KR102428121B1 - Delivery system for preventing or treating of liver cancer comprising modified rt-let7 as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating liver cancer containing modified RT-LET7 with a delivery system as an active component, wherein the modified RT-LET7 with the delivery system according to the present invention was confirmed to increase the inhibition of expression of Let-7i-5p compared to existing RT-LET7-8, the inhibition of liver cancer cell growth, the expression of TSP1 and macrophage phagocytic activity. Therefore, the modified RT-LET7 with the delivery system can be used as the pharmaceutical composition for preventing or treating the liver cancer.

Description

A delivery system for the prevention or treatment of liver cancer comprising modified RT-LET7 as an active ingredient {DELIVERY SYSTEM FOR PREVENTING OR TREATING OF LIVER CANCER COMPRISING MODIFIED RT-LET7 AS AN ACTIVE INGREDIENT}

The present invention relates to a delivery system for preventing or treating liver cancer comprising a modified RT-LET7 as an active ingredient, and specifically, to a delivery system for preventing or treating liver cancer including a modified RT-LET7 equipped with a delivery system as an active ingredient It relates to a pharmaceutical composition for treatment.

Although liver cancer is the fifth most common cancer worldwide, it is the third most aggressive cancer in mortality (Ahn J, Flamm SL Hepatocellular carcinoma Dis Mon 2004;50:556-573). It is possible in only 25% of patients, and most liver cancer patients die within a relatively short period of time due to locally advanced or metastatic diseases (Roberts LR, Gores GJ Hepatocellular carcinoma: molecular pathways and new therapeutic targets Semin Liver Dis 2005;25: 212-225) Hepatitis B virus, hepatitis C virus, and aflatoxin B1 are well known as major causes of liver cancer. However, the overall survival rate of liver cancer patients has not increased significantly over the past 20 years, and the mechanism of development and progression of liver cancer is still not well known (Bruix J, et al Focus on hepatocellular carcinoma Cancer Cell 2004; 5:215-219) So far, molecular targeted therapy has been shown to be effective for the treatment of mature liver cancer (Shen YC, Hsu C, Cheng AL Molecular targeted therapy for advanced hepatocellular carcinoma: current status and future perspectives J Gastroenterol;45:794-807), it is unclear how these genetic changes lead to the clinical features observed in individual HCC patients.

Histone deacetylases (HDACs) can often be attached to gene promoters by corepressors or multi-protein transcriptional complexes, where they modify chromatin without binding directly to DNA. (Thiagalingam S, Cheng KH, Lee HJ, Mineva N, Thiagalingam A, Ponte JF Histone deacetylases: unique players in shaping the epigenetic histone code Ann N Y Acad Sci 2003;983:84-100) There are 18 HDACs, which are class I (HDAC 1, 2, 3 and 8), class II (HDAC 4, 5, 6, 7, 9 and 10), class III (SIRT 1-7), and class IV ( HDAC11) enzymes (Yang XJ, Seto E The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men Nat Rev Mol Cell Biol 2008;9:206-218) Histone acetyltransferases and HDACs are known to be involved in cell proliferation, differentiation and cell cycle regulation (Witt O, Deubzer HE, Milde T, Oehme I HDAC family: What are the cancer relevant targets Cancer Lett 2009;277:8-21) , it has been reported that the pathological activity and deregulation of HDACs can cause several diseases such as cancer, immune disease, and muscular dystrophy (Yang XJ, Seto E HATs and HDACs: from structure, functi on and regulation to novel strategies for therapy and prevention Oncogene 2007;26:5310-5318). HDAC6 is a member of the class IIb family of HDACs, acts as a cytoplasmic deacetylase related to microtubules (MTs), and deacetylates α-tubulin ( Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, et al HDAC6 is a microtubule-associated Mis18α. Nature 2002;417:455-458).

On the other hand, miRNA is a type of endogenous small RNA with a length of 20-25 nucleotides that exists in cells. do. miRNA binds to the complementary sequence of the 3'-UTR of the target mRNA, induces translational inhibition or destabilization of the mRNA, and ultimately serves as a repressor to inhibit protein synthesis of the target mRNA. One miRNA targets multiple mRNAs, and it is known that mRNA can also be regulated by multiple miRNAs.

