchers are concerned more with the tumor itself, and less with the soil and microenvironment of the tumor. In the process of liver cancer target transfer, specific 'soil' is currently considered to play an important role in the liver cancer transfer process. Therefore, the search for specific soil and new microenvironment for tumor is urgent.

The IDNK gene encodes a gluconokinase, a Mg-demanding one²⁺Typical phosphotransferase, a kinase involved in the degradation of d-gluconate (PMID:23067238), is highly expressed in the kidney, liver, small intestine, duodenum, etc. (PMID 24309898). And the gene is located in the gene deletion region of acute myelogenous leukemia del (9 q). It has now been found that the kinase encoded by the IDNK gene metabolizes gluconic acid in a manner similar to that found in prokaryotes, and it is speculated that this protein may exert a gluconic acid catabolic effect in humans. However, no studies have been made on the functional function of IDNK in cells.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide the application of the IDNK inhibitor in preparing a liver cancer treatment drug.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in a first aspect of the invention, the use of an IDNK inhibitor for the preparation of a medicament for the treatment of liver cancer is provided.

Further, the liver cancer treatment drug has at least one of the following functions:

inhibiting proliferation of liver cancer cells, reducing liver cancer cell activity, increasing ratio of liver cancer cells at G1 stage and liver cancer cells at G2/M stage, reducing ratio of liver cancer cells at S stage, causing liver cancer cells to generate G1 stage retardation and G2/M stage retardation, promoting apoptosis of liver cancer cells, and inhibiting growth of liver cancer tumor.

Further, the IDNK inhibitor refers to a molecule having an inhibitory effect on IDNK.

Having inhibitory effects on IDNK include, but are not limited to: inhibiting IDNK activity, or inhibiting IDNK gene transcription or expression.

The IDNK inhibitor can be siRNA, shRNA, antibody, small molecule compound.

As exemplified in the examples herein, the IDNK inhibitor can be an siRNA or shRNA.

The liver cancer treatment drug necessarily comprises an IDNK (identification number receptor) inhibitor, and the IDNK inhibitor is used as an effective component of the function.

In the liver cancer treatment drug, the effective component exerting the functions can be only an IDNK inhibitor, and can also comprise other molecules capable of playing similar functions.

That is, the IDNK inhibitor is the only active ingredient or one of the active ingredients of the liver cancer therapeutic drug.

The liver cancer treatment medicine can be a single-component substance or a multi-component substance.

The form of the liver cancer treatment drug is not particularly limited, and can be various substance forms such as solid, liquid, gel, semifluid, aerosol and the like.

The liver cancer treatment drug mainly aims at mammals such as rodents, primates and the like.

In a second aspect of the invention, a method of treating liver cancer is provided by administering an IDNK inhibitor to a subject.

The subject may be a mammal or a mammalian liver cancer cell. The mammal is preferably an animal of the order rodentia, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The liver cancer cell can be isolated liver cancer.

The subject may be a patient suffering from liver cancer or an individual in whom treatment is desired for liver cancer. Or the subject is a liver cancer patient or a liver cancer cell of an individual expected to treat liver cancer.

The IDNK inhibitor may be administered to a subject before, during, or after receiving treatment for liver cancer.

In a third aspect of the present invention, there is provided a therapeutic agent for liver cancer, comprising an effective amount of an IDNK inhibitor.

Furthermore, the liver cancer treatment drug comprises an effective dose of an IDNK inhibitor and a medicinal carrier.

In a fourth aspect of the invention, a liver cancer combination therapy is provided, which comprises an effective amount of an IDNK inhibitor and at least one other liver cancer therapy drug.

The combination therapy drug combination may be in any one of the following forms:

firstly), the IDNK inhibitor and other liver cancer treatment drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can be the same or different.

