KR102329524B1 - Composition for preventing or treating of liver cancer comprising modified rt-let7 as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating liver cancer, comprising modified RT-LET7 as an active ingredient. The modified RT-LET7 enhances the suppression of the expression of Let-7i-5p compared with existing RT-LET7, enhances the suppression of the growth of liver cancer cells, increases TSP1 expression, and enhances macrophage phagocytic activity. Therefore, the modified RT-LET7 can be used as a pharmaceutical composition for preventing or treating liver cancer.

Description

A composition for preventing or treating liver cancer comprising a modified RT-LET7 as an active ingredient {COMPOSITION FOR PREVENTING OR TREATING OF LIVER CANCER COMPRISING MODIFIED RT-LET7 AS AN ACTIVE INGREDIENT}

The present invention relates to a pharmaceutical composition for preventing or treating liver cancer, and more particularly, to a pharmaceutical composition for preventing or treating liver cancer comprising a modified RT-LET7, an expression inhibitor of Let-7i-5p, as an active ingredient.

Although liver cancer is the fifth most common cancer worldwide, it is the third most aggressive cancer in mortality (Ahn J, Flamm SL Hepatocellular carcinoma Dis Mon 2004;50:556-573). It is possible in only 25% of patients, and most liver cancer patients die within a relatively short period of time due to locally advanced or metastatic diseases (Roberts LR, Gores GJ Hepatocellular carcinoma: molecular pathways and new therapeutic targets Semin Liver Dis 2005;25: 212-225) Hepatitis B virus, hepatitis C virus, and aflatoxin B1 are well known as major causes of liver cancer. However, the overall survival rate of liver cancer patients has not increased significantly over the past 20 years, and the mechanism of development and progression of liver cancer is still unknown (Bruix J, et al Focus on hepatocellular carcinoma Cancer Cell 2004; 5:215-219) So far, molecular targeted therapy has been shown to be effective for the treatment of mature liver cancer (Shen YC, Hsu C, Cheng AL Molecular targeted therapy for advanced hepatocellular carcinoma: current status and future perspectives J Gastroenterol;45:794-807), it is unclear how these genetic changes lead to the clinical features observed in individual HCC patients.

Histone deacetylases (HDACs) can often be attached to gene promoters by corepressors or multi-protein transcriptional complexes, where they modify chromatin without binding directly to DNA. (Thiagalingam S, Cheng KH, Lee HJ, Mineva N, Thiagalingam A, Ponte JF Histone deacetylases: unique players in shaping the epigenetic histone code Ann NY Acad Sci 2003;983:84-100) There are 18 HDACs, which are class I (HDAC 1, 2, 3 and 8), class II (HDAC 4, 5, 6, 7, 9 and 10), class III (SIRT 1-7), and class IV ( HDAC11) enzymes (Yang XJ, Seto E The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men Nat Rev Mol Cell Biol 2008;9:206-218) Histone acetyltransferases and HDACs are known to be involved in cell proliferation, differentiation and cell cycle regulation (Witt O, Deubzer HE, Milde T, Oehme I HDAC family: What are the cancer relevant targets Cancer Lett 2009;277:8-21) , it has been reported that pathological activity and deregulation of HDACs can cause several diseases such as cancer, immune disease, and muscular dystrophy (Yang XJ, Seto E HATs and HDACs: from structure, functi on and regulation to novel strategies for therapy and prevention Oncogene 2007;26:5310-5318). HDAC6 is a class IIb family member of HDACs, acts as a cytoplasmic deacetylase related to microtubules (MTs), and deacetylates α-tubulin ( Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, et al HDAC6 is a microtubule-associated Mis18α. Nature 2002;417:455-458).

On the other hand, miRNA is a type of endogenous small RNA with a length of 20-25 nucleotides present in cells. do. miRNA binds to the complementary sequence of the 3'-UTR of the target mRNA, induces translational inhibition or destabilization of the mRNA, and ultimately serves as a repressor to inhibit protein synthesis of the target mRNA. One miRNA targets multiple mRNAs, and it is known that mRNA can also be regulated by multiple miRNAs.