On the other hand, macrophages phagocytose diseased cells (cancer cells) by phagocytosis, which occurs when the Fc fragment of antibodies mediates binding to the Fc receptor on the membrane surface of macrophages. However, tumors can escape attack by immune cells, including macrophages, by overthrowing the normal immune regulatory machinery. One such mechanism is CD47, a protein expressed in normal cells. CD47 interacts with a macrophage receptor called SIRPα (signal-regulatory protein α), which leads to a “don’t eat me (phagocytic)” signal to the macrophages, which causes normal cells to leave. Equally, CD47 expression by cancer cells makes them resistant to macrophages even when the cancer cells bind to antibodies. Thus, although a large number of macrophages access the tumors, they cannot act on the cancer cells unless the “phagocytic block” signal is turned off. One therapeutic strategy for this is to block the “phagocytic blocking” signal using monoclonal antibodies to CD47.

Therefore, the present invention confirmed that it can be used as a pharmaceutical composition for the prevention or treatment of liver cancer by modifying RT-LET7, an expression inhibitor of Let-7i-5p, and increasing the effect than the existing RT-LET7, and also modified By regulating macrophage phagocytosis by RT-LET7, it was confirmed that it can be used as a pharmaceutical composition for immunotherapy for the treatment of CD47-positive liver cancer, thereby completing the present invention.

KR10-2012-0014893A

It is an object of the present invention to provide a nucleic acid molecule targeting Let-7i-5p.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating liver cancer comprising the nucleic acid molecule as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for the treatment of CD47-positive liver cancer immunotherapy comprising the nucleic acid molecule as an active ingredient.

In addition, another object of the present invention is that in the nucleic acid molecule represented by SEQ ID NO: 1, the nucleotide sequence is modified by being 2'-O-Methoxyethyl (methoxyethyl), and some or the entire backbone is phosphorothioate ( To provide a nucleic acid molecule targeting Let-7i-5p, which is modified with phosphorothioate), characterized in that it is bound to a hepatocyte targeting moiety.

In order to solve the above problems, the present invention provides a nucleic acid molecule targeting Let-7i-5p, wherein the nucleic acid molecule is represented by the nucleotide sequence of SEQ ID NO: 1, and the nucleotide sequence is 2'-O-Methoxyethyl (methoxyethyl) Nucleic acid molecule characterized in that it is a modified nucleic acid, characterized in that part or the entire backbone is modified with phosphorothioate, and a hepatocyte targeting moiety is bound provides

In addition, the present invention provides a pharmaceutical composition for preventing or treating liver cancer comprising a modified RT-LET7 bound to a hepatocyte targeting moiety (Moiety) as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for the treatment of CD47-positive liver cancer immuno-oncology comprising a modified RT-LET7 bound to a hepatocyte targeting moiety (Moiety) as an active ingredient.

Compared to RT-LET7 and modified RT-LET7, which are antisense microRNAs (AS-miRNA) that inhibit Let-7i-5p of existing liver cancer cells, the modified RT-LET7 to which the hepatocyte target moiety is bound according to the present invention It was confirmed that it significantly inhibited tumor cell growth in liver cancer, and modified RT-LET7 equipped with a delivery system increased TSP1 by inhibiting Let-7i-5p in liver cancer cells, and the increased TSP1 binds to CD47. It blocks the interaction of macrophages with SIRPα and, therefore, prevents the binding of CD47 of liver cancer cells to SIRPα of macrophages, thereby enhancing the immune activity of macrophages against cancer cells, thereby significantly increasing the phagocytic activity of macrophages through the mechanism of showing anticancer effects. It was confirmed that it can be used as a pharmaceutical composition for the prevention and treatment of liver cancer or as a pharmaceutical composition for the prevention or treatment of CD47-positive liver cancer immunotherapy.

