CN108330128A - Nucleic acid molecules CTL4HSH10, preparation method and application - Google Patents
Nucleic acid molecules CTL4HSH10, preparation method and application Download PDFInfo
- Publication number
- CN108330128A CN108330128A CN201710031964.6A CN201710031964A CN108330128A CN 108330128 A CN108330128 A CN 108330128A CN 201710031964 A CN201710031964 A CN 201710031964A CN 108330128 A CN108330128 A CN 108330128A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid molecules
- seq
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Abstract
The invention belongs to cell biologies and field of medicaments.The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；And its object component inhibited includes sequence shown in SEQ ID NO 1.The present invention provides the recombinant vectors containing the nucleic acid molecules, additionally provide a kind of kit inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules；The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the preparation method and application of the nucleic acid.
Description
Technical field
The invention belongs to cell biologies and field of medicaments, specifically, the present invention relates to a kind of nucleic acid molecules and its systems
Preparation Method and application.
Background technology
Tumour is body under the effect of various carcinogenic factors, and some cell of local organization loses pair at the genetic level
The normal regulation of growth leads to its clonal abnormality hyperplasia and the abnormality that is formed.The neoplastic disease number of cases in China is quite huge
Greatly, there is data to show and account for the 55% of whole world case load.Tumor disease has risen to the world the 2nd " killer ", death toll
It is only second to cardiovascular disease.
Influence of the benign tumour to body is smaller, is mainly shown as local compression and obstructive symptom.Malignant tumour is due to dividing
Change immature, growth comparatively fast, infiltration destroys the structure and function of organ, and can shift, thus is influenced on body serious.It dislikes
Property tumour can also have fever, intractable pain in addition to it can cause local compression similar with above-mentioned benign tumour and obstructive symptom,
Late period may occur in which seriously become thin, be weak, the state of anaemia and cachexia.
In recent years, foreign medical science bound pair had new understanding again in the pathogenesis of tumor disease on cell base.
Based on being further understood to Tumorigenesis, people are developed and developed using various approach can be special, effectively kills
Hinder tumour cell and to the avirulent drug of normal cell.Currently, the treatment for cancer is still first choice with chemotherapy and radiotherapy,
Though the two achieves suitable curative effect to the treatment of tumour, due to lacking the specificity to tumour cell thus having larger
Toxic side effect and certain tumour cells chemotherapy and radiation is handled it is insensitive, therefore greatly limit they
Application in clinic.In recent years, cancer cell can specifically be killed and to medicine of the normal cell without toxic side effect to develop
Object, people are paid much attention to from the research on cell, molecular level to the pathogenesis of cancer and huge investment.For example, " knot
The carcinoma of the rectum "（CRC）The title for always having " rich people's disease " in tumour shows that it has close contact with people’s lives custom.
In Shanghai, with the improvement of living standards, the incidence of colorectal cancer has leapt to the second of common cancer, is only second to lung
Cancer.According to Tumor Hispital Attached to Fudan Univ statistics, surgery for colorectal carcinoma amount rose year after year in recent years, and institute knot is straight within 2007
Nearly 900 of intestinal cancer amount for surgical, has broken through thousand in 2008, has reached 1027.Develop can specifically killing tumor cell and
The drug or compounds that have no toxic side effect to normal cell are always the hot spot of this field.
Invention content
The nucleic acid point that the technical problem to be solved in the present invention is to provide a kind of for inhibiting cell in vitro CTL4 gene expressions
Son.The expression for inhibiting external CTL4 genes by preparing, using the nucleic acid molecules maintains target cell normal physiological to reach
The effect of state.
The present invention provides a kind of new nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；
And
Its object component inhibited includes sequence shown in SEQ ID NO 1.
Preferably, object component has sequence shown in SEQ ID NO 1.
The present invention also provides a kind of recombinant vectors, it includes above-mentioned nucleic acid molecules.
Wherein, A, T, G and C are adenylic acid, thymidylic acid, guanylic acid and cytimidine core respectively
Thuja acid.
In the present invention, term " CTL4HSH10 " refers to the target element for inhibiting blood vessel CTL4 expression activities and inhibiting
Part includes the nucleic acid molecules of sequence shown in SEQ ID NO 1.The term further includes the sequence and SEQ ID NO 1 of object component
Homology at least 90% nucleic acid molecules.