On the other hand, macrophages phagocytose diseased cells (cancer cells) by phagocytosis, which occurs because Fc fragments of antibodies mediate binding to Fc receptors on the membrane surface of macrophages. However, tumors can escape from attack by immune cells, including macrophages, by overthrowing the normal immune regulatory machinery. One such mechanism is CD47, a protein expressed in normal cells. CD47 interacts with a macrophage receptor called SIRPα (signal-regulatory protein α), which leads to the macrophage “do not eat me (phagocytic blockade)” signal, which causes normal cells to leave. Equally, CD47 expression by cancer cells makes them resistant to macrophages even when the cancer cells bind to antibodies. Thus, although a large number of macrophages access the tumors, they cannot act on cancer cells unless the “phagocytic block” signal is turned off. One treatment strategy for this is to block the “phagocytic blocking” signal using a monoclonal antibody against CD47.

Therefore, the present invention confirmed that it can be used as a pharmaceutical composition for the prevention or treatment of liver cancer by modifying RT-LET7, an expression inhibitor of Let-7i-5p, and increasing the effect than the existing RT-LET7, and also modified By regulating macrophage phagocytosis by RT-LET7, it was confirmed that it can be used as an immunotherapy pharmaceutical composition for the treatment of CD47-positive liver cancer, thereby completing the present invention.

US 10-2012-0014893 A

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating liver cancer.

Another object of the present invention is to provide a pharmaceutical composition for immunotherapy for the treatment of CD47-positive liver cancer.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating liver cancer comprising a modified RT-LET7 as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for immunotherapy for the treatment of CD47-positive liver cancer comprising modified RT-LET7 as an active ingredient.

It was confirmed that the modified RT-LET7 according to the present invention significantly inhibited tumor cell growth in liver cancer compared to RT-LET7, which is an antisense microRNA (AS-miRNA) that inhibits Let-7i-5p of existing liver cancer cells, Modified RT-LET7 increases TSP1 by inhibiting Let-7i-5p in hepatocarcinoma cells, and the increased TSP1 binds to CD47 and blocks the interaction with SIRPα of macrophages. Therefore, CD47 of hepatocarcinoma cells and SIRPα of macrophages By blocking binding, it was confirmed that macrophage phagocytic activity was significantly increased through the mechanism of showing anticancer effect by increasing the immune activity of macrophages against cancer cells, and this was confirmed as a pharmaceutical composition for the prevention and treatment of liver cancer or CD47-positive liver cancer prevention or treatment It was confirmed that it can be used as a pharmaceutical composition for immunotherapy.

1 is a diagram showing various modified structures (FIG. 1A) and inhibition efficiency (FIG. 1B) of RT-LET7, an expression inhibitor of Let-7i-5p (basic type: RT-LET7, modification: RT-LET7-2, RT -LET7-4, RT-LET7-6 and RT-LET7-8).
2 is a diagram confirming the effect of RT-LET7-8, a modified RT-LET7 of the present invention, to significantly and continuously inhibit Let-7i-5p in HCC cell lines (FIG. 2a; SNU-387, FIG. 2b; SNU); -368, Fig. 2c; SNU-423).
3 is a view confirming the growth inhibition of HCC cell line and increase in macrophage activity by RT-LET7-8, which is a modified RT-LET7 of the present invention (FIG. 3a; Let-7i-5p through MTT and cell survival analysis) Characteristics of tumorigenesis, Figure 3b; TSP1 expression change through western blot analysis after treatment with primitive RT-LET7 and modified RT-LET7-8, Figure 3c; Basic type RT-LET7 and modified RT-LET7-8 treated macrophage phagocytosis of HCC cells).

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples of the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted, and , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, the terms used in this specification are terms used to properly express the preferred embodiment of the present invention, which may vary according to the intention of a user or operator, or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

In one aspect, the present invention relates to a nucleic acid molecule represented by SEQ ID NO: 1, which targets Let-7i-5p.

In one embodiment, in the "nucleic acid molecule" of the present invention, the nucleotide sequence of SEQ ID NO: 1 is 2`-O-methyl (2`-OMe) or 2`-O-methoxyethyl (2`-O-MOE) may be deformed.

In one embodiment, the "nucleic acid molecule" of the present invention may be one in which 3' of the nucleotide sequence of SEQ ID NO: 1 is modified with Phosphorothioate.

In one embodiment, the "nucleic acid molecule" of the present invention may be one in which 3' of any one or more nucleotide sequences of the nucleotide sequence from the 5' end to the 4th of the nucleotide sequence of SEQ ID NO: 1 is modified with phosphorothioate.

