CN108070589A - Nucleic acid molecules CTL4HSH9, its preparation method and application - Google Patents

Abstract

The invention belongs to cell biologies and field of medicaments.The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；And its object component inhibited includes the sequence shown in SEQ ID NO 1.The present invention provides the recombinant vectors containing the nucleic acid molecules, additionally provide a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules；The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the preparation method and application of the nucleic acid.

Description

Nucleic acid molecules CTL4HSH9, its preparation method and application

Technical field

The invention belongs to cell biologies and field of medicaments, and specifically, the present invention relates to a kind of nucleic acid molecules and its systems Preparation Method and application.

Background technology

Tumour is body under the effect of various carcinogenic factors, and some cell of local organization loses pair at the genetic level The normal regulation of its growth, the abnormality for causing its clonal abnormality hyperplasia and being formed.The neoplastic disease number of cases in China is quite huge Greatly, there is data to show and account for the 55% of whole world case load.Tumor disease has risen to the world the 2nd " killer ", death toll It is only second to cardiovascular disease.

Influence of the benign tumour to body is smaller, is mainly shown as local compression and obstructive symptom.Malignant tumour is due to dividing Change immature, growth comparatively fast, infiltration destroys the 26S Proteasome Structure and Function of organ, and can shift, thus body is influenced serious.It dislikes Property tumour can also have fever, intractable pain in addition to it can cause the local compression and obstructive symptom similar to above-mentioned benign tumour, Late period may occur in which seriously become thin, be weak, the state of anaemia and cachexia.

In recent years, foreign medical science bound pair had new understanding again in the pathogenesis of tumor disease on cell base. Based on being further understood to Tumorigenesis, people can be special to develop and develop using various approach, effectively kills Hinder tumour cell and to the avirulent drug of normal cell.At present, for cancer treatment still using chemotherapy and radiotherapy as first choice, Though the two achieves the effect of suitable to the treatment of tumour, due to lacking the specificity to tumour cell thus having larger Toxic side effect and some tumour cells chemotherapy and radiation is handled it is insensitive, therefore greatly limit they Application in clinic.In recent years, cancer cell can specifically be killed and to medicine of the normal cell without toxic side effect to develop Object, people are paid much attention to by the pathogenesis of cancer from the research on cell, molecular level and huge investment.For example, " knot The carcinoma of the rectum "（CRC）Always there is the title of " rich people's disease " in tumour, show that it has close contact with people’s lives custom. In Shanghai, with the improvement of living standards, the incidence of colorectal cancer has leapt to the second of common cancer, is only second to lung Cancer.According to Tumor Hispital Attached to Fudan Univ statistics, surgery for colorectal carcinoma amount rose year after year in recent years, and institute knot is straight within 2007 Nearly 900 of intestinal cancer amount for surgical, has broken through thousand in 2008, has reached 1027.Develop can specifically killing tumor cell and The drug or compounds that have no toxic side effect to normal cell are always the hot spot of this field.

The content of the invention

The technical problem to be solved in the present invention is to provide a kind of for inhibiting the nucleic acid of cell in vitro CTL4 gene expressions point Son.Inhibit the expression of external CTL4 genes by preparing, using the nucleic acid molecules, target cell normal physiological is maintained so as to reach The effect of state.

The present invention provides a kind of new nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；

And

Its object component inhibited includes the sequence shown in SEQ ID NO 1.

Preferably, object component has the sequence shown in SEQ ID NO 1.

The present invention also provides a kind of recombinant vectors, it includes above-mentioned nucleic acid molecules.

Wherein, A, T, G and C are adenylic acid, thymidylic acid, guanylic acid and cytimidine core respectively Thuja acid.

In the present invention, term " CTL4HSH9 " refers to the target element for inhibiting blood vessel CTL4 expression activities and inhibiting Part includes the nucleic acid molecules of sequence shown in SEQ ID NO 1.The term further includes the sequence of object component and SEQ ID NO 1 Homology at least 90% nucleic acid molecules.

The term be additionally included in object component 5 ' and/or 3 ' end addition it is several (be usually 5 within, preferably 3 with It is interior) nucleotide or 3 ' end adds in several dT（Deoxythymidine）The sequence formed afterwards.

In the present invention, various carriers known in the art, such as commercially available carrier can be selected.For example, select commercially available load Then body will be operably coupled to expression regulation sequence containing the DNA sequence dna corresponding to CTL4HSH9 of the present invention, can form weight Group carrier.For example, slow virus, adenovirus or russian spring-summer encephalitis virus expression system (Semliki Forest may be employed Virus).Slow virus（Lentivirus）Belong to retrovirus subgenus, with human immunodeficiency virus (human immunod Efficiency virus, HIV) it is representative.Slow virus not only has infection division target cell and integrates in its genome, especially It is a variety of nondividings including neuronal cell, macrophage, liver cell, cardiac muscle cell and stem cell etc. with infection Cell ability, thus, the slow virus carrier effective tool as gene transfer is widely used in gene function especially base Because of the research for the treatment of.

On the other hand, the present invention provides a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned Nucleic acid molecules.