The term further include object component 5 ' and/or 3 ' end addition it is several (be usually 5 within, preferably 3 with
It is interior) nucleotide or 3 ' several dT are added in end（Deoxythymidine）The sequence formed afterwards.
In the present invention, various carriers known in the art, such as commercially available carrier can be selected.For example, selecting commercially available load
Then body will be operably coupled to expression regulation sequence containing the DNA sequence dna corresponding to CTL4HSH10 of the present invention, can be formed
Recombinant vector.For example, slow virus, adenovirus or russian spring-summer encephalitis virus expression system (Semliki Forest may be used
Virus).Slow virus（Lentivirus）Belong to retrovirus subgenus, with human immunodeficiency virus (human immunod
Efficiency virus, HIV) it is representative.Slow virus not only has infection division target cell and integrates in its genome, especially
It is a variety of nondividings including neuronal cell, macrophage, liver cell, cardiac muscle cell and stem cell etc. with infection
Cell ability, thus, slow virus carrier is widely used in gene function especially base as the effective tool of gene transfer
Because of the research for the treatment of.
On the other hand, the present invention provides a kind of kit inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned
Nucleic acid molecules.
Preferably, the sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.
For example, it has sequence nucleic acid molecules as shown in SEQ ID NO 2.
Alternatively, it has sequence nucleic acid molecules as shown in SEQ ID NO 3.
Preferably, it has sequence nucleic acid molecules as shown in SEQ ID NO 2 and SEQ ID NO 3.
The present invention also provides the preparation methods of mentioned reagent box, including prepare sequence such as SEQ ID NO 2 or SEQ
Shown in ID NO 3 the step of nucleic acid molecules：Nucleic acid molecules are according to it as shown in SEQ ID NO 2 or SEQ ID NO 3
Sequence is artificial synthesized；Nucleic acid sequence is pressed, by each ribonucleic acid molecule successively dehydrating condensation.
Alternatively, using enzymatic cleavage methods, and connected after each function element is prepared respectively.
The third aspect, the present invention provides a kind of method inhibiting cell in vitro CTL4 gene expressions, i.e., upper nucleic acid molecules
Pass through medium transfection in vitro cell appropriate.
For example, the culture medium of cell in vitro is added, or pass through carrier（Including virus carrier system）Transfect target cell.
Specifically, this method may include：
（1）Amplifier nucleic acid molecule；
（2）Build the expression vector containing nucleic acid molecules；
（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.
The present invention also provides above-mentioned nucleic acid molecules, and preparing inhibition, cell in vitro --- especially tumour is thin
The application of the medicament of born of the same parents --- proliferation.The experimental results showed that CTL4HSH10 of the invention can obviously inhibit the expression of CTL4.It is real
Verify bright, CTL4（NCBI gene I/Ds 80736）With important immune system biological function, but in some cases, also may be used
Body is caused to damage, causes allergic disease or immunity disease.Inhibit the table of CTL4 in the cell for limiting range
It reaches, can effectively control its caused radical response, safeguard the normal physiological activity of body.
The nucleic acid molecules and the like of the present invention, when being administered (administration) in the treatment, it is possible to provide different effects
Fruit.In general, these substances can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH
It ordinarily is about 5-8, preferably pH is about 6-8, although pH value can have with the property and illness to be treated that are formulated substance
Changed.Prepared pharmaceutical composition can be administered by conventional route, including (but being not limited to)：Intramuscular,
Peritonaeum is interior, subcutaneous, intradermal or local administration.
By taking the nucleic acid molecules of the present invention as an example, itself and suitable pharmaceutically acceptable carrier can be combined.This kind of medicine
Compositions contain the compound and pharmaceutically acceptable carrier or excipient of therapeutically effective amount.This kind of carrier includes (but simultaneously
It is not limited to)：Brine, buffer solution, glucose, water, glycerine, ethyl alcohol, and combinations thereof.Pharmaceutical preparation should match with administering mode.
The nucleic acid molecules of the present invention can be made into injection form, such as with physiological saline or water-soluble containing glucose and other adjuvants
Liquid is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc can be prepared by conventional method.
Pharmaceutical composition such as injection, solution, tablet and capsule preferably aseptically manufacture.The dosage of active constituent is that treatment is effective
Amount, such as about 10 mg/kg weight of about 1 microgram/kg body weight-daily.In addition, the present invention's can also be with other therapeutic agents one
It rises and uses.