In one embodiment, the "nucleic acid molecule" of the present invention may be one in which 3' of any one or more of the nucleotide sequences of the nucleotide sequence from the 3' end to the 4th of the nucleotide sequence of SEQ ID NO: 1 is modified with phosphorothioate.

In one embodiment, the "nucleic acid molecule" of the present invention is one in which 3' of any one or more nucleotide sequences of the nucleotide sequence from the 5' end to the 4th of the nucleotide sequence of SEQ ID NO: 1 is modified with Phosphorothioate, 3' of any one or more nucleotide sequences among the nucleotides from the 3' end to the 4th of the nucleotide sequence may be modified with phosphorothioate.

In one embodiment, the "nucleic acid molecule" of the present invention is one in which 3' of all nucleotides of the nucleotide sequence from the 5' end to the 4th of the nucleotide sequence of SEQ ID NO: 1 are modified with Phosphorothioate, and 3 of the nucleotide sequence of SEQ ID NO: 1 '3 of all nucleotide sequences from the end to the 4th' may be modified with Phosphorothioate.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating liver cancer comprising the nucleic acid molecule as an active ingredient.

In one embodiment, the "composition" of the present invention may inhibit the expression of Let-7i-5p.

In one embodiment, the "composition" of the present invention may inhibit liver cancer cell growth.

In one embodiment, the "composition" of the present invention may increase TSP1 (thrombospondin-1) expression.

In one embodiment, the "composition" of the present invention may increase macrophage phagocytosis activity.

In one aspect, the present invention relates to an immunotherapy pharmaceutical composition for the treatment of CD47-positive liver cancer comprising the nucleic acid molecule as an active ingredient.

In one embodiment, "TSP1" of the present invention is capable of interfering with CD47-SIRPα interaction by occupying the CD47 receptor.

In one embodiment, the "nucleic acid molecule" of the present invention can modulate the let-7i-p-TSP1 signaling axis, and converts the CD47-SIRPα interaction between macrophages and HCC into a CD47-TSP1 interaction in macrophages. re-activating phagocytosis on HCC cells.

In one embodiment, the "liver cancer" of the present invention may be Let-7i-5p high-expressing liver cancer, may be hepatocellular carcinoma, and stage I, II, III, IVA or IVB stage hepatocellular carcinoma. It may be a carcinoma, and more preferably stage III to IV hepatocellular carcinoma, which is more difficult to treat than the initial stage.

In one embodiment, the "liver cancer" of the present invention may be TSP1 low-expressing liver cancer, may be hepatocellular carcinoma, may be hepatocellular carcinoma of stage I, II, III, IVA or IVB, and may be at an earlier stage. It is more preferable that it is stage III to IV hepatocellular carcinoma, which is difficult to treat.

As used herein, the term “repression of expression” means to cause a decrease in expression (to mRNA) or translation (to protein) of a target gene, preferably, whereby the expression of the target gene becomes undetectable or insignificant. means to exist as

In the present invention, the term "prevention" as used means any action of inhibiting or delaying the occurrence, development and recurrence of liver cancer by administration of the composition according to the present invention.

As used herein, the term “treatment” refers to any act of improving or beneficially changing the symptoms of liver cancer and its complications by administering the composition according to the present invention. Those of ordinary skill in the art to which the present invention pertains, with reference to the data presented in the Korean Medical Association, etc., know the exact criteria of the disease for which the composition of the present application is effective, and can determine the degree of improvement, improvement and treatment will be.

The therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the administration method, the target site, the condition of the subject, and the like.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is Health status, type and severity of infection, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well known in the medical field can be determined according to The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group comprising oral formulations, topical formulations, suppositories, sterile injection solutions and sprays.

The compositions of the present invention may also include carriers, diluents, excipients or combinations of two or more commonly used in biological agents. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. Compounds described in , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and if necessary, other antioxidants, buffers, bacteriostats, etc. Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets. Furthermore, it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

The composition of the present invention may further contain one or more active ingredients exhibiting the same or similar function. The composition of the present invention comprises 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid Calcium, sucrose, dextrose, sorbitol, talc and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

The composition of the present invention may be administered parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically) or orally according to a desired method, and oral administration is most preferred. The dosage varies according to the subject's body weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease.

Liquid preparations for oral administration of the composition of the present invention include suspensions, internal solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. and the like may be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.