1 is a diagram showing various modified structures (FIG. 1A) and inhibition efficiency (FIG. 1B) of RT-LET7, an expression inhibitor of Let-7i-5p (basic type: RT-LET7, modification: RT-LET7-2, RT -LET7-4, RT-LET7-6 and RT-LET7-8).
2 is a diagram confirming the effect of RT-LET7-8, a modified RT-LET7 of the present invention, to significantly and continuously inhibit Let-7i-5p in HCC cell lines (FIG. 2a; SNU-387, FIG. 2b; SNU). -368, Fig. 2c; SNU-423).
3 is a view confirming the growth inhibition of HCC cell line and increase in macrophage activity by RT-LET7-8, which is a modified RT-LET7 of the present invention (FIG. 3a; Let-7i-5p through MTT and cell survival analysis) Characteristics of tumorigenesis, Figure 3b; TSP1 expression change through Western blot analysis after treatment with basic RT-LET7 and modified RT-LET7-8, Figure 3c; Basic RT-LET7 and modified RT-LET7-8 treated macrophage phagocytosis of HCC cells).
4 is a diagram confirming the efficiency of inhibiting Let-7i-5p expression and the effect of continuously inhibiting Let-7i-5p in GalNAc-coupled RT-LET7-8 HCC cells.
5 is a diagram confirming the efficiency of inhibiting Let-7i-5p expression and the effect of continuously inhibiting Let-7i-5p in Gal-LNP-coupled RT-LET7-8 HCC cells.
Figure 6 is a diagram confirming the growth inhibition of HCC cell line and increase in macrophage activity by GalNAc-conjugated RT-LET7-8 (Figure 6a; Let-7i-5p tumor formation through MTT and cell survival analysis) Characteristics, Fig. 6b; TSP1 expression change through western blot analysis after treatment with GalNAc-conjugated RT-LET7-8, Fig. 6c; Macrophage phagocytosis activity of HCC cells treated with GalNAc-conjugated RT-LET7-8).
Figure 7 is a diagram confirming the growth inhibition of HCC cell line and increase in macrophage activity by Gal-LNP-conjugated RT-LET7-8 (Figure 6a; Let-7i-5p tumor formation through MTT and cell survival analysis) Characteristics for, Fig. 6b; TSP1 expression change through western blot analysis after treatment with Gal-LNP-conjugated RT-LET7-8, Fig. 6c; Gal-LNP-conjugated RT-LET7-8 treated HCC cells macrophage phagocytosis activity).
Figure 8 is a diagram briefly showing a schematic diagram for the delivery system binding of GalNAc-RT-LET7-8 and Gal-LNP-RT-LET7-8.

Hereinafter, the present invention will be described in detail by way of embodiments of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples for the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted, and , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, the terms used in this specification are terms used to properly express a preferred embodiment of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

In one aspect, the present invention relates to a nucleic acid molecule represented by SEQ ID NO: 1, which targets Let-7i-5p.

In one embodiment, the "nucleic acid molecule" of the present invention may be a modified nucleotide sequence by 2'-O-Methoxyethyl (methoxyethyl).

In one embodiment, the "nucleic acid molecule" of the present invention may have a part or the entire backbone modified with phosphorothioate, preferably from 1 to 5' from the 5' end of the nucleotides of SEQ ID NO: 1 The backbone of the 4th nucleotide and the 1st to 4th nucleotides from the 3' end may be modified with phosphorothioate, but is not limited thereto.

In one embodiment, the "nucleic acid molecule" of the present invention may be one to which a hepatocyte targeting moiety (Moiety) is bound.

In addition, the hepatocyte targeting moiety (Moiety) may be used without limitation as long as it is known as a liver tissue target drug delivery system, for example, N-Acetylgalactosamine (GalNAc), Gal-LNP (Galactosyl lipidoid nanoparticle), Lipid-siRNA, Antibody -siRNA, Peptide-ASO, Stable nucleic acid lipid particle, Exosome, Spherical nucleic acid, DNA cage, etc. (Nat Rev Drug Discov. 2020 Oct;19(10):673-694.).

The Gal-LNP (Galactosyl lipidoid nanoparticle) may be composed of cholesterol, DSPC, C16-PET2000-ceramide and α-galactosyl ceramide.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating liver cancer comprising the nucleic acid molecule as an active ingredient.

In one embodiment, the "composition" of the present invention may inhibit the expression of Let-7i-5p.

In one embodiment, the "composition" of the present invention may inhibit liver cancer cell growth.

In one embodiment, the "composition" of the present invention may increase TSP1 (thrombospondin-1) expression.

In one embodiment, the "composition" of the present invention may increase macrophage phagocytosis activity.

In one aspect, the present invention relates to an immunotherapy pharmaceutical composition for the treatment of CD47-positive liver cancer comprising the nucleic acid molecule as an active ingredient.

In one embodiment, "TSP1" of the present invention is capable of interfering with CD47-SIRPα interaction by occupying the CD47 receptor.