When the other liver cancer therapeutic agent is an antibody, a parenteral administration type is generally used. When other liver cancer treatment medicines are chemical medicines, the administration forms can be rich, and the administration can be carried out in the gastrointestinal tract or the parenteral tract. Known routes of administration for each chemical are generally recommended.

Secondly), the IDNK inhibitor and other liver cancer treatment medicines are prepared into a compound preparation, and when the IDNK inhibitor and other liver cancer treatment medicines are administrated by the same administration route and applied simultaneously, the IDNK inhibitor and other liver cancer treatment medicines can be prepared into the form of the compound preparation.

In a fifth aspect of the invention, a method for treating liver cancer is provided, wherein an effective amount of the IDNK inhibitor is administered to a subject, and an effective amount of another liver cancer treatment drug is administered to the subject and/or another liver cancer treatment means is administered to the subject.

An effective amount of the IDNK inhibitor and an effective amount of at least one other liver cancer therapeutic may be administered simultaneously or sequentially.

The invention discloses a liver cancer treatment target point discovered for the first time based on IDNK, which at least has the effect of adding curative effects in combined medication with other liver cancer treatment medicines except an IDNK inhibitor, and further enhances the treatment effect on liver cancer.

Other liver cancer treatment drugs include, but are not limited to: antibody drugs, chemical drugs or targeted drugs, etc.

The IDNK inhibitor may be administered parenterally or parenterally. The other liver cancer therapeutic agent may be administered gastrointestinal or parenteral. For antibody drugs, parenteral administration is generally employed.

In a sixth aspect of the invention, there is provided the use of an IDNK inhibitor for the manufacture of a medicament for any one or more of the following effects: inhibiting proliferation of liver cancer cells, reducing liver cancer cell activity, increasing ratio of liver cancer cells at G1 stage and liver cancer cells at G2/M stage, reducing ratio of liver cancer cells at S stage, causing liver cancer cells to generate G1 stage retardation and G2/M stage retardation, promoting apoptosis of liver cancer cells, and inhibiting growth of liver cancer tumor.

Compared with the prior art, the invention has the following beneficial effects:

through extensive and intensive research, the first research shows that the inhibition of the expression of the IDNK can obviously influence the proliferation of the liver cancer cell BEL-7404, influence the distribution of the cell cycle and promote the apoptosis of the cell. The gene is shown to be a key functional gene for promoting the generation and development of liver cancer and to be a potential therapeutic target of liver cancer.

Drawings

FIG. 1: the fluorescent picture of BEL-7404 cell infected by lentivirus, the upper picture is shCtrl infected lentivirus group, the lower picture is shIDNK infected interference lentivirus group, the left side is bright field picture, and the right side is fluorescent picture.

FIG. 2A: shIDNK knockdown efficiency test shows that shIDNK lentivirus obviously inhibits the expression amount of an IDNK gene in BEL-7404 cells at an mRNA level, and bar results are shown as an average value +/-SD, wherein p is less than 0.01.

FIG. 2B: shIDNK knockdown efficiency detection, Western Blot shows that interference targets have a knock-down effect on the exogenous expression of the IDNK at the protein level.

FIG. 3A: celigo cytometric method verifies the effect of IDNK gene on cell proliferation, and Celigo records cell pictures for 5 consecutive days.

FIG. 3B: celigo cell counting method verifies the influence of IDNK gene on cell proliferation, the BEL-7404 cell is infected by shRNA slow virus, and the cell number of shIDNK group and shCtrl control group is changed along with time.

FIG. 3C: celigo cell counting method verifies the effect of IDNK gene on cell proliferation, the BEL-7404 cell is infected by shRNA slow virus, and the change multiple of shIDNK group and shCtrl control group cell number is compared with time.

FIG. 4A: and (3) detecting the influence of the IDNK gene on the cell proliferation activity by an MTT method, infecting BEL-7404 cells with shRNA lentivirus, culturing for 5 days, and treating for 4 hours by the MTT, and comparing the absorption rate of the shIDNK group and the shCtrl control group on light with the wavelength of 490nm with the change of time in an enzyme labeling instrument. OD490 here reflects the number of viable cells.

