CN108070590A - Nucleic acid molecules CTL4HSH5, its preparation method and application - Google Patents

Nucleic acid molecules CTL4HSH5, its preparation method and application Download PDF

Info

Publication number
CN108070590A
CN108070590A CN201611003115.1A CN201611003115A CN108070590A CN 108070590 A CN108070590 A CN 108070590A CN 201611003115 A CN201611003115 A CN 201611003115A CN 108070590 A CN108070590 A CN 108070590A
Authority
CN
China
Prior art keywords
nucleic acid
acid molecules
seq
cell
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201611003115.1A
Other languages
Chinese (zh)
Inventor
朱波
张乐扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN201611003115.1A priority Critical patent/CN108070590A/en
Publication of CN108070590A publication Critical patent/CN108070590A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention belongs to cell biologies and field of medicaments.The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions;And its object component inhibited includes the sequence shown in SEQ ID NO 1.The present invention provides the recombinant vectors containing the nucleic acid molecules, additionally provide a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules;The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the preparation method and application of the nucleic acid.Experiment shows that nucleic acid molecules of the invention can inhibit the expression quantity of cell in vitro CTL4 genes at least 45%.

Description

Nucleic acid molecules CTL4HSH5, its preparation method and application
Technical field
The invention belongs to cell biologies and field of medicaments, and specifically, the present invention relates to a kind of nucleic acid molecules and its systems Preparation Method and application.
Background technology
It is body under the effect of various carcinogenic factors prior art discloses tumour, some cell of local organization is in base Because losing the normal regulation to its growth in level, the abnormality for causing its clonal abnormality hyperplasia and being formed.China swells Knurl case load is quite huge, has data to show and accounts for the 55% of whole world case load.Tumor disease has risen to the world the 2nd and " has killed Hand ", death toll is only second to cardiovascular disease.
Influence of the studies have shown that benign tumour to body is smaller, is mainly shown as local compression and obstructive symptom.It is pernicious swollen For knurl due to breaking up immature, growth comparatively fast, infiltration destroys the 26S Proteasome Structure and Function of organ, and can shift, thus to body shadow It rings serious.Malignant tumour can also have fever, stupid in addition to it can cause the local compression and obstructive symptom similar to above-mentioned benign tumour Solidity pain, late period may occur in which seriously become thin, be weak, the state of anaemia and cachexia.
In recent years, foreign medical science bound pair has new understanding in the pathogenesis of tumor disease on cell base.It is based on Tumorigenesis is further understood, people can be special to develop and develop using various approach, and effectively killing is swollen Oncocyte and to the avirulent drug of normal cell.At present, for cancer treatment still using chemotherapy and radiotherapy as first choice, the two Though is achieved to the treatment of tumour, due to lacking to the specific thus secondary with larger poison of tumour cell the effect of suitable Effect and some tumour cells handle chemotherapy and radiation insensitive, therefore greatly limit them in clinic In application.In recent years, cancer cell can specifically be killed and to drug of the normal cell without toxic side effect to develop, People are paid much attention to by the pathogenesis of cancer from the research on cell, molecular level and huge investment.For example, " knot is straight Intestinal cancer "(CRC)Always there is the title of " rich people's disease " in tumour, show that it has close contact with people’s lives custom. The second of common cancer has been leapt in Shanghai, with the improvement of living standards, the incidence of colorectal cancer, is only second to lung Cancer.According to Tumor Hispital Attached to Fudan Univ statistics, surgery for colorectal carcinoma amount rose year after year in recent years, and institute knot is straight within 2007 Nearly 900 of intestinal cancer amount for surgical, has broken through thousand in 2008, has reached 1027.Develop can specifically killing tumor cell and The drug or compounds that have no toxic side effect to normal cell are always the hot spot of this field.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of for inhibiting the nucleic acid of cell in vitro CTL4 gene expressions point Son.Inhibit the expression of external CTL4 genes by preparing, using the nucleic acid molecules, target cell normal physiological is maintained so as to reach The effect of state.
The present invention provides a kind of new nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions;
And
Its object component inhibited includes the sequence shown in SEQ ID NO 1.
Preferably, object component has the sequence shown in SEQ ID NO 1.
The present invention also provides a kind of recombinant vectors, it includes above-mentioned nucleic acid molecules.
Wherein, A, T, G and C are adenylic acid, thymidylic acid, guanylic acid and cytimidine core respectively Thuja acid.
In the present invention, term " CTL4HSH5 " refers to the target element for inhibiting blood vessel CTL4 expression activities and inhibiting Part includes the nucleic acid molecules of sequence shown in SEQ ID NO 1.The term further includes the sequence of object component and SEQ ID NO 1 Homology at least 90% nucleic acid molecules.