In one embodiment, the "nucleic acid molecule" of the present invention is capable of modulating the let-7i-p-TSP1 signaling axis, and converts the CD47-SIRPα interaction between macrophages and HCC into CD47-TSP1 interaction in macrophages. re-activating phagocytosis on HCC cells.

In one embodiment, the "liver cancer" of the present invention may be Let-7i-5p high-expressing liver cancer, may be hepatocellular carcinoma, and stage I, II, III, IVA or IVB stage hepatocellular carcinoma. It may be a carcinoma, and more preferably stage III to IV hepatocellular carcinoma, which is more difficult to treat than the initial stage.

In one embodiment, the “liver cancer” of the present invention may be TSP1 low-expressing liver cancer, may be hepatocellular carcinoma, may be hepatocellular carcinoma of stage I, II, III, IVA or IVB, and may be at an earlier stage. It is more preferable that it is stage III to IV hepatocellular carcinoma, which is difficult to treat.

As used herein, the term "repression of expression" means to cause a decrease in expression (to mRNA) or translation (to protein) of a target gene, preferably whereby the target gene expression becomes undetectable or insignificant. means to exist as

In the present invention, the term "prevention" used in the present invention means any action of inhibiting or delaying the occurrence, development and recurrence of liver cancer by administration of the composition according to the present invention.

As used herein, the term “treatment” refers to any act of improving or beneficially changing the symptoms of liver cancer and its complications by administering the composition according to the present invention. Those of ordinary skill in the art to which the present invention pertains, with reference to the data presented by the Korean Medical Association, etc., know the exact criteria of the disease for which the composition of the present application is effective, and can determine the degree of improvement, improvement and treatment will be.

The therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the administration method, the target site, the condition of the individual, and the like.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is Health status, type and severity of infection, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well-known in the medical field can be determined according to The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group comprising oral formulations, topical formulations, suppositories, sterile injection solutions and sprays.

The compositions of the present invention may also include carriers, diluents, excipients or combinations of two or more commonly used in biological agents. A pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. The compound described in , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and if necessary, other antioxidants, buffers, bacteriostats, etc. Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets. Furthermore, it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition, the composition of the present invention may contain one or more active ingredients exhibiting the same or similar function. The composition of the present invention comprises 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid Calcium, sucrose, dextrose, sorbitol and talc and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

The composition of the present invention may be administered parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) or orally, depending on the desired method, and oral administration is most preferred. The dosage varies according to the subject's body weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease.

Liquid formulations for oral administration of the composition of the present invention include suspensions, internal solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. etc. may be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.

The present invention will be described in more detail through the following examples. However, the following examples are only intended to embody the contents of the present invention, and the present invention is not limited thereto.

<Example 1> Manufacture of modified RT-LET7 of existing RT-LET7

RT-LET7, an inhibitor of Let-7i-5p (SEQ ID NO: 1: AACAGCACAAACUACUCUCCUCA), proceeds one cycle in a four-step process, deblocking each 1mer of RNA oligo from the 3' end to the 5' end -> Coupling -> Oxidation -> Capping In this case, a modified base is used, and according to Nat Rev Drug Discov. 2020 Oct;19(10):673-694., the modification of 2'-Ribose (2'-O-methyl , 2'-MOE) increases resistance from nucleases compared to unmodified RNA, and contributes to increasing stability in the cytoplasm, and also serves to increase half-life in living tissues, resulting in drug effects Moreover, it strongly attaches to complementary RNA, helping target gene to be more effectively degraded by RNase In addition, when phosphorothioate is substituted between RNA bases, RNase activity is not affected. It binds efficiently to the target RNA and binds to proteins such as albumin in cells and in the body, protecting it from nucleases, and thus preventing the drug from being excreted in the urine. Ribose and phosphorothioate were modified for the reason that it increases the drug's duration by increasing the drug's effect Modified RNA base 2'-OMe rA Phosphoramidite (Glen Research, Sterling, VA, cat. 10-3100) , 2'-OMe rC Phosphoramidite (Glen Research, cat. 10-3115), 2'-OMe rG Phosphoramidite (Glen Research, cat. 10-3120), 2'-OMe rU Phosphoramidite (Glen Research, cat. 10-3130) ), 2'-MOE rA Phosphoramidite (G len Research, cat. 10-3200), 2'-MOE rC Phosphoramidite (Glen Research, cat. 10-3211), 2'-MOE rG Phosphoramidite (Glen Research, cat. 10-3220), 2'-MOE rU Phosphoramidite (Glen Research, cat. .10-3231). The part that needs to be replaced with phosphorothioate in the synthesis process is synthesized using Sulfurizing Reagent II (Glen Research, cat. 40-4037-10) (Bioneer synthesis). At this time, the unmodified RNA oligo was RT-LET7, all bases were modified with 2'-O-methyl, and the RNA oligo modified with phosphorothioate was RT-LET7-2, 4 places at the 5' and 3' ends. The modified base was designated as RT-LET7-6. In addition, all bases were modified with 2'-MOE, and the RNA oligo modified with phosphorothioate was named RT-LET7-4, and the bases modified at the 5' and 3' ends were named RT-LET7-8 (Fig. 1a).

