CN107868783A - Nucleic acid molecules CTL4HSH2, its preparation method and application - Google Patents

Abstract

The invention belongs to cell biology and field of medicaments.The invention provides a kind of nucleic acid molecules, and it has the activity for suppressing cell in vitro CTL4 gene expressions；And its object component suppressed includes the sequence shown in SEQ ID NO 1.The invention provides the recombinant vector containing the nucleic acid molecules, additionally provides a kind of kit for suppressing cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules；The sequence of described nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.Present invention also offers the preparation method and application of the nucleic acid.

Description

Nucleic acid molecules CTL4HSH2, its preparation method and application

Technical field

The invention belongs to cell biology and field of medicaments, and specifically, the present invention relates to a kind of nucleic acid molecules and its system Preparation Method and application.

Background technology

Tumour is body under the effect of various carcinogenic factors, and some cell of local organization loses pair on gene level Its normal regulation grown, the abnormality for causing its clonal abnormality hyperplasia and being formed.The neoplastic disease number of cases in China is quite huge Greatly, there is data to show and account for the 55% of whole world case load.Tumor disease has risen to the world the 2nd " killer ", its death toll It is only second to cardiovascular disease.

Influence of the benign tumour to body is smaller, is mainly shown as local compression and obstructive symptom.Malignant tumour is due to dividing Change immature, growth comparatively fast, infiltration destroys the 26S Proteasome Structure and Function of organ, and can shift, thus body is influenceed serious.Dislike Property tumour can also have heating, intractable pain in addition to it can cause the local compression and obstructive symptom similar to above-mentioned benign tumour, Late period may occur in which seriously become thin, be weak, the state of anaemia and cachexia.

In recent years, foreign medical science bound pair had new understanding again in the pathogenesis of tumor disease on cell base. Based on being further understood to Tumorigenesis, people can be special to develop and develop using various approach, effectively kills Hinder tumour cell and to the medicine of normal cytotoxic.At present, the treatment for cancer is still using chemotherapy and radiotherapy as first choice, Though both achieve the effect of suitable at the treatment to tumour, due to lacking the specificity to tumour cell thus having larger Toxic side effect and some tumour cells chemotherapy and radiation is handled it is insensitive, therefore greatly limit they Application in clinic.In recent years, cancer cell can specifically be killed and to the medicine of normal cytotoxic negative interaction to develop Thing, people are paid much attention to by the pathogenesis of cancer from the research on cell, molecular level and huge investment.For example, " knot The carcinoma of the rectum "（CRC）Always there is the title of " rich man's disease " in tumour, showing the habits and customs of itself and people has close contact. In Shanghai, with the improvement of living standards, the incidence of disease of colorectal cancer has leapt to the second of common cancer, is only second to lung Cancer.According to Tumor Hispital Attached to Fudan Univ statistics, surgery for colorectal carcinoma amount rose year after year in recent years, and institute knot is straight within 2007 Nearly 900 of intestinal cancer amount for surgical, has broken through thousand in 2008, has reached 1027.Develop can specifically killing tumor cell and Medicine or compound to normal cytotoxic side effect are always the focus of this area.

The content of the invention

The technical problem to be solved in the present invention is to provide a kind of nucleic acid point for being used to suppress cell in vitro CTL4 gene expressions Son.Suppress the expression of external CTL4 genes by preparing, using the nucleic acid molecules, target cell normal physiological is maintained so as to reach The effect of state.

The invention provides a kind of new nucleic acid molecules, and it has the activity for suppressing cell in vitro CTL4 gene expressions；

And

Its object component suppressed includes the sequence shown in SEQ ID NO 1.

Preferably, object component has the sequence shown in SEQ ID NO 1.

Present invention also offers a kind of recombinant vector, and it includes above-mentioned nucleic acid molecules.

Wherein, A, T, G and C are adenylic acid, thymidylic acid, guanylic acid and cytimidine core respectively Thuja acid.

In the present invention, term " CTL4HSH2 " refers to the target element for suppressing blood vessel CTL4 expression activities and suppressing Part includes the nucleic acid molecules of sequence shown in SEQ ID NO 1.Sequence of the term also including object component and SEQ ID NO 1 Homology at least 90% nucleic acid molecules.

The term be additionally included in object component 5 ' and/or 3 ' end addition it is several (be usually 5 within, preferably 3 with It is interior) nucleotides, or 3 ' some dT of end addition（AZT）The sequence formed afterwards.