The present invention will be described in more detail through the following examples. However, the following examples are only for specifying the contents of the present invention, and the present invention is not limited thereto.

<Example 1> Manufacture of modified RT-LET7 of existing RT-LET7

RT-LET7, an inhibitor of Let-7i-5p (SEQ ID NO: 1: AACAGCACAAACUACUCUCCUCA), proceeds one cycle in a four-step process, deblocking each 1mer of RNA oligo from the 3' end to the 5' end -> Coupling -> Oxidation -> Capping At this time, a modified base is used, and according to Nat Rev Drug Discov. 2020 Oct;19(10):673-694., the modification of 2'-Ribose (2'-O-methyl , 2'-MOE) increases resistance from nucleases compared to unmodified RNA, and contributes to increasing stability in the cytoplasm.In addition, it also serves to increase half-life in living tissues, resulting in drug effects Moreover, it strongly attaches to complementary RNA, helping target gene to be more effectively degraded by RNase In addition, when phosphorothioate is substituted between RNA bases, the activity of RNase is not affected. It binds efficiently to the target RNA and binds to proteins such as albumin in cells and in the body, protecting it from nucleases, and thus preventing the drug from being excreted in the urine, Ribose and phosphorothioate were modified for the reason that it increases the duration of the drug and enhances the effect of the drug.The modified RNA base 2'-OMe rA Phosphoramidite (Glen Research, Sterling, VA, cat. 10-3100) , 2'-OMe rC Phosphoramidite (Glen Research, cat. 10-3115), 2'-OMe rG Phosphoramidite (Glen Research, cat. 10-3120), 2'-OMe rU Phosphoramidite (Glen Research, cat. 10-3130) ), 2'-MOE rA Phosphoramidite (G len Research, cat. 10-3200), 2'-MOE rC Phosphoramidite (Glen Research, cat. 10-3211), 2'-MOE rG Phosphoramidite (Glen Research, cat. 10-3220), 2'-MOE rU Phosphoramidite (Glen Research, cat. 10-3231) is synthesized. The part that needs to be replaced with phosphorothioate in the synthesis process is synthesized using Sulfurizing Reagent II (Glen Research, cat. 40-4037-10) (Bioneer synthesis). At this time, the unmodified RNA oligo was RT-LET7, all bases were modified with 2'-O-methyl, and the RNA oligo modified with phosphorothioate was RT-LET7-2, 4 places at the 5' and 3' ends. The modified base was designated as RT-LET7-6. Then, all bases were modified with 2'-MOE, and the RNA oligo modified with phosphorothioate was named RT-LET7-4, and the bases modified at the 5' and 3' ends were named RT-LET7-8 (Fig. 1a).

<Example 2> Confirmation of inhibition of Let-7i-5p expression by treatment of modified RT-LET7

After isolation of total RNA from HCC cell lines (SNU-387, SNU-368, and SNU-423) transfected with the modified RT-LET7 made as shown in FIG. 1A using TRIzol reagent (Invitrogen, Carlsbad, CA) , cDNA specific for the two miRNAs was synthesized using the micscipt II RT kit (Qiagen, Manchester, UK). qRT-PCR was performed with a SensiFAST™ SYBR NoROX Kit (Bioline, London, UK). As a result of qRT-PCR analysis of Let-7i-5p in HCC cell lines (SNU-387, SNU-368, and SNU-423), when all bases were substituted with 2'-MOE (RT-LET7-4 and RT-LET7-8), it was confirmed that when substituted with 2'-O-methyl (RT-LET7-2 and RT-LET7-6), it was more effective in inhibiting the expression of Let-7i-5p (Fig. 1b). ).

In addition, when RT-LET7 was modified with 2'-MOE, HCC cell lines (SNU-387, SNU-368, and SNU-423) were cultured for up to 7 days after transfection and RNA extraction after Let-7i-5p When comparing the degree of inhibition of the expression of Let-7i-5p, it was confirmed that the efficiency of expression inhibition of Let-7i-5p was significantly increased when modified with 2'-MOE and substituted with phosphorothioate compared to RT-LET7 without any modification. (Fig. 2).