The term be additionally included in object component 5 ' and/or 3 ' end addition it is several (be usually 5 within, preferably 3 with It is interior) nucleotide or 3 ' end adds in several dT(Deoxythymidine)The sequence formed afterwards.
In the present invention, various carriers known in the art, such as commercially available carrier can be selected.For example, select commercially available load Then body will be operably coupled to expression regulation sequence containing the DNA sequence dna corresponding to CTL4HSH5 of the present invention, can form weight Group carrier.For example, slow virus, adenovirus or russian spring-summer encephalitis virus expression system (Semliki Forest may be employed Virus).Slow virus(Lentivirus)Belong to retrovirus subgenus, with human immunodeficiency virus (human immunod Efficiency virus, HIV) it is representative.Slow virus not only has infection division target cell and integrates in its genome, especially It is a variety of nondividings including neuronal cell, macrophage, liver cell, cardiac muscle cell and stem cell etc. with infection Cell ability, thus, the slow virus carrier effective tool as gene transfer is widely used in gene function especially base Because of the research for the treatment of.
On the other hand, the present invention provides a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned Nucleic acid molecules.
Preferably, the sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.
For example, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2.
Alternatively, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 3.
Preferably, it has nucleic acid molecules of the sequence as shown in SEQ ID NO 2 and SEQ ID NO 3.
The present invention also provides the preparation method of mentioned reagent box, including preparing sequence such as SEQ ID NO 2 or SEQ The step of nucleic acid molecules shown in ID NO 3:Nucleic acid molecules as shown in SEQ ID NO 2 or SEQ ID NO 3 are according to it Sequence is artificial synthesized;I.e. by nucleotide sequence, by each ribonucleic acid molecule successively dehydrating condensation.
Alternatively, it is connected after being prepared respectively using enzymatic cleavage methods and by each function element.
The third aspect, the present invention provides a kind of method for inhibiting cell in vitro CTL4 gene expressions, i.e., upper nucleic acid molecules Pass through appropriate medium transfection in vitro cell.
For example, it adds in the culture medium of cell in vitro or passes through carrier(Including virus carrier system)Transfect target cell.
Specifically, this method can include:
(1)Amplifier nucleic acid molecule;
(2)Build the expression vector containing nucleic acid molecules;
(3)By step(2)The expression vector of acquisition is transferred to target cell in vitro.
The present invention also provides above-mentioned nucleic acid molecule, preparing inhibition, cell in vitro --- especially tumour is thin The application of the medicament of born of the same parents --- multiplication.The experimental results showed that CTL4HSH5 of the invention can substantially inhibit the expression of CTL4.Experiment It proves, CTL4(NCBI gene I/Ds 80736)It, also can be right with important immune system biological function, but in some cases Body causes to damage, and causes allergic disease or immunity disease.Inhibit the expression of CTL4 in the cell for limiting scope, Its caused radical response can be effectively controlled, safeguards the normal physiological activity of body.
Nucleic acid molecules of the present invention and the like, when being administered (administration) in the treatment, it is possible to provide different effects Fruit.In general, these substances can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH 5-8 ordinarily is about, preferably pH is about 6-8, although pH value can have with the property and illness to be treated that are formulated substance Changed.Prepared pharmaceutical composition can be administered by conventional route, including (but being not limited to):Intramuscular, Peritonaeum is interior, subcutaneous, intracutaneous or local administration.
By taking the nucleic acid molecules of the present invention as an example, itself and suitable pharmaceutically acceptable carrier can be combined.This kind of medicine Compositions contain the compound of therapeutically effective amount and pharmaceutically acceptable carrier or excipient.This kind of carrier is included (but simultaneously It is not limited to):Brine, buffer solution, glucose, water, glycerine, ethyl alcohol, and combinations thereof.Pharmaceutical preparation should match with administering mode. The nucleic acid molecules of the present invention can be made into injection form, such as with physiological saline or water-soluble containing glucose and other assistant agents Liquid is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc can be prepared by conventional method. Pharmaceutical composition such as injection, solution, tablet and capsule preferably aseptically manufacture.The dosage of active ingredient is that treatment is effective Amount, such as the mg/kg weight of about 1 microgram/kg body weight-about 10 daily.In addition, the present invention's can also be with other therapeutic agents one It rises and uses.
When the nucleic acid molecules of the present invention are used as drug, the polypeptide for the treatment of effective dose can be applied to lactation and moved Object, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and in most cases it is no more than about 8 millis G kg weight, preferably the dosage is the mg/kg weight of about 10 micrograms/kg body weight-about 1.Certainly, specific dosage is also The factors such as administration route, patient health situation are considered as, within the scope of these are all skilled practitioners technical ability.In the present invention, institute The pharmaceutical composition that the medicament stated is made of the nucleic acid molecules containing effective therapeutic dose and carrier pharmaceutically or excipient.