When the nucleic acid molecules of the present invention are used as drug, the polypeptide for the treatment of effective dose can be applied to lactation and moved
Object, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and in most cases it is no more than about 8 millis
G kg weight, preferably the dosage is about 1 mg/kg weight of about 10 micrograms/kg body weight-.Certainly, specific dosage is also
The factors such as administration route, patient health situation are considered as, within the scope of these are all skilled practitioners technical ability.In the present invention, institute
The pharmaceutical composition that the medicament stated is made of the nucleic acid molecules containing effective therapeutic dose and carrier pharmaceutically or excipient.
The present invention provides a kind of nucleic acid molecules, it has the activity for inhibiting cell in vitro CTL4 gene expressions；And its
The object component of inhibition includes sequence shown in SEQ ID NO 1.The present invention provides the recombination loads containing the nucleic acid molecules
Body additionally provides a kind of kit inhibiting cell in vitro CTL4 gene expressions, it includes above-mentioned nucleic acid molecules；The nucleic acid
The sequence of molecule is as shown in SEQ ID NO 2 or SEQ ID NO 3.The present invention also provides the nucleic acid and preparation method and
Using.Experiment shows that nucleic acid molecules of the invention can inhibit the expression quantity of cell in vitro CTL4 genes at least 45%.
Specific implementation mode
The design of embodiment 1, screening CTL4 inhibit molecule
Inhibit molecule, sequence using GTGAGAAAGTGCCAATAAATA in CTL4 sequences (SED ID NO 1) as target sieving
For 5'-ACCTCGTGAGAAAGTGCCAATAAATATCAAGAGTATTTATTGGCACTTTCTCA CTT-3'(SED ID NO
Or 5'-CAAAAAGTGAGAAAGTGCCAATAAATACTCTTGATATTTATTGGCACTTTCTC ACG-3'(SED ID 2)
NO 3) nucleic acid molecules as CTL4 candidate inhibitors, referred to as CTL4HSH10.
Kind 293T cells plant plate density 2*10 in 24 orifice plates4/ hole.
After kind of plate for 24 hours（Hour）, 72h, 120h repeat transfection CTL4HSH10 segments, with Opti-MEM（Opti-MEM
I Reduced Serum Medium, invitrogen companies, 31985-070）It is dissolved for solvent, final concentration is made to reach 40nM.
Transfection reagent uses lipofectamin2000（11668-027, invitrogene company）.
In first time transfect after for 24 hours, 72h, 120h vitellophag, collect the parts 72h and 120h（5*104）Cell sample.
Western is detected, antibody Nogo (N-18) SC-11027 (santa cruz companies) CTL4 intrinsic protein expressions
Variation.
Conclusion：With siRNA feminine gender segments NS（Target replaces with GAATCAAGTAACGGTGAAATA, SEQ ID NO 4）
Compare, 5'-ACCTCGTGAGAAAGTGCCAATAAATATCAAGAGTATTTATTGGCACTTTCTCA CTT-3' or 5'-
72h after CAAAAAGTGAGAAAGTGCCAATAAATACTCTTGATATTTATTGGCACTTTCTCACG -3' transfection, that is, visible
CTL4 protein expression levels lower at least 50%.This explanation, CTL4HSH10 of the invention can obviously inhibit CTL4.
Embodiment 2 tests the cell-based screening of the consumption of CTL4 gene expressions
Experimental procedure：
Kind 293T cells（Purchased from Cell Bank of Chinese Academy of Sciences）In 96 orifice plates, plate density 0.8*10 is planted4/ hole.
The lentivirus of CTL4HSH10 will be carried afterwards for 24 hours（Slow virus, Ji Kai companies）It transduces into cell.
Lentivirus titres are 106TU/ul, and it is 100 to take MOI, i.e., 80ul virus liquids are added per hole.Specific transduction method is as follows：
50ul fresh cultures are changed to every hole cell（PH7.0）, appropriate virus liquid is added, adds 50ul cultures after 7-8h per hole
Base.Change liquid afterwards for 24 hours.48-72h observes GFP（Green fluorescence）Fluorescence detects transduction efficiency.
By cell expansion culture, GFP green fluorescence sortings are carried out to cell using flow cytometry, filter out viral transduction
Positive cell, and detect its positive rate.