FIG. 4B: and (3) detecting the influence of the IDNK gene on the cell proliferation activity by an MTT method, infecting BEL-7404 cells by shRNA lentivirus, culturing for 5 days, and treating for 4 hours by the MTT, and comparing the change multiple of the absorption rate of the shIDNK group and the shCtrl control group to light with the wavelength of 490nm with the change of time in an enzyme labeling instrument. OD490 here reflects the number of viable cells.

FIG. 5A: and (3) detecting the influence of shIDNK on the cell cycle of BEL-7404 cells by flow cytometry, and showing a cell cycle result schematic diagram.

FIG. 5B: flow cytometry was used to examine the effect of shIDNK on the cell cycle of BEL-7404 cells, and bar results are shown as the mean of the cell percentage ± SD, indicating that p < 0.01.

FIG. 6A: the Annexin V-APC flow apoptosis test shows that the shIDNK has influence on BEL-7404 apoptosis and is a schematic diagram of flow apoptosis.

FIG. 6B: annexin V-APC flow apoptosis assay shIDNK effect on BEL-7404 apoptosis, bar results are shown as percent cell mean ± SD, indicating p < 0.01.

Detailed Description

The inventor of the invention finds that designing an interference target sequence aiming at the IDNK gene, packaging and constructing lentivirus, and knocking down the IDNK gene can obviously influence the proliferation of the liver cancer cell BEL-7404, influence the distribution of the cell cycle and promote the apoptosis of the cell. The gene is shown to be a key functional gene for promoting the generation and development of liver cancer and to be a potential therapeutic target of liver cancer.

IDNK

Is a gluconokinase, is a Mg-demanding²⁺Typical phosphotransferase, a kinase involved in the degradation of d-gluconate (PMID:23067238), is highly expressed in the kidney, liver, small intestine, duodenum, etc. (PMID 24309898).

IDNK inhibitors

Refers to a molecule having inhibitory effect on IDNK. Having inhibitory effects on IDNK include, but are not limited to: inhibiting IDNK activity, or inhibiting IDNK gene transcription or expression. The IDNK inhibitors include, but are not limited to, siRNA, shRNA, antibodies, small molecule compounds.

Inhibiting IDNK activity refers to reducing the activity of IDNK. Preferably, the IDNK activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, more preferably by at least 70%, more preferably by at least 80%, and most preferably by at least 90% compared to prior to inhibition.

Inhibiting IDNK gene transcription or expression refers to: the method comprises the step of preventing transcription of the gene of IDNK, or reducing the transcription activity of the gene of IDNK, or preventing expression of the gene of IDNK, or reducing the expression activity of the gene of IDNK.

One skilled in the art can use conventional methods to regulate gene transcription or expression of IDNK, such as gene knock-out, homologous recombination, interfering RNA, and the like.

Inhibition of gene transcription or expression of IDNK can be verified by PCR and Western Blot detection of expression level.

Preferably, the IDNK gene transcription or expression is reduced by at least 10%, preferably by at least 30%, even more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, most preferably the IDNK gene is not expressed at all, compared to the wild type.

Small molecule compounds

The invention refers to a compound which is composed of several or dozens of atoms and has the molecular mass of less than 1000.

IDNK inhibitor for preparing medicine for treating liver cancer

The IDNK inhibitor is used as the main active ingredient or one of the main active ingredients for preparing the liver cancer treatment medicine. Generally, the medicament may comprise one or more pharmaceutically acceptable carriers or adjuvants in addition to the active ingredient, as required by the dosage form.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with, i.e., capable of being blended with, the IDNK inhibitor without substantially diminishing the effectiveness of the pharmaceutical composition under normal circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as glycerol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouth feel or odor in the case of oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be compatible with the mode of administration.