The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions;And its The object component of inhibition includes the sequence shown in SEQ ID NO 1.The present invention provides the restructuring loads containing the nucleic acid molecules Body, additionally provides a kind of kit for inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules;The nucleic acid The sequence of molecule is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the nucleic acid and preparation method and Using.Experiment shows that nucleic acid molecules of the invention can inhibit the expression quantity of cell in vitro CTL4 genes at least 45%.
Specific embodiment
Embodiment 1 designs, screens CTL4 inhibition molecules
Inhibit molecule, sequence using GCATCCTGTCCAGCAACATCA in CTL4 sequences (SED ID NO 1) as target sieving For 5'-ACCTCGCATCCTGTCCAGCAACATCATCAAGAGTGATGTTGCTGGACAGGATG CTT-3'(SED ID NO Or 5'-CAAAAAGCATCCTGTCCAGCAACATCACTCTTGATGATGTTGCTGGACAGGAT GCG-3'(SED ID 2) NO 3) nucleic acid molecules as CTL4 candidate inhibitors, be known as CTL4HSH5.
Kind 293T cells plant plate density 2*10 in 24 orifice plates4/ hole.
After kind of plate for 24 hours(Hour), 72h, 120h repeat transfection CTL4HSH5 segments, with Opti-MEM(Opti-MEM I Reduced Serum Medium, invitrogen companies, 31985-070)It is dissolved for solvent, final concentration is made to reach 40nM.Turn Transfection reagent uses lipofectamin2000(11668-027, invitrogene company).
In first time transfect after for 24 hours, 72h, 120h vitellophag, collect 72h and 120h parts(5*104)Cell sample. Western is detected, antibody Nogo (N-18) SC-11027 (santa cruz companies) CTL4 intrinsic protein expressions Variation.
Conclusion:With siRNA feminine gender segments NS(Target replaces with GCCTTACGAACCCGTCCTAAA, SEQ ID NO 4) Compare, 5'-ACCTCGCATCCTGTCCAGCAACATCATCAAGAGTGATGTTGCTGGACAGGATG CTT-3' or 5'- 72h, that is, visible after CAAAAAGCATCCTGTCCAGCAACATCACTCTTGATGATGTTGCTGGACAGGATGCG -3' transfections CTL4 protein expression levels lower at least 50%.This explanation, CTL4HSH5 of the invention can substantially inhibit CTL4.
Embodiment 2 tests the cell-based screening of the consumption of CTL4 gene expressions
Experimental procedure:
Kind 293T cells(Purchased from Chinese Academy of Sciences's cell bank)In 96 orifice plates, plate density 0.8*10 is planted4/ hole.
The lentivirus of CTL4HSH5 will be carried afterwards for 24 hours(Slow virus, Ji Kai companies)It transduces into cell.Lentivirus Titre is 106TU/ul, and it is 100 to take MOI, i.e., 80ul virus liquids are added in per hole.Specific transduction method is as follows:
50ul fresh cultures are changed to every hole cell(PH7.0), appropriate virus liquid is added in, adds 50ul cultures after 7-8h per hole Base.Change liquid afterwards for 24 hours.48-72h observes GFP(Green fluorescence)Fluorescence detects transduction efficiency.
By cell expansion culture, GFP green fluorescence sortings are carried out to cell using flow cytometry, filter out viral transduction Positive cell, and detect its positive rate.
Western detects the variation of the CTL4 intrinsic protein expressions of positive cell and negative cells.
Conclusion:
A. 48h observes GFP fluorescence, and positive rate is about 50%, illustrates that viral transduction experimental method is correct.
B. flow cytometry sorting transducer cell, positive group and the transduction rate of negative group are all higher than 90%(Flow cytometer Display data).
C. Western detects positive cell CTL4 protein expression levels and is substantially reduced compared with negative cells.
3 Flow cytometry CTL4HSH5 of embodiment is to the shadow of the survival rate of people's normal colon epithelial cells HCoEpiC It rings
HcoEpiC cells from people's normal colon epithelial cells(Purchased from ATCC)By 5 × 104The density inoculation of a cells/well 12 orifice plates, transfection CTL4HSH5 or control culture 24 is allowed to adherent when small after, transfection method is the same as embodiment 1.After overnight incubation Add in 5 FU 5 fluorouracil.After 24 h, pancreatin digestion is collected by centrifugation cell, abandons supernatant, and cleans cell twice with precooling PBS, It is resuspended in the PBS containing 50 μ g/ml PI (Sigma companies).After being protected from light 15 min of incubation at room temperature, Flow cytometry.
The results show:Transfect 5'-CAAAAAGCATCCTGTCCAGCAACATCACTCTTGATGATGTTGCTGGACAGGAT The HcoEpiC cells of GCG-3' improve more than 20% compared to the HcoEpiC cell survival rates of the negative segment of transfection, transfect 5'- The HcoEpiC cells of ACCTCGCATCCTGTCCAGCAACATCATCAAGAGTGATGTTGCTGGACAGGATGCTT -3' are compared More than 30% is improved in the HcoEpiC cell survival rates of the negative segment of transfection.Conclusion:CTL4HSH5 can improve colon cell pair Chemotherapeutics, such as the tolerance of 5 FU 5 fluorouracil.
SEQUENCE LISTING
<110>Fudan University
<120>Nucleic acid molecules CTL4HSH5, its preparation method and application
<130> 201605
<160> 4
<170> PatentIn version 3.1
<210> 1
<211> 21
<212> DNA
<213> Artificial
<400> 1
gcatcctgtc cagcaacatc a 21
<210> 2
<211> 56
<212> DNA
<213> Artificial
<400> 2
acctcgcatc ctgtccagca acatcatcaa gagtgatgtt gctggacagg atgctt 56
<210> 3
<211> 56
<212> DNA
<213> Artificial
<400> 3
caaaaagcat cctgtccagc aacatcactc ttgatgatgt tgctggacag gatgcg 56
<210> 4
<211> 21
<212> DNA
<213> Artificial
<400> 4
gccttacgaa cccgtcctaa a 21