Western detects the variation of the CTL4 intrinsic protein expressions of positive cell and negative cells.
Conclusion：
A. 48h observes GFP fluorescence, and positive rate is about 50%, illustrates that viral transduction experimental method is correct.
B. flow cytometry sorts transducer cell, and positive group and the transduction rate of negative group are all higher than 90%（Flow cytometer
Display data）.
C. Western detects positive cell CTL4 protein expression levels and is substantially reduced compared with negative cells.
3 Flow cytometry CTL4HSH10 of embodiment is to the survival rate of people's normal colon epithelial cells HCoEpiC
It influences
HcoEpiC cells from people's normal colon epithelial cells（Purchased from ATCC）By 5 × 104The density of a cells/well is inoculated with
12 orifice plates, transfection CTL4HSH10 or control after culture is allowed to adherent for 24 hours, transfection method is the same as embodiment 1.After overnight incubation
5 FU 5 fluorouracil is added.After 24 h, pancreatin digestion is collected by centrifugation cell, abandons supernatant, and precooling PBS cleanings cell is used in combination twice,
It is resuspended in the PBS containing 50 μ g/ml PI (Sigma companies).After being protected from light 15 min of incubation at room temperature, Flow cytometry.
As a result it shows：Transfect 5'-CAAAAAGTGAGAAAGTGCCAATAAATACTCTTGATATTTATTGGCACTTTCTC
The HcoEpiC cells of ACG-3' improve 20% or more compared to the HcoEpiC cell survival rates of the negative segment of transfection, transfect 5'-
The HcoEpiC cells of ACCTCGTGAGAAAGTGCCAATAAATATCAAGAGTATTTATTGGCACTTTCTCACTT -3' are compared
30% or more is improved in the HcoEpiC cell survival rates of the negative segment of transfection.Conclusion:CTL4HSH10 can improve colon cell
To the tolerance of chemotherapeutics, such as 5 FU 5 fluorouracil.
SEQUENCE LISTING
<110>Fudan University
<120>Nucleic acid molecules CTL4HSH10, preparation method and application
<130> 201610
<160> 4
<170> PatentIn version 3.1
<210> 1
<211> 21
<212> DNA
<213> Artificial
<400> 1
gtgagaaagt gccaataaat a 21
<210> 2
<211> 56
<212> DNA
<213> Artificial
<400> 2
acctcgtgag aaagtgccaa taaatatcaa gagtatttat tggcactttc tcactt 56
<210> 3
<211> 56
<212> DNA
<213> Artificial
<400> 3
caaaaagtga gaaagtgcca ataaatactc ttgatattta ttggcacttt ctcacg 56
<210> 4
<211> 21
<212> DNA
<213> Artificial
<400> 4
gaatcaagta acggtgaaat a 21
Claims (10)
1. a kind of nucleic acid molecules, which is characterized in that it has the activity for inhibiting cell in vitro CTL4 gene expressions；
And
Its object component inhibited includes sequence shown in SEQ ID NO 1.
2. a kind of nucleic acid molecules as described in claim 1, which is characterized in that object component has shown in SEQ ID NO 1
Sequence.
3. a kind of recombinant vector, which is characterized in that it includes nucleic acid molecules as described in claim 1.
4. a kind of kit inhibiting cell in vitro CTL4 gene expressions, which is characterized in that it includes core described in claim 1
Acid molecule；
The sequence of the nucleic acid molecules is as shown in SEQ ID NO 2 or SEQ ID NO 3.
5. a kind of kit as claimed in claim 4, which is characterized in that it has sequence core as shown in SEQ ID NO 2
Acid molecule.
6. a kind of kit as claimed in claim 4, which is characterized in that it has sequence core as shown in SEQ ID NO 3
Acid molecule.
7. a kind of kit as claimed in claim 4, which is characterized in that it has sequence such as SEQ ID NO 2 and SEQ ID
Nucleic acid molecules shown in NO 3.
8. the preparation method of any one kit in claim 4-7, which is characterized in that the preparation method includes preparing
Sequence is as shown in SEQ ID NO 2 or SEQ ID NO 3 the step of nucleic acid molecules：Such as SEQ ID NO 2 or SEQ ID
Nucleic acid molecules shown in NO 3 are artificial synthesized according to its sequence.