In the present invention, various carriers known in the art, such as commercially available carrier can be selected.Such as from commercially available load Body, then expression regulation sequence will be operably coupled to containing the DNA sequence dna corresponding to CTL4HSH2 of the present invention, weight can be formed Group carrier.It is for instance possible to use slow virus, adenovirus or russian spring-summer encephalitis virus expression system (Semliki Forest Virus).Slow virus（Lentivirus）Belong to retrovirus subgenus, with human immunodeficiency virus (human immunod Efficiency virus, HIV) it is representative.Slow virus not only has infection division target cell and integrated in its genome, especially It is a variety of nondividings including neuronal cell, macrophage, liver cell, cardiac muscle cell and stem cell etc. with infection Cell ability, thus, the slow virus carrier effective tool as gene transfer, it is widely used in gene function especially base Because of the research for the treatment of.

On the other hand, the invention provides a kind of kit for suppressing cell in vitro CTL4 gene expressions, it includes above-mentioned Nucleic acid molecules.

Preferably, the sequence of described nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.

For example, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2.

Or it has nucleic acid molecules of the sequence as shown in SEQ ID NO 3.

Preferably, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2 and SEQ ID NO 3.

Present invention also offers the preparation method of mentioned reagent box, including prepare sequence such as SEQ ID NO 2 or SEQ The step of nucleic acid molecules shown in ID NO 3：Nucleic acid molecules as shown in SEQ ID NO 2 or SEQ ID NO 3 are according to it Sequence is artificial synthesized；Nucleotide sequence is pressed, by each ribonucleic acid molecule successively dehydrating condensation.

Or using enzymatic cleavage methods, and connected after each function element is prepared respectively.

The third aspect, the invention provides a kind of method for suppressing cell in vitro CTL4 gene expressions, i.e., upper nucleic acid molecules Pass through appropriate medium transfection in vitro cell.

For example, adding the culture medium of cell in vitro, or pass through carrier（Including virus carrier system）Transfect target cell.

Specifically, this method can include：

（1）Amplifier nucleic acid molecule；

（2）Build the expression vector containing nucleic acid molecules；

（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.

Present invention also offers above-mentioned nucleic acid molecule, preparing suppression, cell in vitro --- especially tumour is thin The application of the medicament of born of the same parents --- propagation.Test result indicates that CTL4HSH2 of the invention can substantially suppress CTL4 expression.Experiment Prove, CTL4（NCBI gene I/Ds 80736）, also can be right with important immune system biological function, but in some cases Body causes to damage, and causes allergic disease or immunity disease.Suppress CTL4 expression in the cell for limiting scope, Its caused radical response can be effectively controlled, safeguards the normal physiological activity of body.

Nucleic acid molecules of the present invention and the like, when being administered (administration) in the treatment, it is possible to provide different effects Fruit.Generally, these materials can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH 5-8 is ordinarily be about, preferably pH is about 6-8, although pH value can have with the property and illness to be treated that are formulated material Changed.The pharmaceutical composition prepared can be administered by conventional route, including (but being not limited to)：Intramuscular, Intraperitoneal, subcutaneous, intracutaneous or part administration.

By taking the nucleic acid molecules of the present invention as an example, itself and suitable pharmaceutically acceptable carrier can be combined.This kind of medicine Compositions contain the compound and pharmaceutically acceptable carrier or excipient of therapeutically effective amount.This kind of carrier is included (but simultaneously It is not limited to)：Salt solution, buffer solution, glucose, water, glycerine, ethanol, and combinations thereof.Pharmaceutical preparation should match with administering mode. The nucleic acid molecules of the present invention can be made into injection form, such as with physiological saline or water-soluble containing glucose and other assistant agents Liquid is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc, it can be prepared by conventional method. Pharmaceutical composition such as injection, solution, tablet and capsule preferably aseptically manufacture.The dosage of active component is that treatment is effective Amount, such as the mg/kg body weight of about 1 microgram/kg body weight-about 10 daily.In addition, the present invention's can also be with other therapeutic agents one Rise and use.