Claims (10)

1. a kind of nucleic acid molecules, which is characterized in that it has the activity for inhibiting cell in vitro CTL4 gene expressions;
And
Its object component inhibited includes the sequence shown in SEQ ID NO 1.
2. a kind of nucleic acid molecules as described in claim 1, which is characterized in that object component has shown in SEQ ID NO 1 Sequence.
3. a kind of recombinant vector, which is characterized in that it includes nucleic acid molecules as described in claim 1.
4. a kind of kit for inhibiting cell in vitro CTL4 gene expressions, which is characterized in that it includes core described in claim 1 Acid molecule;
The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.
5. a kind of kit as claimed in claim 4, which is characterized in that it has core of the sequence as shown in SEQ ID NO 2 Acid molecule.
6. a kind of kit as claimed in claim 4, which is characterized in that it has core of the sequence as shown in SEQ ID NO 3 Acid molecule.
7. a kind of kit as claimed in claim 4, which is characterized in that it has sequence such as SEQ ID NO 2 and SEQ ID Nucleic acid molecules shown in NO 3.
8. the preparation method of any one kit in claim 4-7, which is characterized in that the preparation method includes preparing The step of nucleic acid molecules of the sequence as shown in SEQ ID NO 2 or SEQ ID NO 3:Such as SEQ ID NO 2 or SEQ ID Nucleic acid molecules shown in NO 3 are artificial synthesized according to its sequence.
A kind of 9. method for inhibiting cell in vitro CTL4 gene expressions, which is characterized in that by nucleic acid molecules described in claim 1 Pass through appropriate medium transfection in vitro cell.
10. the application of nucleic acid molecules described in claim 1, which is characterized in that inhibit external thin in preparation including the nucleic acid molecules Application in terms of born of the same parents' CTL4 expression;
The application comprises the following steps:
(1)Expand the nucleic acid molecules in the kit described in claim 4;
(2)Build the expression vector containing the nucleic acid molecules described in claim 4 described in kit;
(3)By step(2)The expression vector of acquisition is transferred to target cell in vitro.
CN201611003115.1A 2016-11-15 2016-11-15 Nucleic acid molecules CTL4HSH5, its preparation method and application Pending CN108070590A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611003115.1A CN108070590A (en) 2016-11-15 2016-11-15 Nucleic acid molecules CTL4HSH5, its preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611003115.1A CN108070590A (en) 2016-11-15 2016-11-15 Nucleic acid molecules CTL4HSH5, its preparation method and application