<Example 3> Characterization of Let-7i-5p for tumorigenesis through MTT and cell viability assay

In order to confirm the inhibitory ability of in vitro tumorigenesis upon RT-LET7 treatment in liver cancer, MTT analysis was performed using RT-LET7. Specifically, for MTT analysis, SNU-387 cells were aliquoted in a 12-well plate and transfected with RT-LET7, RT-LET7-4, RT-LET7-8, and then MTT[3-(4,5) After incubation with 0.5 mg/ml of -dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] solution (Sigma) for 1 hour, absorbance was measured using a SYNERGY H1 Multilabel plate reader (Bio-Tek, Winooski, VT). measured. As a result, it was confirmed that the most excellent inhibition of tumor cell growth in the experimental group treated with RT-LET7-8 modified RT-LET7 (FIG. 3a).

<Example 4> Confirmation of macrophage phagocytosis regulation by modified RT-LET7

To confirm whether Let-7i-5p regulates the expression of TSP1 involved in the regulation of macrophage phagocytosis, the expression change was analyzed by Western blot analysis after treatment with RT-LET7 and modified RT-LET7-8. Confirmed. As a result, when RT-LET7 and RT-LET7-8 were treated, it was confirmed that the expression of TSP1 was increased (FIG. 3b).

Based on these results, in the interaction between CD47 and SIRPα (signal regulatory protein α) in the Let-7i-5p-TSP1 network, TSP1 occupies the CD47 receptor and interferes with the CD47-SIRPα interaction, so macrophages can phagocytic HCC. To confirm whether it is possible, an in vitro phagocytosis assay was performed. Specifically, each of the HCC cell lines, SNU-387, was prepared as a single cell suspension and labeled with CFSE (abcam, Cambridge, UK). Thereafter, peritoneal macrophages were obtained from C57BL/6 mice and co-cultured with SNU-387 for 2 hours, treated with RT-LET7 and modified RT-LET7-8, respectively, and TSP1 recombinant protein was directly treated as a positive control. compared to treated HCC cells. The phagocytosis index was calculated by dividing the number of macrophages capturing tumor cells by the total number of macrophages. As a result, both RT-LET7 and modified RT-LET7-8-treated HCC cells confirmed that macrophage phagocytosis activity was significantly increased, and macrophage phagocytosis activity was higher in modified RT-LET7-8 compared to RT-LET7. It was confirmed that the increase (Fig. 3c).

Through this, RT-LET7-8-modified RT-LET7 can regulate the let-7i-p-TSP1 signaling axis, and by converting the CD47-SIRPα interaction between macrophages and HCC into a CD47-TSP1 interaction, It can be seen that re-activation of phagocytosis on HCC cells of phagocytes.

<110> NEORAT <120> COMPOSITION FOR PREVENTING OR TREATING OF LIVER CANCER COMPRISING MODIFIED RT-LET7 AS AN ACTIVE INGREDIENT <130> PN2106-323 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> RT-LET7 <400> 1 aacagcacaa acuacuaccu ca 22

Claims (13)

A nucleic acid molecule targeting Let-7i-5p represented by the nucleotide sequence of SEQ ID NO: 1,
The nucleic acid molecule is
All of the nucleotide sequences of SEQ ID NO: 1 are modified by 2'-O-methoxyethyl (2'-O-MOE),
3' of the nucleotide from the 5' end to the 4th of the nucleotide sequence of SEQ ID NO: 1 is modified with Phosphorothioate,
A nucleic acid molecule targeting Let-7i-5p, wherein the 3' of the nucleotide from the 3' to the 4th of the nucleotide sequence of SEQ ID NO: 1 is modified with Phosphorothioate. delete delete delete delete delete delete A pharmaceutical composition for preventing or treating liver cancer comprising the nucleic acid molecule of claim 1 as an active ingredient. 9. The method of claim 8,
The composition inhibits the expression of Let-7i-5p, a pharmaceutical composition for preventing or treating liver cancer. 9. The method of claim 8,
The composition inhibits the growth of liver cancer cells, a pharmaceutical composition for the prevention or treatment of liver cancer. 9. The method of claim 8,
The composition is to increase TSP1 (thrombospondin-1) expression, a pharmaceutical composition for the prevention or treatment of liver cancer. 9. The method of claim 8,
The composition is to increase macrophage phagocytosis activity, a pharmaceutical composition for the prevention or treatment of liver cancer. An immunotherapy pharmaceutical composition for the treatment of CD47-positive liver cancer comprising the nucleic acid molecule of claim 1 as an active ingredient.

Images