Preferably, the sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.

For example, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2.

Alternatively, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 3.

Preferably, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2 and SEQ ID NO 3.

The present invention also provides the preparation method of mentioned reagent box, including preparing sequence such as SEQ ID NO 2 or SEQ The step of nucleic acid molecules shown in ID NO 3：Nucleic acid molecules as shown in SEQ ID NO 2 or SEQ ID NO 3 are according to it Sequence is artificial synthesized；I.e. by nucleotide sequence, by each ribonucleic acid molecule successively dehydrating condensation.

Alternatively, it is connected after being prepared respectively using enzymatic cleavage methods and by each function element.

The third aspect, the present invention provides a kind of method for inhibiting cell in vitro CTL4 gene expressions, i.e., upper nucleic acid molecules Pass through appropriate medium transfection in vitro cell.

For example, it adds in the culture medium of cell in vitro or passes through carrier（Including virus carrier system）Transfect target cell.

Specifically, this method can include：

（1）Amplifier nucleic acid molecule；

（2）Build the expression vector containing nucleic acid molecules；

（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.

The present invention also provides above-mentioned nucleic acid molecule, preparing inhibition, cell in vitro --- especially tumour is thin The application of the medicament of born of the same parents --- multiplication.The experimental results showed that CTL4HSH9 of the invention can substantially inhibit the expression of CTL4.Experiment It proves, CTL4（NCBI gene I/Ds 80736）It, also can be right with important immune system biological function, but in some cases Body causes to damage, and causes allergic disease or immunity disease.Inhibit the expression of CTL4 in the cell for limiting scope, Its caused radical response can be effectively controlled, safeguards the normal physiological activity of body.

Nucleic acid molecules of the present invention and the like, when being administered (administration) in the treatment, it is possible to provide different effects Fruit.In general, these substances can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH 5-8 ordinarily is about, preferably pH is about 6-8, although pH value can have with the property and illness to be treated that are formulated substance Changed.Prepared pharmaceutical composition can be administered by conventional route, including (but being not limited to)：Intramuscular, Peritonaeum is interior, subcutaneous, intracutaneous or local administration.

By taking the nucleic acid molecules of the present invention as an example, itself and suitable pharmaceutically acceptable carrier can be combined.This kind of medicine Compositions contain the compound of therapeutically effective amount and pharmaceutically acceptable carrier or excipient.This kind of carrier is included (but simultaneously It is not limited to)：Brine, buffer solution, glucose, water, glycerine, ethyl alcohol, and combinations thereof.Pharmaceutical preparation should match with administering mode. The nucleic acid molecules of the present invention can be made into injection form, such as with physiological saline or water-soluble containing glucose and other assistant agents Liquid is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc can be prepared by conventional method. Pharmaceutical composition such as injection, solution, tablet and capsule preferably aseptically manufacture.The dosage of active ingredient is that treatment is effective Amount, such as the mg/kg weight of about 1 microgram/kg body weight-about 10 daily.In addition, the present invention's can also be with other therapeutic agents one It rises and uses.

When the nucleic acid molecules of the present invention are used as drug, the polypeptide for the treatment of effective dose can be applied to lactation and moved Object, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and in most cases it is no more than about 8 millis G kg weight, preferably the dosage is the mg/kg weight of about 10 micrograms/kg body weight-about 1.Certainly, specific dosage is also The factors such as administration route, patient health situation are considered as, within the scope of these are all skilled practitioners technical ability.In the present invention, institute The pharmaceutical composition that the medicament stated is made of the nucleic acid molecules containing effective therapeutic dose and carrier pharmaceutically or excipient.

The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；And its The object component of inhibition includes the sequence shown in SEQ ID NO 1.The present invention provides the restructuring loads containing the nucleic acid molecules Body, additionally provides a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules；The nucleic acid The sequence of molecule is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the nucleic acid and preparation method and Using.Experiment shows that nucleic acid molecules of the invention can inhibit the expression quantity of cell in vitro CTL4 genes at least 45%.

Specific embodiment

Embodiment 1 designs, screens CTL4 inhibition molecules

Inhibit molecule, sequence using GATGATGTCTACCATGTTCTA in CTL4 sequences (SED ID NO 1) as target sieving For 5'-ACCTCGATGATGTCTACCATGTTCTATCAAGAGTAGAACATGGTAGACATCAT CTT-3'(SED ID NO Or 5'-CAAAAAGATGATGTCTACCATGTTCTACTCTTGATAGAACATGGTAGACATCA TCG-3'(SED ID 2) NO 3) nucleic acid molecules as CTL4 candidate inhibitors, be known as CTL4HSH9.

Kind 293T cells plant plate density 2*10 in 24 orifice plates⁴/ hole.

After kind of plate for 24 hours（Hour）, 72h, 120h repeat transfection CTL4HSH9 segments, with Opti-MEM（Opti-MEM I Reduced Serum Medium, invitrogen companies, 31985-070）It is dissolved for solvent, final concentration is made to reach 40nM.Turn Transfection reagent uses lipofectamin2000（11668-027, invitrogene company）.