When the nucleic acid molecules of the present invention are used as medicine, the polypeptide for the treatment of effective dose can be applied to lactation and moved Thing, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and in most cases it is no more than about 8 millis G kg body weight, preferably the dosage is the mg/kg body weight of about 10 micrograms/kg body weight-about 1.Certainly, specific dosage is also The factors such as method of administration, patient health situation are considered as, within the scope of these are all skilled practitioners technical ability.In the present invention, institute The pharmaceutical composition that the medicament stated is made up of the nucleic acid molecules containing effective therapeutic dose and carrier pharmaceutically or excipient.

The invention provides a kind of nucleic acid molecules, and it has the activity for suppressing cell in vitro CTL4 gene expressions；And its The object component of suppression includes the sequence shown in SEQ ID NO 1.The invention provides the load of the restructuring containing the nucleic acid molecules Body, a kind of kit for suppressing cell in vitro CTL4 gene expressions is additionally provided, it includes above-mentioned nucleic acid molecules；Described nucleic acid The sequence of molecule is as shown in SEQ ID NO 2 or SEQ ID NO 3.Present invention also offers the nucleic acid and preparation method and Using.Experiment shows that nucleic acid molecules of the invention can suppress the expression quantity of cell in vitro CTL4 genes at least 45%.

Embodiment

Embodiment 1 designs, screens CTL4 suppression molecules

Suppress molecule using GTCCTCTTCCTGCTCTTCATT in CTL4 sequences (SED ID NO 1) as target sieving, sequence is 5'-ACCTCGTCCTCTTCCTGCTCTTCATTTCAAGAGAATGAAGAGCAGGAAGAGGA CTT-3'(SED ID NO 2) or Person 5'-CAAAAAGTCCTCTTCCTGCTCTTCATTCTCTTGAAATGAAGAGCAGGAAGAGG ACG-3'(SED ID NO 3) Nucleic acid molecules as CTL4 candidate inhibitors, referred to as CTL4HSH2.

Kind 293T cells plant plate density 2*10 in 24 orifice plates⁴/ hole.

The 24h after kind of plate（Hour）, 72h, 120h repeat transfection CTL4HSH2 fragments, with Opti-MEM（Opti-MEM I Reduced Serum Medium, invitrogen companies, 31985-070）Dissolved for solvent, final concentration is reached 40nM.Turn Transfection reagent uses lipofectamin2000（11668-027, invitrogene company）.

24h, 72h, 120h vitellophag after being transfected in first time, collect 72h and 120h parts（5*10⁴）Cell sample. Western is detected, antibody Nogo (N-18) SC-11027 (santa cruz companies) CTL4 intrinsic protein expressions Change.

Conclusion：With siRNA feminine gender fragments NS（Target replaces with GCCCTTCATTCTTCGCTCTTT, SEQ ID NO 4） Compare, 5'-ACCTCGTCCTCTTCCTGCTCTTCATTTCAAGAGAATGAAGAGCAGGAAGAGGA CTT-3' or 5'- 72h is visible after CAAAAAGTCCTCTTCCTGCTCTTCATTCTCTTGAAATGAAGAGCAGGAAGAGGACG -3' transfections CTL4 protein expression levels lower at least 50%.This explanation, CTL4HSH2 of the invention can substantially suppress CTL4.

Embodiment 2 is tested to the cell-based screening of the consumption of CTL4 gene expressions

Experimental procedure：

Kind 293T cells（Purchased from Chinese Academy of Sciences's cell bank）In 96 orifice plates, plate density 0.8*10 is planted⁴/ hole.

CTL4HSH2 lentivirus will be carried after 24h（Slow virus, Ji Kai companies）Transduce into cell.Lentivirus Titre is 106TU/ul, and it is 100 to take MOI, i.e., 80ul virus liquids are added per hole.Specific transduction method is as follows：

50ul fresh cultures are changed to every hole cell（PH7.0）, appropriate virus liquid is added, adds 50ul cultures after 7-8h per hole Base.Liquid is changed after 24h.48-72h observes GFP（Green fluorescence）Fluorescence, detect transduction efficiency.

By cell expansion culture, GFP green fluorescence sortings are carried out to cell using flow cytometry, filter out viral transduction Positive cell, and detect its positive rate.

Western detects the change of the CTL4 intrinsic protein expressions of positive cell and negative cells.

Conclusion：

A. 48h observes GFP fluorescence, and positive rate is about 50%, illustrates that viral transduction experimental method is correct.

B. flow cytometry sorting transducer cell, the transduction rate of positive group and negative group are all higher than 90%（Flow cytometer Display data）.