Combination therapeutic drug combinations and methods of administration

firstly), the IDNK inhibitor and other liver cancer treatment drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can be the same or different. When in use, several medicines can be used simultaneously or sequentially. When administered sequentially, the other drugs should be administered to the body during the period that the first drug is still effective in the body.

The antibody is usually administered by intravenous injection, intravenous drip or arterial infusion. The usage and the dosage can refer to the prior art.

The small molecule compounds are usually administered by either gastrointestinal or parenteral administration. The siRNA, shRNA and antibody are generally administered parenterally. Can be administered locally or systemically.

When in use, the effective dose of the IDNK inhibitor and the effective dose of other liver cancer treatment medicines can be used simultaneously, or the effective dose of the IDNK inhibitor and the effective dose of other liver cancer treatment medicines can be used sequentially. When administered sequentially, the other drug should be administered to the organism during the period that the first drug is still effective for the organism.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS Inmolecular BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATINSTRUCUTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; (iii) Methods Inenzymolygy, Vol.304, Chromatin (P.M. Wassarman and A.P.Wolffe, eds.), academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

Example 1

The first experiment method comprises the following steps:

1.IDNK gene interfering lentivirus preparation

Aiming at an IDNK gene, a specific target point interference sequence is designed, namely the target point sequence is AAACAGAACTAAGCATAAA, SEQ ID NO.1), TTCTCCGAACGTGTCACGT (SEQ ID NO.2) is used as a negative control sequence, an shRNA interference sequence is designed according to the target point sequence, the shRNA interference sequence is respectively constructed into an hU6-MCS-CMV-EGFP plasmid vector, and is co-transfected with a pHelper 1.0 vector and a pHelper 2.0 vector plasmid to obtain 293T cells, unpurified cell supernatants are obtained 48-72h after transfection, and the supernatants are purified and concentrated to obtain the high-titer lentivirus. Specifically, the sequence of shRNA against the IDNK gene is CCGGCCAAACAGAACTAAGCATAAA CTCGAGTTTATGCTTAGTTCTGTTTGGTTTTT (SEQ ID NO.3, noted shIDNK). The sequence of siRNA directed against the IDNK gene was AAACAGAACUAAGCAUAAA, SEQ IDNO.4). The negative control shRNA was designated shCtrl.

2. RT-PCR detection of target gene knockdown efficiency

Primer design was performed for IDNK gene. Extracting shCtrl and shIDNK interfering lentivirus infected group cells of a control group, respectively extracting RNA, carrying out reverse transcription to obtain cDNA, and detecting the mRNA expression condition of the IDNK by RT-PCR with GAPDH as an internal reference.

3. Western Blot exogenous verification of target validity

The construction of the fusion FLAG tag-containing IDNK expression cloning plasmid and the RNAi virus vector plasmid aiming at the IDKN interference target are co-transfected into 293T cells, and after 48 hours, the protein is collected and quantified, and the WesternBlot is used for detecting the protein knockdown efficiency.

4. Celigo cell counting method for detecting cell growth

BEL-7404 cells are subjected to lentivirus infection for 4 days, subcultured in a 96-well plate, plated for 24 hours, read and photographed by a celigo instrument, the number of cells expressing EGFP fluorescence in the plate is calculated by software processing, and after continuous detection for 5 days, a growth curve graph of the cells is drawn and the growth condition of the cells is analyzed.

5. MTT detection of cell viability

BEL-7404 cells are inoculated with lentivirus for 4 days, subcultured in a 96-well plate, plated 24 later, 20 mu L of 5mg/mL MTT solution is added 4h before culture is terminated, and 100 mu L of LDMSO solution is added 4h later for enzyme-linked immunosorbent assay.