9. a kind of method inhibiting cell in vitro CTL4 gene expressions, which is characterized in that by nucleic acid molecules described in claim 1
Pass through medium transfection in vitro cell appropriate.
10. the application of nucleic acid molecules described in claim 1, which is characterized in that inhibit external thin in preparation including the nucleic acid molecules
Application in terms of born of the same parents' CTL4 expression；
The application includes the following steps：
（1）Expand the nucleic acid molecules in the kit described in claim 4；
（2）Build the expression vector containing the nucleic acid molecules described in kit described in claim 4；
（3）By step（2）The expression vector of acquisition is transferred to target cell in vitro.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710031964.6A CN108330128A (en) | 2017-01-17 | 2017-01-17 | Nucleic acid molecules CTL4HSH10, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710031964.6A CN108330128A (en) | 2017-01-17 | 2017-01-17 | Nucleic acid molecules CTL4HSH10, preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108330128A true CN108330128A (en) | 2018-07-27 |
Family
ID=62921887
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710031964.6A Pending CN108330128A (en) | 2017-01-17 | 2017-01-17 | Nucleic acid molecules CTL4HSH10, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108330128A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009033094A2 (en) * | 2007-09-07 | 2009-03-12 | Agensys, Inc. | Antibodies and related molecules that bind to 24p4c12 proteins |
-
2017
- 2017-01-17 CN CN201710031964.6A patent/CN108330128A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009033094A2 (en) * | 2007-09-07 | 2009-03-12 | Agensys, Inc. | Antibodies and related molecules that bind to 24p4c12 proteins |
Non-Patent Citations (1)
| Title |
|---|
| SONG P等: "Choline transporter-like protein 4 (CTL4) links to non-neuronal acetylcholine synthesis", 《J NEUROCHEM.》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109837306A (en) | Contain the excretion body and its preparation method and application of miRNA-204-5p | |
| CN108236722B (en) | Application of IDNK inhibitor in preparation of liver cancer treatment drug | |
| CN108330128A (en) | Nucleic acid molecules CTL4HSH10, preparation method and application | |
| CN108315329A (en) | Nucleic acid molecules CTL4HSH13, preparation method and application | |
| CN1970763A (en) | Shortened anti-oncogene p53 capable of increasing sensitivity of human lung cancer cell to antineoplastics | |
| CN108118052A (en) | Nucleic acid molecules CTL4HSH17, its preparation method and application | |
| CN108118053A (en) | Nucleic acid molecules CTL4HSH16, its preparation method and application | |
| CN108070591A (en) | Nucleic acid molecules CTL4HSH4, its preparation method and application | |
| CN108070590A (en) | Nucleic acid molecules CTL4HSH5, its preparation method and application | |
| CN107955812A (en) | Nucleic acid molecules CTL4HSH19, its preparation method and application | |
| CN108070589A (en) | Nucleic acid molecules CTL4HSH9, its preparation method and application | |
| CN107881170A (en) | Nucleic acid molecules CTL4HSH11, its preparation method and application | |
| CN107881171A (en) | Nucleic acid molecules CTL4HSH12, its preparation method and application | |
| CN107868782A (en) | Nucleic acid molecules CTL4HSH3, its preparation method and application | |
| CN108070588A (en) | Nucleic acid molecules CTL4HSH8, its preparation method and application | |
| CN107841501A (en) | Nucleic acid molecules CTL4HSH20, its preparation method and application | |
| CN107841500A (en) | Nucleic acid molecules CTL4HSH18, its preparation method and application | |
| CN107868783A (en) | Nucleic acid molecules CTL4HSH2, its preparation method and application | |
| CN107955813A (en) | Nucleic acid molecules CTL4HSH14, its preparation method and application | |
| CN107955811A (en) | Nucleic acid molecules CTL4HSH15, its preparation method and application | |
| CN107841502A (en) | Nucleic acid molecules CTL4HSH1, its preparation method and application | |
| CN110420328B (en) | Application of SYT14 inhibitor in preparation of medicine for treating lung cancer | |
| CN100430412C (en) | Nucleic acid molecule RTN4BSR6 and application for preparation of anti-cancer drugs | |
| CN101643729B (en) | Nucleic acid molecule NRN1SR22 and application thereof in preparation of anticancer medicaments | |
| CN101328475B (en) | Nucleic acid molecule NRN1SR11 and use thereof in anti-cancer medicine preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180727 |