C. Western detects positive cell CTL4 protein expression levels and substantially reduced compared with negative cells.

Shadows of the Flow cytometry CTL4HSH2 of embodiment 3 to people's normal colon epithelial cells HCoEpiC survival rate Ring

HcoEpiC cells from people's normal colon epithelial cells（Purchased from ATCC）By 5 × 10⁴The density inoculation of individual cells/well 12 orifice plates, transfection CTL4HSH2 or control after culture is allowed to adherent for 24 hours, transfection method is the same as embodiment 1.After overnight incubation Add 5 FU 5 fluorouracil.After 24 h, pancreatin digestion, cell is collected by centrifugation, abandons supernatant, and cell is cleaned twice with precooling PBS, It is resuspended in the PBS containing 50 μ g/ml PI (Sigma companies).After lucifuge is incubated at room temperature 15 min, Flow cytometry.

As a result show：Transfect 5'-CAAAAAGTCCTCTTCCTGCTCTTCATTCTCTTGAAATGAAGAGCAGGAAGAGG ACG-3' HcoEpiC cells improve more than 20% compared to the HcoEpiC cell survival rates for transfecting negative fragment, transfect 5'- ACCTCGTCCTCTTCCTGCTCTTCATTTCAAGAGAATGAAGAGCAGGAAGAGGACTT -3' HcoEpiC cells are compared More than 30% is improved in the HcoEpiC cell survival rates for transfecting negative fragment.Conclusion:CTL4HSH2 can improve colon cell pair Chemotherapeutics, such as the tolerance of 5 FU 5 fluorouracil.

SEQUENCE LISTING

<110>Fudan University

<120>Nucleic acid molecules CTL4HSH2, its preparation method and application

<130> 201602

<160> 4

<170> PatentIn version 3.1

<210> 1

<211> 21

<212> DNA

<213> Artificial

<400> 1

gtcctcttcc tgctcttcat t 21

<210> 2

<211> 56

<212> DNA

<213> Artificial

<400> 2

acctcgtcct cttcctgctc ttcatttcaa gagaatgaag agcaggaaga ggactt 56

<210> 3

<211> 56

<212> DNA

<213> Artificial

<400> 3

caaaaagtcc tcttcctgct cttcattctc ttgaaatgaa gagcaggaag aggacg 56

<210> 4

<211> 21

<212> DNA

<213> Artificial

<400> 4

gcccttcatt cttcgctctt t 21

Claims (10)

1. a kind of nucleic acid molecules, it is characterised in that it has the activity for suppressing cell in vitro CTL4 gene expressions；

And

Its object component suppressed includes the sequence shown in SEQ ID NO 1.

2. a kind of nucleic acid molecules as claimed in claim 1, it is characterised in that object component has shown in SEQ ID NO 1 Sequence.

3. a kind of recombinant vector, it is characterised in that it includes nucleic acid molecules as claimed in claim 1.

4. a kind of kit for suppressing cell in vitro CTL4 gene expressions, it is characterised in that it includes the core described in claim 1 Acid molecule；

The sequence of described nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.

5. a kind of kit as claimed in claim 4, it is characterised in that it has core of the sequence as shown in SEQ ID NO 2 Acid molecule.

6. a kind of kit as claimed in claim 4, it is characterised in that it has core of the sequence as shown in SEQ ID NO 3 Acid molecule.

7. a kind of kit as claimed in claim 4, it is characterised in that it has sequence such as SEQ ID NO 2 and SEQ ID Nucleic acid molecules shown in NO 3.

8. the preparation method of any one kit in claim 4-7, it is characterised in that described preparation method includes preparing The step of nucleic acid molecules of the sequence as shown in SEQ ID NO 2 or SEQ ID NO 3：Such as SEQ ID NO 2 or SEQ ID Nucleic acid molecules shown in NO 3 are artificial synthesized according to its sequence.

A kind of 9. method for suppressing cell in vitro CTL4 gene expressions, it is characterised in that by the nucleic acid molecules described in claim 1 Pass through appropriate medium transfection in vitro cell.

10. the application of nucleic acid molecules described in claim 1, it is characterised in that suppress external thin in preparation including the nucleic acid molecules Application in terms of born of the same parents' CTL4 expression；

Described application comprises the following steps：

（1）Expand the nucleic acid molecules in the kit described in claim 4；

（2）Build the expression vector containing the nucleic acid molecules described in claim 4 described in kit；

（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.