6. PI-FACS flow cytometry

After BEL-7404 cells are infected by lentivirus for 4 days, passage plating is carried out, after the cell fusion degree reaches 85%, the cells are digested and collected, ethanol fixation and washing are carried out, PI staining solution is added to stain the cells, a flow cytometer is used for detecting the cells, and ModFit software is used for carrying out data analysis.

7. Annexin V-APC flow apoptosis assay

After BEL-7404 cells are infected by lentivirus for 4 days, passage plating is carried out, after the cell fusion degree reaches 85%, the cells are digested and collected, Annexin V-APC staining treatment is added, the cells are detected by using a flow cytometer, and analysis is carried out by using guava ICtrlyte flow cytometer analysis software.

Second, experimental results

1. Verification of IDNK gene interference lentivirus infection and knockdown efficiency

BEL-7404 cells are infected by MOI 20 through the constructed shIDNK interfering lentivirus and shCtrl control lentivirus, EGFP fluorescence is observed under a fluorescence microscope after 72 hours, and pictures are taken, so that the cell infection efficiency is over 80 percent, and the cell state is good (figure 1).

After the infection effect is confirmed, the interference efficiency of shIDNK lentivirus is verified through qPCR experiment. The qPCR result shows that shIDNK lentivirus obviously inhibits the expression amount of the IDNK gene in BEL-7404 cells at the mRNA level (p <0.05), and the knockdown efficiency reaches 84.5% (FIG. 2A). The FLAG tag is detected by Western Blot after the IDNK overexpression plasmid containing the fusion FLAG tag and the shIDNK interference plasmid are co-transfected into 293T cells, and the result shows that the interference target has a knock-down effect on the exogenous expression of the IDNK at the protein level, so that the interference target is an effective target (figure 2B).

2. IDNK gene interference for inhibiting BEL-7404 cell proliferation

Photographing and recording the shIDNK interference group and shCtrl control group BEL-7404 cells for 5 days continuously by a cello cell counting method, and the result shows that the IDNK gene interference can obviously influence the growth and proliferation of the BEL-7404 cells (figure 3A). The proliferation fold numbers of the shCtrl control group cells on the 2 nd day, the 3 rd day, the 4 th day and the 5 th day after adherent growth are respectively 1.35 +/-0.02, 3.55 +/-0.13, 5.66 +/-0.21 and 8.92 +/-0.26 (FIG. 3B), while the proliferation fold numbers of the shIDNK interference group cells on the 2 nd day, the 3 rd day, the 4 th day and the 5 th day after adherent growth are respectively 1.08 +/-0.06, 1.86 +/-0.11, 2.15 +/-0.1 and 2.69 +/-0.21, and the growth fold is obviously inhibited (FIG. 3C).

In addition, the influence of the IDNK gene on the cell viability is also verified by applying an MTT detection method. MTT experimental results show that the cell viability multiples of shCtrl control group cells at 2 days, 3 days, 4 days and 5 days after adherent growth are 1.357 + -0.0134, 1.888 + -0.0862, 2.55 + -0.031 and 3.959 + -0.0119 respectively, while the cell viability multiples of shIDNK interference group cells at 2 days, 3 days, 4 days and 5 days after adherent growth are 1.182 + -0.0179, 1.552 + -0.0407, 1.924 + -0.0611, 2.267 + -0.0125 respectively, which shows that the cell proliferation of shIDNK group is obviously slowed down (FIG. 4).

3. IDNK gene interference affecting BEL-7404 cell cycle redistribution

Furthermore, we used flow cytometry to examine the effect of IDNK gene interference on the cell cycle of BEL-7404. Flow-chart results show that shIDNK significantly increases the proportion of G1 phase cells and G2/M phase cells (p <0.01), significantly decreases the proportion of S phase cells (p <0.01), and may cause G1 phase arrest and G2/M phase arrest of cells (FIGS. 5A and 5B).