In first time transfect after for 24 hours, 72h, 120h vitellophag, collect 72h and 120h parts（5*10⁴）Cell sample. Western is detected, antibody Nogo (N-18) SC-11027 (santa cruz companies) CTL4 intrinsic protein expressions Variation.

Conclusion：With siRNA feminine gender segments NS（Target replaces with GAATTCCGGTCGCATTATTAT, SEQ ID NO 4） Compare, 5'-ACCTCGATGATGTCTACCATGTTCTATCAAGAGTAGAACATGGTAGACATCAT CTT-3' or 5'- 72h, that is, visible after CAAAAAGATGATGTCTACCATGTTCTACTCTTGATAGAACATGGTAGACATCATCG -3' transfections CTL4 protein expression levels lower at least 50%.This explanation, CTL4HSH9 of the invention can substantially inhibit CTL4.

Embodiment 2 tests the cell-based screening of the consumption of CTL4 gene expressions

Experimental procedure：

Kind 293T cells（Purchased from Chinese Academy of Sciences's cell bank）In 96 orifice plates, plate density 0.8*10 is planted⁴/ hole.

The lentivirus of CTL4HSH9 will be carried afterwards for 24 hours（Slow virus, Ji Kai companies）It transduces into cell.Lentivirus Titre is 106TU/ul, and it is 100 to take MOI, i.e., 80ul virus liquids are added in per hole.Specific transduction method is as follows：

50ul fresh cultures are changed to every hole cell（PH7.0）, appropriate virus liquid is added in, adds 50ul cultures after 7-8h per hole Base.Change liquid afterwards for 24 hours.48-72h observes GFP（Green fluorescence）Fluorescence detects transduction efficiency.

By cell expansion culture, GFP green fluorescence sortings are carried out to cell using flow cytometry, filter out viral transduction Positive cell, and detect its positive rate.

Western detects the variation of the CTL4 intrinsic protein expressions of positive cell and negative cells.

Conclusion：

A. 48h observes GFP fluorescence, and positive rate is about 50%, illustrates that viral transduction experimental method is correct.

B. flow cytometry sorting transducer cell, positive group and the transduction rate of negative group are all higher than 90%（Flow cytometer Display data）.

C. Western detects positive cell CTL4 protein expression levels and is substantially reduced compared with negative cells.

SEQUENCE LISTING

<110>Fudan University

<120>Nucleic acid molecules CTL4HSH9, its preparation method and application

<130> 201609

<160> 4

<170> PatentIn version 3.1

<210> 1

<211> 21

<212> DNA

<213> Artificial

<400> 1

gatgatgtct accatgttct a 21

<210> 2

<211> 56

<212> DNA

<213> Artificial

<400> 2

acctcgatga tgtctaccat gttctatcaa gagtagaaca tggtagacat catctt 56

<210> 3

<211> 56

<212> DNA

<213> Artificial

<400> 3

caaaaagatg atgtctacca tgttctactc ttgatagaac atggtagaca tcatcg 56

<210> 4

<211> 21

<212> DNA

<213> Artificial

<400> 4

gaattccggt cgcattatta t 21

Claims (10)

1. a kind of nucleic acid molecules, which is characterized in that it has the activity for inhibiting cell in vitro CTL4 gene expressions；

And

Its object component inhibited includes the sequence shown in SEQ ID NO 1.

2. a kind of nucleic acid molecules as described in claim 1, which is characterized in that object component has shown in SEQ ID NO 1 Sequence.

3. a kind of recombinant vector, which is characterized in that it includes nucleic acid molecules as described in claim 1.

4. a kind of kit for inhibiting cell in vitro CTL4 gene expressions, which is characterized in that it includes core described in claim 1 Acid molecule；

The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.

5. a kind of kit as claimed in claim 4, which is characterized in that it has core of the sequence as shown in SEQ ID NO 2 Acid molecule.

6. a kind of kit as claimed in claim 4, which is characterized in that it has core of the sequence as shown in SEQ ID NO 3 Acid molecule.

7. a kind of kit as claimed in claim 4, which is characterized in that it has sequence such as SEQ ID NO 2 and SEQ ID Nucleic acid molecules shown in NO 3.

8. the preparation method of any one kit in claim 4-7, which is characterized in that the preparation method includes preparing The step of nucleic acid molecules of the sequence as shown in SEQ ID NO 2 or SEQ ID NO 3：Such as SEQ ID NO 2 or SEQ ID Nucleic acid molecules shown in NO 3 are artificial synthesized according to its sequence.

A kind of 9. method for inhibiting cell in vitro CTL4 gene expressions, which is characterized in that by nucleic acid molecules described in claim 1 Pass through appropriate medium transfection in vitro cell.

10. the application of nucleic acid molecules described in claim 1, which is characterized in that inhibit external thin in preparation including the nucleic acid molecules Application in terms of born of the same parents' CTL4 expression；

The application comprises the following steps：

（1）Expand the nucleic acid molecules in the kit described in claim 4；

（2）Build the expression vector containing the nucleic acid molecules described in claim 4 described in kit；

（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.