Publications (1)

Publication Number Publication Date
CN108070590A true CN108070590A (en) 2018-05-25

Family

ID=62162652

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611003115.1A Pending CN108070590A (en) 2016-11-15 2016-11-15 Nucleic acid molecules CTL4HSH5, its preparation method and application

Country Status (1)

Country Link
CN (1) CN108070590A (en)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NABOKINA SM ET AL: "Homo sapiens solute carrier family 44 member 4(SLC44A4), transcript variant 1,mRNA", 《NCBI REFERENCE SEQUENCE:NM_025257.2》 *
PINGFANG SONG ET AL: "Choline transporter-like protein 4 (CTL4) links to non-neuronal acetylcholine synthesis", 《J NEUROCHEM》 *

Similar Documents

Publication Publication Date Title
CN109837306A (en) Contain the excretion body and its preparation method and application of miRNA-204-5p
CN108070590A (en) Nucleic acid molecules CTL4HSH5, its preparation method and application
CN108118053A (en) Nucleic acid molecules CTL4HSH16, its preparation method and application
CN108118052A (en) Nucleic acid molecules CTL4HSH17, its preparation method and application
CN108070591A (en) Nucleic acid molecules CTL4HSH4, its preparation method and application
CN108315329A (en) Nucleic acid molecules CTL4HSH13, preparation method and application
CN108330128A (en) Nucleic acid molecules CTL4HSH10, preparation method and application
CN108070589A (en) Nucleic acid molecules CTL4HSH9, its preparation method and application
CN108070588A (en) Nucleic acid molecules CTL4HSH8, its preparation method and application
CN107955812A (en) Nucleic acid molecules CTL4HSH19, its preparation method and application
CN107955811A (en) Nucleic acid molecules CTL4HSH15, its preparation method and application
CN107955813A (en) Nucleic acid molecules CTL4HSH14, its preparation method and application
CN107881170A (en) Nucleic acid molecules CTL4HSH11, its preparation method and application
CN107868782A (en) Nucleic acid molecules CTL4HSH3, its preparation method and application
CN107881171A (en) Nucleic acid molecules CTL4HSH12, its preparation method and application
CN107841500A (en) Nucleic acid molecules CTL4HSH18, its preparation method and application
CN107841501A (en) Nucleic acid molecules CTL4HSH20, its preparation method and application
CN107868783A (en) Nucleic acid molecules CTL4HSH2, its preparation method and application
CN107841502A (en) Nucleic acid molecules CTL4HSH1, its preparation method and application
CN100430412C (en) Nucleic acid molecule RTN4BSR6 and application for preparation of anti-cancer drugs
CN100510071C (en) Nucleic acid molecule RTN4BSR3 and application thereof in preparing anticancer medicine
CN100503825C (en) Nucleic acid molecule RTN4BSR4 and its application in preparing anticancer medicine
CN101643729B (en) Nucleic acid molecule NRN1SR22 and application thereof in preparation of anticancer medicaments
CN101007836A (en) Nucleic acid molecule RTN4BSR52 and its application in preparing anticancer medicine
CN101328475B (en) Nucleic acid molecule NRN1SR11 and use thereof in anti-cancer medicine preparation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180525