4. IDNK gene interference promoting BEL-7404 cell apoptosis

Cell cycle arrest is usually accompanied by apoptosis, so we next examined the effect of shIDNK on apoptosis by flow. The flow detection of Annexin V labeled cells shows that the apoptosis rate of shIDNK group is increased remarkably from 4.24 +/-0.1697% of shCtrl control group to 34.03 +/-0.0629% (p <0.01), indicating that IDNK gene interference remarkably promotes the apoptosis of BEL-7404 cells (FIGS. 6A and 6B).

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and alterations without departing from the spirit and scope of the present invention, and all equivalent changes, modifications and alterations to the present invention are equivalent embodiments of the present invention; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

Sequence listing

<110> third people's hospital in Wuxi city

Application of <120> IDNK inhibitor in preparation of liver cancer treatment drug

<130>176434

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

aaacagaact aagcataaa 19

<210>2

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ttctccgaac gtgtcacgt 19

<210>3

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccggccaaac agaactaagc ataaactcga gtttatgctt agttctgttt ggttttt 57

<210>5

<211>19

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aaacagaacu aagcauaaa 19

Claims

The application of an IDNK inhibitor in preparing a liver cancer treatment drug is characterized in that the IDNK inhibitor is a molecule with an inhibiting effect on IDNK, the IDNK inhibitor is selected from siRNA or shRNA, and the target sequence of the siRNA or shRNA is shown in SEQ ID NO. 1.
2. The use of claim 1, wherein the liver cancer treatment drug has at least one of the following functions: inhibiting proliferation of liver cancer cells, reducing liver cancer cell activity, increasing ratio of liver cancer cells at G1 stage and liver cancer cells at G2/M stage, reducing ratio of liver cancer cells at S stage, causing liver cancer cells to generate G1 stage retardation and G2/M stage retardation, promoting apoptosis of liver cancer cells, and inhibiting growth of liver cancer tumor.
3. The use of claim 1, wherein the IDNK inhibitor is the only active ingredient or one of the active ingredients of the liver cancer therapeutic drug.
4. A liver cancer treatment drug comprises an effective dose of an IDNK inhibitor, wherein the IDNK inhibitor is a molecule with an inhibiting effect on IDNK, the IDNK inhibitor is selected from siRNA or shRNA, and the target sequence of the siRNA or shRNA is shown as SEQID No. 1.
5. The therapeutic agent for liver cancer according to claim 4, wherein the IDNK inhibitor is the only active ingredient or one of the active ingredients of the therapeutic agent for liver cancer.
6. A liver cancer treatment drug combination comprises an effective amount of an IDNK inhibitor and at least one other liver cancer treatment drug, wherein the IDNK inhibitor is a molecule with an inhibition effect on IDNK, the IDNK inhibitor is selected from siRNA or shRNA, and the target sequence of the siRNA or shRNA is shown in SEQ ID NO. 1.
7. The pharmaceutical combination according to claim 6, wherein the combination therapy pharmaceutical combination is selected from any one of the following forms:

firstly), the IDNK inhibitor and other liver cancer treatment drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can be the same or different;

secondly), the IDNK inhibitor and other liver cancer treatment medicines are prepared into a compound preparation, and when the IDNK inhibitor and other liver cancer treatment medicines are administrated by the same administration route and applied simultaneously, the IDNK inhibitor and other liver cancer treatment medicines are prepared into the compound preparation.
Use of an IDNK inhibitor for the manufacture of a medicament having any one or more of the following effects: the anti-tumor liver cancer cell line has the advantages of reducing the survival rate of liver cancer cells, inhibiting the clone forming capability of the liver cancer cells, increasing the apoptosis ratio of the liver cancer cells, inhibiting the size of liver cancer tumors and inhibiting the growth of the liver cancer tumors, wherein the IDNK inhibitor is a molecule with an inhibiting effect on IDNK, the IDNK inhibitor is selected from siRNA or shRNA, and the target sequence of the siRNA or shRNA is shown in SEQ ID NO. 1.