<Example 2> Confirmation of inhibition of expression of Let-7i-5p by treatment of modified RT-LET7

After isolation of total RNA from HCC cell lines (SNU-387, SNU-368, and SNU-423) transfected with the modified RT-LET7 made as shown in FIG. 1A using TRIzol reagent (Invitrogen, Carlsbad, CA) , cDNA specific for the two miRNAs was synthesized using the micscipt II RT kit (Qiagen, Manchester, UK). qRT-PCR was performed with a SensiFAST™ SYBR NoROX Kit (Bioline, London, UK). As a result of performing qRT-PCR analysis of Let-7i-5p in HCC cell lines (SNU-387, SNU-368, and SNU-423), when all bases were substituted with 2'-MOE (RT-LET7-4 and RT-LET7-8), it was confirmed that the effect was better in inhibiting the expression of Let-7i-5p than when substituted with 2'-O-methyl (RT-LET7-2 and RT-LET7-6) (Fig. 1b). ).

In addition, when RT-LET7 was modified with 2'-MOE, HCC cell lines (SNU-387, SNU-368, and SNU-423) were cultured for up to 7 days after transfection and RNA extraction after Let-7i-5p When comparing the degree of suppression of expression of Let-7i-5p, it was confirmed that when modified with 2'-MOE and then replaced with phosphorothioate, the expression suppression of Let-7i-5p was significantly increased compared to RT-LET7 without any modification. (Fig. 2).

<Example 3> Characterization of Let-7i-5p for tumorigenesis through MTT and cell viability analysis

In order to confirm the inhibitory ability of in vitro tumorigenesis upon RT-LET7 treatment in liver cancer, MTT analysis was performed using RT-LET7. Specifically, for MTT analysis, SNU-387 cells were aliquoted in a 12-well plate and transfected with RT-LET7, RT-LET7-4, RT-LET7-8, and then MTT [3-(4,5) After incubation with 0.5 mg/ml of -dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] solution (Sigma) for 1 hour, absorbance was measured using a SYNERGY H1 Multilabel plate reader (Bio-Tek, Winooski, VT). measured. As a result, it was confirmed that the most excellent inhibition of tumor cell growth in the experimental group treated with RT-LET7-8 modified of RT-LET7 (FIG. 3a).

<Example 4> Confirmation of macrophage phagocytosis regulation by modified RT-LET7

To confirm whether Let-7i-5p regulates the expression of TSP1, which is involved in the regulation of macrophage phagocytosis, the expression change was analyzed by Western blot analysis after treatment with RT-LET7 and modified RT-LET7-8. Confirmed. As a result, when RT-LET7 and RT-LET7-8 were treated, it was confirmed that the expression of TSP1 was increased ( FIG. 3b ).

Based on these results, in the interaction between CD47 and SIRPα (signal regulatory protein α) in the Let-7i-5p-TSP1 network, TSP1 occupies the CD47 receptor and interferes with the CD47-SIRPα interaction, so macrophages can phagocytic HCC. In order to confirm whether it is possible, in vitro phagocytosis analysis was performed. Specifically, each of the HCC cell lines, SNU-387, was prepared as a single cell suspension and labeled with CFSE (abcam, Cambridge, UK). Thereafter, peritoneal macrophages were obtained from C57BL/6 mice and co-cultured with SNU-387 for 2 hours, treated with RT-LET7 and modified RT-LET7-8, respectively, and TSP1 recombinant protein as a positive control directly. compared to treated HCC cells. The phagocytosis index was calculated by dividing the number of macrophages capturing tumor cells by the total number of macrophages. As a result, it was confirmed that both the HCC cells treated with RT-LET7 and the modified RT-LET7-8 significantly increased the macrophage phagocytosis activity, and the macrophage phagocytosis activity was higher in the modified RT-LET7-8 compared to RT-LET7. It was confirmed that the increase (Fig. 3c).

Through this, RT-LET7-8 modified RT-LET7 could modulate the let-7i-p-TSP1 signaling axis, and by converting the CD47-SIRPα interaction between macrophages and HCC into a CD47-TSP1 interaction, It can be seen that re-activation of phagocytosis of phagocytes on HCC cells.

<Example 5> Efficiency verification of RT-LET7-8 bound to hepatocyte target moiety (Moiety)

5-1. Confirmation of inhibition of Let-7i-5p expression of RT-LET7-8 using a delivery system

In order to confirm the effect of inhibiting the expression of Let-7i-5p of the modified RT-LET7-8 using a delivery system, N-Acetylgalactosamine (GalNac) or Gal-LNP (Galactosyl lipidoid nanoparticle, known as a drug delivery system) ), a nucleic acid molecule bound to RT-LET7-8 was delivered to cells in which ASGPR (asialoglycoprotein receptor) expression was positive (Hep3B) and negative cells (SNU-449).

Specifically, GalNAc-RT-LET7-8 was modified RT-LET7-8 by conjugating Trebler phosphoramidite (GLEN Research) to the 5' end of the modified RT-LET7-8 and then N-acetylgalactosamine (GLEN Research) was conjugated. to synthesize GalNAc-RT-LET7-8 (see FIG. 8a ). Subsequently, Gal-LNP-RT-LET7-8 was synthesized by combining alkylepoxide (Sigma-Aldrich) and polyamine (Sigma-Aldrich), C12-SPM, DSPC (Distearoylphosphatidylcholine) (Sigma-Aldrich), cholesterol (Sigma) -Aldrich), C16-PEG2000-ceramide (Avanti Polar Lipids) and α-galactosyl ceramide (Avanti Polar Lipids) were mixed in a ratio of 50:10:38.5:0.75:0.75, respectively, to prepare Gal-LNP. Then, RT-LET7-8 solution (10 mg / mL) is mixed with 10 mM citrate buffer (pH 3), and Gal-LNP and RT-LET7-8 are mixed 7:1 and incubated at 37 °C for 30 minutes. Gal-LNP was loaded with RT-LET7-8. Thereafter, it was dialyzed against PBS (Sigma-Aldrich, cat. P5368) for 75 minutes to remove RT-LET7-8 not loaded with ethanol and Gal-LNP (see FIG. 8b ). Thereafter, the expression level of Let-7i-5p in each cell was confirmed in the same manner as in Example 2.

As a result, in the case of GalNac-conjugated RT-LET7-8, the ASGPR positive cell Hep3B cell showed a significant increase in the inhibitory effect of Let-7i-5p expression compared to the existing RT-LET7-8, but the ASGPR negative cell SNU- In 449 cells, the expression inhibitory effect of Let-7i-5p was not increased (Fig. 4a). On the other hand, in the case of RT-LET7-8 bound to Gal-LNP, the effect of inhibiting the expression of Let-7i-5p was significantly increased regardless of the presence of ASGPR (Fig. 5a). These results show that GalNac is a delivery system having the property of binding to the ASGPR receptor on the surface of the liver cell, so it is effective only on ASGPR postive cells, but Gal-LNP has a structure similar to the cell membrane, so it is expected to show the effect regardless of ASGPR.

In addition, Gal-LNP-conjugated RT-LET7-8 (Gal-LNP-RT-LET7-8) was more effective than Let-7i-5p compared to lipofectamine-conjugated RT-LET7-8 (Lipo-RT-LET7-8). The expression was found to be significantly reduced. In the case of lipofectamine, it is composed of simple phospholipids, and compared with Gal-LNP composed of cholesterol, DSPC, C16-PET2000-ceramide, and α-galactosyl ceramide, the efficiency of delivery to the liver and stability in vivo are significantly improved. means to fall

Subsequently, 7-day efficiency maintenance verification of RT-LET7-8 to which a hepatocyte target moiety (GalNac or Gal-LNP) was bound in Hep3B cells was performed. As a result, the effect of suppressing the expression of Let-7i-5p was maintained until 7 days, and it was shown that the expression of Let-7i-5p was stably inhibited even compared to Lipo-RT-LET7-8 ( FIGS. 4b and 5b ). ).

5-2. Confirmation of tumorigenesis inhibition in liver cancer of RT-LET7-8 using delivery system

In order to confirm the inhibitory ability of in vitro tumorigenesis upon RT-LET7-8 treatment with a hepatocellular target moiety bound in liver cancer, MTT analysis was performed by the method of Example 3.

As a result, in the case of GalNac-RT-LET7-8 and Gal-LNP-RT-LET7-8 bound with a hepatocyte targeting moiety, the tumor formation of hepatocellular carcinoma was effectively inhibited compared to the control group, and Lipo-RT-LET7- 8, it was found that, when 72 hours elapsed, it showed a high tumorigenicity inhibitory ability ( FIGS. 6a and 7a ).

5-3. Confirmation of macrophage phagocytosis regulation of RT-LET7-8 using a delivery system

To confirm the expression change of let-7i-5p target protein TSP1 by lowering the expression of let-7i-5p, the target microRNA of RT-LET7, modified RT-LET7-8 and hepatocyte target moiety (Moiety) After treatment with RT-LET7-8, the expression change was confirmed through Western blot analysis.

As a result, it was confirmed that the expression of TSP1 was increased in the case of RT-LET7-8 to which the hepatocyte target moiety was bound compared to the modified RT-LET7-8 to which the hepatocyte target moiety was not bound (Fig. 6b and 7b).

Then, in order to confirm whether macrophages are capable of phagocytosing HCC, an in vitro phagocytosis assay was performed by the method of Example 4.

As a result, it was confirmed that macrophage phagocytosis activity was further increased in GalNac-RT-LET7-8 and Gal-LNP-RT-LET7-8 compared to modified RT-LET7-8 ( FIGS. 6c and 7c ).

Through this, when the modified RT-LET7-8 is equipped with a hepatocyte-targeted delivery system, it increases delivery to the target organ, the liver, thereby inhibiting Let-7i-5p expression in hepatocytes, tumor formation inhibitory efficacy in liver cancer, and macrophage phagocytosis activity It can be seen that the efficacy is significantly increased.

<110> NEORNAT <120> DELIVERY SYSTEM FOR PREVENTING OR TREATING OF LIVER CANCER COMPRISING MODIFIED RT-LET7 AS AN ACTIVE INGREDIENT <130> PN2110-489 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> RT-LET7 <400> 1 aacagcacaa acuacuaccu ca 22

Claims (9)

As a nucleic acid molecule targeting Let-7i-5p represented by the nucleotide sequence of SEQ ID NO: 1,
The nucleic acid molecule is
All sequences of the nucleotides of SEQ ID NO: 1 are modified by 2'-O-methoxyethyl,
The backbone of the nucleotides from the 5' end and the 3' end to the 4th end of the nucleotide sequence of SEQ ID NO: 1 is modified with phosphorothioate,
A nucleic acid molecule targeting Let-7i-5p, which is bound to a hepatocyte targeting moiety. delete delete The method of claim 1,
The hepatocyte targeting moiety (Moiety) is a nucleic acid molecule, characterized in that N-Acetylgalactosamine (GalNAc) or Gal-LNP (Galactosyl lipidoid nanoparticle). A pharmaceutical composition for preventing or treating liver cancer, comprising the nucleic acid molecule of claim 1 or 4 as an active ingredient. 6. The method of claim 5,
The composition inhibits the expression of Let-7i-5p, a pharmaceutical composition for preventing or treating liver cancer. 6. The method of claim 5,
The composition is to increase TSP1 (thrombospondin-1) expression, a pharmaceutical composition for the prevention or treatment of liver cancer. 6. The method of claim 5,
The composition is to increase macrophage phagocytosis activity, a pharmaceutical composition for the prevention or treatment of liver cancer. Claims 1 or 4, comprising the nucleic acid molecule of claim 4 as an active ingredient, CD47-positive immunotherapy pharmaceutical composition for the treatment of liver cancer.

Images